Empire of ecstasy: nudity and movement in German body culture, 1910-1935 9780520206632
373 26 137MB
English Pages [488] Year 1997
Polecaj historie
Table of contents :
Frontmatter
LIST OF ILLUSTRATIONS (page ix)
LIST OF ABBREVIATIONS (page xiii)
ACKNOWLEDGMENTS (page xv)
Figure One (page 1)
Early Nackttanz (page 22)
Nacktkultur (page 30)
Feminist Nacktkultur (page 39)
Erotic Nacktkultur (page 48)
Nacktballett (page 74)
Schools of Bodily Expressivity (page 97)
Solo Dancing (page 155)
Pair Dancing (page 207)
Group Dancing (page 234)
Theatre Dancing (page 284)
Mass Dancing (page 300)
Music and Movement (page 321)
Dance Criticism (page 334)
Dance as Image (page 358)
Ecstasy and Modernity (page 382)
REFERENCES (page 387)
INDEX (page 411)
Citation preview
Empire of Ecstasy
< SEs ee ee aa Set : ree Dehn Bs Se ns UIT nes cc al Un an
eee earecencent ernie erat tcni en ecto tmnt atonanseh ceterstnntoge oe stonnet ter chteeeeetentte ng ety Sle renese toe eabesr ets et | . eel nt BREST een La a DT
Bucuaeeneusuatiecnnaemamammncunmncementa Secaee aerate Sathaace neem meters tates hetataratosnt oa tatehe seetaeRlaracsralet acne atenwentatotuteetots Det VIED UD A DL Sn ee eo EN Se MEMRMSEEMRMEOENT orci re’ onece aiecesotovaterierecotesoseteresetncniecsss ataraeetene Mme ar CO AN PRR RRS RRR ER RR RNIN RRND Insc staneN NieeteLOO penne hetninestonnenar ieerentetoeete rie eeesioem Se LEDIA eens eS one haasneoantertememmeeeeneeae 2 URLS Met ages sex 4) INS sioatuannuuanemantun.gossenencenenaeemeeeaeeetet OO tataecatetatetseecineetatereneratarstata’coetetataracstetacesatetetstenatecncotetsteesten RAED yO Nv SR aN ee aatnantane rescontecshaticorseesscrieeesctrtnssrscrereeteorstertesanceroentate DAD LEED eh ne I gas tag TREE pidicheenaiunie mnt haautetaeinint etter Oa SeeaeEea
| ee SEES SRS SR ce Sica Renae Rae octane RNS CORR DRONE,
Reese eter ei tascteretereienerernneceneorienieceneuenesenertmaete tectrieeietenseeecrteiceeocs eae Ros aan nant eran eeeNAP eee PIII TIO aa ho RSA RE geraterateataretenstenaiecar RTT Betieren conte? SRO ee RE ve SESE ee Re ier ama eee oesterieues pire SORA serene SS a EASnesses RAS nes CIREIITE ISIE Sgn SRR NReee ot SUD ORD eRe RS eT SIcantante ORR eM ios WR SR RD ani. rer tateON aan SR a Ue Stee casa eatecencasei eceesepieeenm meet IEEE EERE SRN elas~ on ROR SRR fr- st ORR RRC. RENNES.
Bric sien es cneeranara sna a Ba centers sraspantenaaeieceseeteaeeee eneeataestaroeerreaneeeonctetinetetettsteati nner tatatyracere® RIOR fares ct scare Sotaretetattetaretecareietatecetetetecetcecietetetene tte heis soe RR RRR SSE t ets oto A RIS OIE. > soe SRC. ’-" SER ONINRR DEG anesRES soeenon pennnRE EE ee Spite a neSecescesereresnsteceesnyeneteesannttestateteecenaitatrenaegtae Men Eas tiger RETR ecoERE A Fenty OG: Pie's SERRE. RORiaRie ea :RR a Beier a peeamearna a ea ae te ae aera ome TONE RRR SSSR RS RRR Ree cccgaSc a as COI SSS ROR SERURRRRR Be tesssatetstanetetectcrecornieten renee jtegecetenenenriatermieeetanannegnten tet co a aR Patatetatetattet rier atest e oc setatebetetenceehatrentateteaetttet teint Siscesne hstarettatattaratiesntete eeietnateereisiortieseteieeemttenteseeenientes “ETI RRR RS Si ae aaenestassicexiee cc icc Tiel E Li rn ae STEIN a ERR RR ee RR ogee Las SOSH RR RR RR SRR ERS RN RES AOR coast tatarenatal erestates SOR 1 TINTIAS SSRIS SR SEI RRS as NIQQRII EES a aRNIL cornUO Tat, a ae SESS SEIS, einiaittasenttrctaresctasctonmarigtanneriententretteeeseaeetai erctater REP ets rnisec aden mannnummneeneamn nan ean eae mame ORSON Gn cena SeerREDRESS LS Se re Seso. SRR
ee Si naa ee Oe RR BERRA scents tari ea a RRR nner 2 RRR RRR Rae RONG, 2 Sg a
eS Re eR eet eae ene eee eet hanes EELS SRR SCE i Rane aaaSR NaS ROR OED: RENO sieetetes iteewtteeeisieeeetansieteeraeestentnertartanenseeiteennenatannenanneet SBS At SERIE Nate Sbinseelereaetennesetetetetenat eeseisseesete caecum eer eee RSE onan stenn i SESS “RRO Fe eS ee ee Bahan aueearnatan catatonia ena “CES RRR Se SS i a EOS SR a SS ee eee SORES St mie ii SOLER Bits PRUNE ERS NRRRR RE RROD Saae ee ROE eS ae ae RR ia RRARR ARaeRRR. SRN _nsSREB ERRRER OSEDOR $e ns RRR ree cnaratatatatetatidetenatstetnienrtel cat etriett cetetetet et ctatetatpteharetatetatalenavatec asa SOON re. cca atatat recreatesnsstatwasetatatetetetatatS Nn cecereyereseceraeoweale.o syevenelRrorteaserd @o8.an# 3 astaetatanetatetetatatatataystotetatetasrieeasecee tn Pe a Roinnn canara ae OOS DRORERIIS. SEI 279.8000 00005800", Seah NNER RN MRR ORR. RRR RN, Shh a
os anatenencontenatettatatanstarer trteneresersptesotaieycettrsarenrtateteet aetetat rene elfen! Aanhel aRstotncaterrtanslabate EN eecettseciricvtesetespnsagngneeycteneepenetatnae reseteateansninnegeeterreseeeesastangrcneceeeeetagegn tpegrataetsapneneotaeegtenametatetrets EESRRS RRR SeeCORT. aia eeRRR. SRR PRR ERR ERMA RRR M RR NER RRR siatetatetatetatatateret Carag MARR RR ec ceenene ernesel tat oseatetatatatatatstaretet tata aero eregegtatetetetet ttatatate! satetatareteretatattet eee RIM «80 ccSe'ciacateteete aretens NRCS {CEE SEES SS a NER. .2:0-2,: RPC SRora RE SoS os ROI:
nee sirrsmanrtaniaseaemateanies oes coetenepeeeroueitee mete me em at ghatahetatetetatetatneetatetetete: MOGRROMEY soi sc sec eonoSccarateanscoTeh tOstacac tatsaren fat a: eR.ericotetnaeetnt e-store TRG URSIES -- Seana tee . 7 ee ee oe Tle CON rer er nee SESE ESTEE SOT EERE ET SOE EO SO TEDL acca ae lee eae eect EUW Da ETE eT OEE PE Se SEE DRDO DACA OT RTALTOLOLO DOTA LATA WT BEAD SL a LODO OCA ETCOL ALOT ete WDE OTe eta ec eel pt tel acene Lanes peace nec and eng as ptt ates tater aten etal ett eaten gt atatet eee taht ett g EES a eat retreat ntti alr eeneta stat ett tetera aera ter teteitrivetgtre fe TE URES T DD DUR DETTE ES Ln nent ee ey
nena gn Dal Lelelan cabecacatetacetelate etetaretal lalate elalelerscerene, LaDeLenelelelsgeg! Den Dees cee ete S eee CoML TeeD APDPLPLSDMPENTEOEOE ORE HLT MALIA ALE Setar Atatalee card larered eal ar eTetelereTa leer alate aL eUtTg ALU CMAPS P LEH LeL eA LOA LESLEY BGA T ELAS HALTED ELAS OLEATE COL a LetTa cele a eraTa Set cere Pera ee Mette tlds Te TTD OD DED DOORS AOR GREE LG NE EGU ECE SLE BELG GSE GEL, Hee eeeeec eee ence eee ne nnn een ae ae ales eee IN Dg TD SLD ee Dae abc ca ace dae pera Lagerer eaceger aya reLeranelaceTas era latataslacdratgghrghth tecdganre fob (c acter niga ye BLnGar DeRtD Arta t. Racha La De Ee LALs te aaa weet gees en ee ceet Tea eter etet eat etety Mrytitteee Gon ‘nati et TRY DNS Dene ee Ee eee
Satie tir erecta na SS SPT Sat SR nS SECT SO SE SPO CaP CSE rh titer SORES SC STL Sr ST BSC RE NMI SESE BC SC SSDS OC St OSE NOSE RC OUST SDC ST SOC DUR SN I SBE GS SEE SERCO OE MS SESCON ESR SRC SS OLESEN SESE IO DES COCR RIEES IN 8 “a SOS SONI Se SSE SE SESE SR SSCS CD OBR ORCI RSPAS rach RTE Stt etn DAT Se arate ae OSPR aT ta Sar aT RSD ES Daa at Sat a Oar Sea aDaEa Ce aan nay at at et ana SP Si ie SACS Mt SSC EW OO BNC MOC EK SOC OC SO ACC BD CO SS COE LO ICR MSN OC OCR ED RRR RE OS Sa SER SC MALI IA ABI ORNS Oo CS
eee n enna ee UE Llanes oldalatatenaletesatayareteterererefepatasatate sere le lepenelarweagoeeepeestaesg sear eyes sere eegtatgtesgt tet acacereeTer a eTATMTUTODeTSCeTUPOOTETOETOTSSSTOTITETDTOMITI TOTO TAT ETAcarabazeteraraettetsratstatecetotetatptetetebaterstatetitetanetststatabat tated tetitstatatatetstetetetettepeteters Pere lacel: Sear ana SR aE Star Stat SP mPa SIE DSTO SESE SOSESUSS SORES OE DESC OIE SLES NOE OLA SEES SOC Sennen eee renee ee eee en enn ere eC nn Ree mee nen nena en ane aa Rene eee R eA ene a era eT ATRL are enh ee ae ada Ea ETE Bear BT RTE BLUE AT ane BRT A Ded BIRT E DB se BRO ARE RRR T A eee ADE REP ASO EPA EELS ELD OLA ATES Dlork Sd 9 RTE RETO PLOTHLD EA TOT ROLE RB a #8 OMA aleceralscecaacecale evereletalaleleleca stale lelaTalee stylet tale Tahal ale lete lately ele lelel elelalele alata el atalel ere el
aye etet tere tet wht NEaT Chaat oeatt GCSE DESL SO SESE CENTOS SERNSRG OC DGEBA Bi UiOOO SSO DESC SEDC EMSCCC CRSB OOOO SEC SC eRt ee CSE AC ae DE RS oye! AEE SSCS EDIRNE IIDCatDIN GG eee i oan bahtiESeoe ono cater claUe elelel eenRee! Viatately oetele ws SPORES is te enna SacSSSCMASE SME SE DST OnabeatRaton the Gt Or od OS RB SCE Oe SCRE SEE 1B SMB COE RCRD CO OCC RCMSC SC OCB PRSEED ees eaten etetinatstaletitatotabuetptanetet staan steerer ete Nao tatetetote ctor eateant, cE et MBE 2 PTE BUA Pea ee a ae nPan aT aa Ian ERTS ISTO ION IIE SRL DSP aa SEnERSO SE REL SONS ROLES CS SES a SEED EC at DIED aD ERD SE ie ta a a Se BOO at a SD ESE EDD CORSE Br ON DES EOD SOCEM SCOTS ME SION DEON SPT EOE BECO ONC NEG OSE CS OO ECAC BER OO EROS OO OB DBRS EO OO DO DC OE CREDO 2 PO
RRR SRE RSENS NEN RMS K tN RN SMEAR MMR MSE N MERON R MENSA ES HE NE MEM TNR MEME SEMEN EM MEME MME SS SSNS EMER RMN Ae RAN MMR MS NK RMN HMM RS MORN RRM OREN ODA RM RN MOSS RR I GIISCOSILS SIIB ASRS SS SEDGE LOSERS EOS SDDS SSE SP SSDS SEIS STS REDDER CSC EET
RSS IIRE SES OSCR RIESE STEIR ICRC SEDC ST Sea OSCR SP SE IC SST Wad EPS AC SS TSS ICP SOC SP SE CSO ER CHD WEIN TES OC SESE OR CSCO SSS OR RO SAC DL SOUS OCHS OR ESRI OSC IRS DEMO SEIS BES CD EE OOS EO OSE ORE CSIC EN RCE CCE OSS REO IE Bitlet sliytptetetat et eatetetetale Geeta adegeatptatetstelcstalatetetetetateteletotatptatetntatetntattetatetetetettaletatetctalatataretetstetatatatecsteraterstatetatatatetete ne eletetatetatetet ete tete pete eats t ete teers teats en ater e Ee ESE wea etetete slalaleleleletelalal ele] elelelaleletalas elele! elalalalalel piel alal eluate eles lela oltepereacalesaselelelare elela lel hale ala a teletal ately lata tale ela stale tatalelalelalelplele lee while Tale lelele lel aly a ete Pech eR SORSON Cet i SN Sera Rte ee RMN SRE RE NS SNM RIESE SR SEMAN RRM SRM MRR RN NMS MM SMS MRS RSM RNN MEME MRNA RHE SSS Coe MRNAS MME RSS ICR BRS BOON MESH OR SER MERON 5 0 i Ot CLIO REO SCO OC RSC SON RE RD T ESOC OC OEY TRIS SSSI EEE CEUTA cececate TAT OACADMDNCOADATOCOeoy OGL ATA CRC OSACede coca a caCecec Aye acelAcea Gece aceP eee eigen eyesel Lara ane elerececesae ate gterenilate eta elasprerstaetatataneeseiscepetelelgtvletetreretasyelatelererate ete otesa adatesesectetetceceearaterehagatesscatetatenacetadateletelslelatanataesrenaeneercesacetereteteneetercnats ef GT once ete latent ta ae DL a at a acetone Seance renee ee ccna nee acne eee EEE Tah Deh Laobatagete Lele che tenctetets pel eeogsne tegen ubegegegegegegeeegcpraeyhashehcatetecetee ater aCaha TDS STUCUTESTUTETATETSTOTET DESL APETOSETOTSSESETTETDT EHEC AT A AE EATE DAT AT TAP eTORLTASUEALMSAUFStsbatatatathte MotahatetetetsTePetetetuteteten sZataterecetetattetetenetenetetetetetatebaeeetetatytetatotaccter stetstetatotteteret Sctstenec tL MAGEN AIS eralele lela l eal Teele lela, alae alley yale ela alee alee
LPL LIC Baad am eae DLO AD Gann SELES SDL IG a Oa Dan I Pa Da PED P aN OL NLD Seana LE Sema O aD DEIN Sen aman Oa Ni Sana RAP aD I RO at DiC Anaad Orne a RRO RFOT Td SNE SECRET ACTER CRO Se OC Te Ce OS EC HO eee CB ORES ROE EC CS SE EE ME DEO Ee Se ee ed terete tatetatgtotetate erate pha plate tere satel stele latatan et ptetteta ate tate e a pia ptatetateta tata tetatate platgtetatate ate aa atatatytete totale ets tatatetatetatatalstetatattatenetetetats a tetatal el tee tata teeta t teste Eat te tate nest ate tele eta alate rate te et teta el ara tee stata aetna tetas alate tatet state Mlatararetetatatetarataterale tata -fargtarstatarant 26 RE ea Pr an ete Paar Lear Br kr at wae EO Re ae nee a a OE Ee SO OO ad Oe Oa ROO aretha cea ee Cee ALT g ag BREE PEATE OE Pe ETE ERED BRR Beng TRO E Le ER EME AMO AD EEE GES EPEC ETHIE AO OTe rel OCG BOO ac eTeIBPTHLPTELALO ELLE EDR EA LP ELE YR ELaLOTea ra raTalaretetelaventtecetetslataletsteTetalatatsletetetately al stetetatelatetateletetetptad sls ete stata tetrtets SENT IOO RGR CL ae at reer ee NE SUE Os Ene
CREO OO OE GD OG OL OPI Naim Ee UPR Da Ett ROD tL APSO aE ROL aC ay aan On he Ot Bet at Ot SP EE BC SE ae OO OR Se PO St nD Oa PO SDD tne tS SCC OL eo WNC OE DO Oe Heese ne ee einen nen en en ee RUN nnn nE BEC a ea eerie Ped COREL ESP nae TR TELM ALES E rd CALA LODE PLODELT REED CALMS ROBT REA Ca DIAC ATL EBTAL DATE ACTS TATED CO TRTO ELBA BLOCDLDT BRAT SE ATTA RO TOLATE MTT S ALHT LODE BIE TaTd ACH 2 bere erelareralelel elelelelerers stale eteraae ¢leceeeenerprare cr lata elelesi Tela rie areaceia’ereryrererccare testa leis laig elalatelalelelatateletalale se lylatylelelelilalelglelelels te abate oly
CO OO OC OR DD CO TO SE OPO OO OSS SR Ua ISOS UEDA O SD OE ITED SEE LND Ga LDU ROSS ODL IGT RESINS SE SESEAGHERSE GG GESD SD SOU RESOLD SEES SST OS GEE Su ht SSC HERE ENT ta OF BEDE RE NCS SENET DETEDH SRE SEMOC CEE ICN MC RERECICOC ACNE OC NNER ECS ECE DCC OE ED
Scar a een SLSR Shr ON ESE GS SS Ene Stee ST Dae SE eNO EM Ee DE MECN S MEME PE Dee Pee NEM RY Se eee Ree E ARERR CER RANE REMC RS SRLS NEN Mee NRE SRR RR RENN MSE A OMENS MRR. ° 5 OR a CN ORO SLD ADE Tans DERG a SR ae REE OSE DEERE STIS
NC OCLC DEMIS ICT ST OOLY ST ORR SO EPL GOERS TL OOS CLESDEDL SB SSS PSTES SITS EERIE SO SRD SIE SAGDCH ian LOUD RIN at Oca NSIS SOS Ua SI Wr INL WO Shs We Ea ota OSES SOE SO SCN SCE IO NEC MACS B SC BSED NB SC RBCS MRM SE GCC SRBC SCOR +6 5K OOS CE HES DR RC OCDE OS SCHED CODER iaaron Ce SSL ie ISCD a OO a CS aan Sa I Oa Oa OL Ea aa PLIGG DLP EDS a ae ean ena IG Tris aaL or teat a Pal nnaD name ania hs rar noi SP eat a tr neat mr Ge Br ae OO SERS TBE Ne OE OO Be EER OO OC BER OB DORE ME OE CO DCE CC OE ee Oe OS «ht OO OC ee GPRS ene DC NAL eS S ASCII ACO SSE IIR MICIG ICSC DO IETS MOED SEIDEN SDC TED ERO IEIEDEDEESSEDLSLOENL FERGIE EIEN i SE TUSERD SDSS RIS SS eID GMO SADDENS SOS ECE OSTEO can OGRE SSS RGD OLA DOSS AT St SE Da ESRD BEC aRC ORS St OP aI SCC SPAS REDS enc" Shc a Sat tn St SRR ESR Rie ER SOS SE HOSE ENCES SRC SSE DE SS ER ESC SRsSanSSauaBCSIhe Ont SCaS SSIES SERS SSSEDIOELSSESE DI SCOIEHEN SS STDS SOO-DCSEDDECOSODESDO DIE SEIS EIS SGD SECIS IEEE SOPEDCOE RIED SOESCONDCESON PE ION OCH OCR ESCHER SSS SEE SESE SSE SLSR DG DES ORI OEE SR ROC ESDP ©. “15 1 a See BONDE ISIN SSDSSE RES SEOS SPOS SDS SESE SSS NED SERS LSREES SED SEES ST SCS SIESES
aaaaeSaaS Daa Sean SEDPO ann IDS BORD SOSDENS SP EMERGENT St RPS SCHEER OTOL SPE LEO OCSOT ESOEE MSORE ER ON Oe Re OR Se OL ee SC IN ECCSeeNOC FeeAco '0 KCcco OCoe SCneSOL ce TO RR ae ae eeaaa i OaanG Oe UC ae a SE OGsects Se OL LheSS a ROe SLene rae ae eaeRene are Een aeRO ies ae hear LeAO aeDE aO BEE nea neat ae Ee EeNOME OP RO RCC OE NO OOS OOCRS Oa SEE ss St en OO eaeOC aDO enc ca ocBS enee Coie oeOc Ae paaenenanenennnenans avert ere eee PSPLh a ae ne nnn OeRE DEarate DT DERE BO ad TEER EEEOtOO DCSE OEOE OT OE OTH BP Ot BEEOT OEOE RESR OPOeOE SEE ED DSS OPCe DOES Co eCoeCe eee Be , CMC
Seen nen nee eee ne enn cence cnn nen nee eee ee ne een e een eee ee Bern Ene eke BEBE BOT ENS ETE TR a wR AS BERT LSBE EA RRB TTA ATED a BOE BURA RERTSS DERE O ERT Oe E RIED CHIBLE DG AE AB NOAM PEN ENDL pw TR TOTO ER eT PRR D OPTS Ore EOS OTE DN BATON Ea HAT OLE OA e aOR RSD A A aca OTATaTyTATg "a a olatpe"eleTel ots oleleTatele eTelalalylplalatetelelelalelgleletylals late glelehs lets lele lalalotalel (oletel alate Lae eee eee ee Oe ee Oe GLE DOE DOLL DL OE OE Oe LSP e Oe area ann een Perera Mar arene DL Cea aeime ar ar hme ie ht SO Od Sf Snares Snr ae ie aan ar he at aE Oa OE a RO Ot Oe DOO Oe TO Bt BO OS OE OE OE OE OE Re DOE ORE MRS 3 0 OC Oe ee ee ce eo ee ee ee enn nen cee en nc nc ccc ce cen ence eee aE Sr EEE EES EE ASTER ADELA Oe S ie S ELE ENDER cane peat MATE eae er RTT ET RTa glee aADPLAH LE SDORGO LDCR SLATE BT BTICES IMS MEA ALBE BSED RLE TDC Oo tee g COED LP BELELMEBT EDEL DE LUCE RHL PEALE ETAL ALA LALATci Tare Lose T A BORM Heeseepra areca alerecetersrasalete lens lelecalara laterals ler elalarapelelDaladalatelelatalelsletetelebetate lelelateleleleleletaletebelaleleteteleletel
Leanne rec crcc ccc cance ence cence ence cen cn nnn ence enna eaniinintnnn nibh nnntenaasnnennnnn nian naannnean nttearnennenssnisen nhten ms intismiasenm nice m tinier ncanincasmtnernnn rer inniasrrntecnecsstegeetetanter sen aitiiitencs cateaetels guisielsietensinceteletatnvettenceststtetitarmac tite carte titelgte srt Sarna air iaer tara ar an saner nan is Grane HnLIS IEICE DIDSESCEINEICL ECCS CSET ENOCH OS OT SLED uC CMa a DLL oT Gai Orie aris aS ara SE hata haat ata hy tar ar ana ee SPST aD REET MS SD PaaS P CLC C SOT BESS Ot MSDE ACE IC SOE OE AD SOBRE ORS Sg BORE "00 SO oS SA ESCO EE EOS ECO CD SCRE EOS
Sennen ce cae nee cee n enn cre cence ne cnc enc nccncecnnec ncn ne ene eee Taal ae RALA Nea a aca ere nba LaL ere Eay LOO CBTA TENGE EEC DLDEDEALALDLALDELOUOC ET OLATALPER LOCAL aL LALA, ATRL CA ADELA GE ASSERT, De ELEM DANCED ALA AAA TAL TREATS OLD UTA OP Tt CELI Ck HERE CPE ACPI SCSI OL MELO ROLE POLES ORION ENO LOL RLDIALS Ts HDA Lace raTare eT eTere alee le lala alelelelaare’s Telelalelelelalele lalate le el alace lala lately sly els Delete lets aera taal yeaa ata!
eC aaa nea aE aE SEE SE ee ne DEO SOC IE NE DES DEY SD aT ier eis ras ete nine Orr pena OPEL TL Str PDE ar aha Saar at oar Oc hs ti St Sd a te Se te SOL na oN SE AIRE EO OSCE SE SD CCRC SCC OT DCT CSCC TC SCI CDCR RKB» “8 WOO OA ON DNS
cee c eee n cnn n enc cnn ee ene enc creer ee Er nr ee re eee eee eran DL DUO e OH DUSTOReDPSUIATEDADALATADDTATSTStaPacaatetatatabettetacatatetetataterarststptretetehatetetsnerslatatstatstatetahatetatatatatatatetetorstetstatetstststatstetetitatatgtenststaterattitotateteram Re sere Oa hcian seit OC SEIN SE IKI EE SECC BOR SSCS UOC ORO Lene ecnreecnncceccccccen nce cccn ene nena CS SAN LOD UTED UDETESEIT cot SCee DESC FOOTED PODEOT SCOTCH SEDEUH GES DEIDALTAEDE ARDS GEL OREHORSBASHUALELESEPIRIEDTLHOSSDPSE BLED ATHAGHORDADACES DALAL eID LATO ATILALATA oa ADUCaC aval lala lalalalacicerelase a DOTaTe carpet arate aera aac o el are ee MP ie Octe et te ALTA ATS ns eLareLale ce elena Tele ele al ele a eg eee Oe Me
TASES EIS SEES eee toe Ce GU Se tase aah dete tea a ee ta teen ad eb tetteuteg teehee oct ane eloce ce baaaieneisteieleseisebenstacasdactsbastes ttioiseasteisanensianniessntessneenmgegmanancnestmannneserentenints Seen eaeeaL aC TRLa SEB MEI CCE Daa SaNII acs aI aaa aEDDL SD OCTET Cai nnerPRD Ogt TESTS ic hPa ao chsLAL AEDES DNRIGS aR aeA SEN aR Sat Bt the td GAC SE MESS De RDS SSCA OSCOe Sd SOE ECAC «ot DOA NSERC BD R IASOO ROSCOE SO EO "1" CSE “0” ER CCDS Perea DNL DSDSS SEDCELIO IESESen NIGH EDAD MST SC ORIG LICERIESUDE Ia GoaSSeS CIRC DRM ChE Disa ts at i eran atari Wr GPG Poa Le SESS hia eth ht hat Oc SRS Ba SESE" to OSC BB IORI, « DSRRR EEOOD SS RON DG DOE DS I
Sree DER SDD SEEN SENSES SESE MRD SSE Sea SP SE SSDS GOMES SEE SED SEEMS SN HSER ON COMER N SS MNS Sa OEY SMM NMS RMN BMS RMN AMA EMRE R MRSA NNR R ARRAS SERRE RAS RNS SRD. > °. 7. SRS a a Se Se SE OL ICS ESSE NI OS aC RL SO RROD SEU EOS steele eter iceiecethcate i etesecela eleny ara eect taretacasegetetetetetaney cpteretarecefede elec ensieeeetetatets reteteiatate stat neterlelsteentoseteseteregeteraratal este petteteteysteseneneceteeeteretstetelagezelopepetste regs egerenetegegetagege otete Gate atatetegots aQetets tate at gotacat igus tetctate tates tateogiweaneeeees coors sietegegtateet ae tartan titre ssaptegetet soos aaseser cash esepeegetetacatan testes acecetaceceg car cateletetataentutetecetete
ena nae MIO RIOD DOORS iPS SSS DOD SORE PD SOD OGD Sr Gs SOTO ESO GOT OU SESDEPLSDGAUD ILA GEIS GI Brana atc SOE SPOS LAGE IC UP Ie APS EST SOS SO CS St RSet RC MSO BO BCR CO MOC CCN NSEC COR ODOC MSE SRMCE> 20 S08 OC OI Ee Ce SOS ER SO SCC . SOUS PLESPIOEa ae SSaIaG NaS PERCE OSLESE RISD SRI SE SSSR SC SER? GPS OPES COS OSO RES RN NDE SOI RENAN BOSE NOT OUTED BSL OPS BESET OOOO MNO NESE NO EOCENE DO OR REN SE EEO EN CO CR I EH OEE &»- v8 STS BSCS SE DC CC eC CR TDRSS Scaccecetarepa cata etetevecedesecefeticeteata etalototeretetecesptatecetelteneyeie! retetetetetetatetiteteseletaceteloserstuselerylafetetetata'ateotptatatatatatesetecetstrletats feletetptetatetateceletgtatetafetel tatasatetennsetetetate stetatezonetetesutretenasanctatetaterstensnatacttaneteratatosuacrutsootutgiaranetetstenetststceaaimnsegeantstotetetegetetcrorefelersreperctenetstecesetyslefetetstisetedesysasysprtens secareceneripioa sep toteent oa egetigaseceladegonl Detagetelatecetecetane!
Sennen ei ne nen ee a enn nn Ee eee Onde ERB CE ee kd ane EER OP eed BAER TARE BET eB be Bee EOE RR STR CR RP EECA 8 CE OTe OE LOTR ATU E NDOT F RTA Fao RTE OTE are gn geele’#9Tu gs aTeTe eH ea 9 ee MMERIRCU SEA # ¢ ene es svg p Ore nop rca lerererare slalete aletatelete t-Tatatatelalale plefelelalelelele ole stalstelet taletateletetslele’aletelslelalele te leh! A I PTC CS a LP a OO Ic SOC DS LIN OS Daan ata he Pe a Ser aa aT Goh tear Ran a RSI aD SMart a ater at ha ahaa ht he i ene a hr ht Cart Od hd it tae a ad Pe BP Et a at dW ee . in EEN Se RENE aE BERET" ” 5 “aie a rater heer Ree Ot a ae Oe ee ee A ee ec eee
POE a TaN OS Peas SoS Ga LP aOLE RT aaa aD TaD a TGS USD USGL Ot UtGD big OUT St SDL? avd Sit Sat ta SPEEDY BOOST RO NESE SESE BOOT RMR SOE ACRE ICD NY COD IOC MEO BR DOES CSE EO OOS SCI CSR RRS 52 ao Pac a a ORO RRS ERS SS aC RO tO EER SCE ERE BS EE EROS
Paar atari a Seana reapIRIN StarSeed iathe SDGT aNaEea taeL ISStS BERET REDE Or SE OE REESE OSC SOOT BC OCS OCBOSSOS HEE CR DE ONC COICO | woe TAT EOL a aeteeeht aCe See ATL ESS ar Areear be SCOR ERIS IRt SEL ESA TaeSE hina SESE SaR REESERGE SECS ORNS td ENCESSEINE Oa RMSENCS SD NESE ERENCES OCCDESIR SE ESE DESC SONS ESR MED SEDC DR BRR NERC NED OCDE MRO SOS EAEOC REO RR CLICCR RS Syieeibeee alae SeEES OL RRC: 5 SCR Cae eea R eeRES SaCEe OE Ce
. het etat ete tet. TET SOIR aT aE STR a etna ESTE SES Ca SRE BOC OE DLS RICCO SESS NERS SESSION MEMEO SEC DEM DE SOR EOC EDC DL HD DIE DERI MM EE” ve L ate se 2 rn ewe : : an a SS aR eS aS CnC DIINO IC NEAL ODE SCI ERED DEO CMOS SE DCE CE
. NE en eR SSN MSW ORENSicSNS ENN MSE ENS RRR NSE SAR ME RAR RM SR ee RRM ee eee RNIN” ew Boas sacatatacetocerenacorererat sre Te cere larscerere! apniecrcsegsre scent ar eertgtaccn sea renerses sDererale ote ts Be Tata Pete elena tate tate ae eee ED oi Cees SEEN PDC SSDP STILE PILI SD Sa SSEE SEAT DSTO SSO Gs Sr LSPS Gr or tis tir Sis a Ona th a at SO EE EO EEC SPAS NOt DC PIC ICN SC NOSE DR SCE MRR 8 . ‘ Tle ws ivecatattetatatateTocecererene yeti cetatatetetatacetstet sth ily totataretatetrtnte tate te thar etotate a lotete arsteleta tates lobeststctetrtetaterstatsteerare letal eta Sen eee eee eee ener reat deg tala ata Late Late elot aera aege tee ge Ut UtEsDhCtOtheyHUPaPat etter OTATAPTAT eter OMOTOTILETLTDUTEatstal ot BSSDODNTOtALaDODAn Here cacatatatel acecanete Sehr tenatatatatitetntetahststetetvtetatstatetetatitatrhtntet sts geal ee wa Oy eS Re aTalelalalelelelelelele te leletetererereaelalerelsrelere cate laleleteletelpreleraleloetelaetelecelylelelaetete!s TOR TN SETS IGS SES SLE pce ee EHH ALELEDO BLD AALS ADH Ones oneDapLedatecacacata ace avadal retical etetetoteletetetay nenemennetareys recearigiseersanivarniniemieneat teetering aa SS Ne ee een nen neta eco tnminaeennseneasitaca seananassten satis tote aterm nnstiennnness
SPaat eae aP ea aT DSP GnaE Nay Stat AT Stata at Att St tar Oar GOT ad Stat SOS Se SNe PCa SERCH PROSE DEST MOTOS EEN NG HE Oe A SET OSE OO GE SESH SC ERC DOA ORCI ME SOE SOE SECM TEN BN DN CR ICN I ORIEN. © “ PERU SC haa Ty "o "so "eneceovochc ers corerecace nrererere orerstetercteteterela state lererelacersrare ttateretetcnsteretvrsra stele ateterete tarsal Letaty totes tele elage
eee ein Da Lnee nananena TENS DSIene tt a ONC ar neea n ETE GoP Eta ENtrade SSDSeet OLDIE NE Sea SETat is SSDNA GSES GRACES OER IEICE OE IEUC IC ONO UE NCS SRM ROEDERER 9 neg! 0 ORC REC ae an Se ee eB SOI Oe Se cece eee ene eee cSt tn neat dadOGIO tet eet aae ete retePOCO eet RROnEC ts Patptat rate tanIStata tat SEER ae taTtaratatel trateOEC statsROR eletetate vests talgtatatalgtanelareresarete rages «te AMTo.eine: “GRR ORE DS ee Ce LI Ne Oe Sa ALSTON ar CSD SORD ETS oa DLAC SESE SI Siac nir ET nt or GPa A RS SRE Snr aD PSC NEO SORIA SOSA ORC BIS SCR OC Enc Oe Sk SOAR SDSS SEDC SEDO BODEN OC SONIC IC ERIS NICO SOR DOI” Barr soreense STEER en een nee eee cena nee e eee EEE Talal ola regener abeneprer te riyen tayete erga
SS A Oe Pe I ©” Srerareen.” 5” 5! aT. wnt cist: 1h SSE aaa ae eyerayestetatatatatatatitatetatatateteh tet fetatetstelatetetetetetetitatets
CSP Aaa SEU PSSST EES Ea LSS tae LISD aT ea Sr a ASSES ERS SaS ENN, SALONS ESS SER SEES REN SORTS Std OER SS aT DSS BO SSET SR RLSCOS SC REMOTES OSES OEM SEEN MOR ENE SM SEN AM OMSL» 2 RRR SE + “ a TERS OC ICICI IEDR ICE SCTE A OPE Se EOE CSE SC SEEN SOE COU CSE RS
TEAC ae en BTCC RSG BT DESTATP Bead DETR DED ATE DLT EBT Dea DIBEA DC LCATO ava zeH aS ES pape AUC TESE OCELPURTETOCSUSBCHT BHA TITHE TACETATS ATU Teer svar atelarereTite mia_eretelplalecrnitracelereleceeteeleret perartlarget ever’ es Mama DRCICRIGR OE eye, 0c00>.* 0-01 nS EMPRESS ool ealal nate lelotateletetee tate tater ai tete latent totntete cnet eatnnelegelareneiegeengeter spare ansyepe gees rene eyt ree Aare te ge
ae aL SET Pata t OSES ICS SETSES? OES LE STUER BO POSTION SC GPRD BLESS DON SOP RC REN BU SESE IOC UNC SECO BS BAEC MOOS OE OES OC Bt BSE 80 Se OO EOI OID . CREREDEDE REMC ava” 8 ae 0 e_+. 0 OER MMIRGES a 'e'a“acalacyreretetelece arse leraralereece eee etererecera rire sree endna ees eeeteara nese nee ere ere ert tae treree brake Cal prege carters! a CL ERSe I Ln am Panera Sieh ane ara aT ar iain he katate har tag a he PE Cal a ae Ri nh it he hea ead ae se eae 2 gE Saar tr atte eater at ht bt St Stee ee Oe Se Bae RR eee ee ee
EReMRS SN NICK a ORD SB SCC MESar CACM ROR SRNiret BOOGran HO LN SRR SRRROGIOER 8858 atten’ is eae (o's +ee OSE PEtre SPARSE SESE SS SD Senay AED SC SOE Eat RSSESC SPEDE SESS iRMR er era aan MMR ieee Dena ineMC Naess NPICDC a mara PTET areaCNB narLM mstMH rrar araCON arr eae hr DI iarOD anar arGRO Sekrinhs iran hierMERE nara NCD earner ir ecet ete ated ROpete ICSee eCnenecteetitanineenenegees . ere a ee nate eT oo w n-ne 4-0-0 6-0-0, Oe tenet omSOROS os SEAT at RCI BE SE OC TTS RESTS tats tote Sate Tee ea eae aaa ai tea ee egg er tetga ned tceee cee erent eden ene eeenenene eapetinsesnegecereardae tert get maseestatenaneraternienetrtvretiscetenenteretinnse ee ll RAD MEARS ys csec notte SAM ccretchepscneecenceeateetussssveatacetatercmeanicrtceranoeatacessansentesecaterrtantwrccetetarensmanceeteteta ats
a TeaSeSr SES Se Ce Arar Ora Sone h aca E SRE hehe itr ata or SSC Sia oe oe She ihc bi bcd gt ta a BD te OD Den CD oA fete eatatete” a vate ioe aus eranetatatetetenehei ste et wae acne serene reecatetatetaenetetacetatat pleats otatatetaleln el retatetetptetelelratereotatatetstete eiatitetetetetatetetrateteterete
LI Oe I ee tL Trae ht LP thea apt th haPa earn ae ected wiht Se ae ait te ar a hd el Pa nad Mera ih he at heh CEP a” Baran * aes a Ne RAE OLS - ats 8 OREO HI RCI, SLI BEB OSE ES BO SC OD ee SRST aCaaaSaretha att Bt aD tat tatitaSid 8BeaDAB SS Oat SN ata IS SOB OO” 9 RR TOTALLY a NS a SC Se Oe SOREN SLICER SSS HENNE RIINS Pere ae ar tanSTIs ae PRN aap a atelier ania Wa ara it taI DR aS Oo RTECS Be1A ae CO ae Oe OERARO NS Rta OREashe Oe Ne ba OE >, CR erate a ne Fe eee TEN ee ee cee enteralOSD ataratete ol.
IAA aca tate eae e A Re eRe ee Ane UEe ee TS Eg SP ae oW BEE eL On PCRTE DT ot BIrd Le RTEG MAELO Dae BtO le gtet tare etalacdlatalele ntonenecet ater pleTatetnerarsttalerstrtatersterattiterstrtststentarsreteteretseeesteeetete Ae Ree! ue BEER | Fee een eee cece nea cc ence nen ease ne ae aataesetestariegentanecatateranetetecneaterteatiss . aan ee ne en reer pare etre a reletelath ener a Oar carncatarel stags tiers latets stalataletels alate avelazeratege leeegsghaheatyatytetetetstetetatetatystetetatetatatatatetatetatetetetstetatatetetetstatatetstatetatatst Sai . CMR “os rots $a'a*a‘e*o a aarava ace aa ORM ee cece esa cecececececelacecerspiaceraseyececararecenelervoese flee Reet tetris toeca taser #ereraca alata eleletate ale tatelar terete,
Sear aR Lanois atte SERPS RESTS DES is SOTA SELLERS GEA Sean SRC SE Rhee St ae CE ERE BE Se EEL SRS REDRESS DE ERE RC NESE SE SEM SM St SENN EE SOS NR ENC eR NON HOI a ey ese om we ete + SR ta*ececceresecerece era TENN SSRI RIS SC en Ce
SPSS eee SENT Carer eaRONE APRN AC RON Ir Sf SP ee HOSED OE OR Oe SE SE ESE CSN A NOOR OCR BO OC REO OS SO ID IORI = 8 sR 8. velatehatetete tetas: < ORIRR SIMO... +, 1.0. «” Sa aN A OC Fe I Ie a a a a at arate at naa DLS Saami
ee ee ee eee taeda yt enatatelalecaatateletatatereteteteletatetetete stetatelelateteceatntateranetalstace stat alalanstatarara:ecaratarelatelareceral scare Barer al acaral ays resas tenes aca area ASC RTAT# @ are Brea 004. Oa 6 6S ie aPC Ws Te RRA) COOOL RRM RR ERR RRO I RR RCE CIN SM MIR Ra MTS ISee a aee OO a a na a ae ta hi at he ae ar te ea om aD «> "” ite 5 A SPPUIN a ‘oA TN ROO RNRste a Otr at eae Ne ieSCRE ae TEREST Ws SOMEDMERESMRE MEERA oa" y"a"o" precede leies ane arate crated eee ‘Rietisielanhsnosiennccnniabb ine tenets | MRE RR ROE RON Ro aR RR ES RRR RER RRC CR: «SURE. MEN EN IN REMREN 6 o62 0 oso ccccockeecrcene ele A CCA ATA HSINI STSLATUeTATA Og Gels (pip BLESSES e A CHASSTOE STSIETELES FFs F sLEceSESIEV. 0 2 0 ST S00 RR CRE ROC SN RRO SENSES. = CORDES” gs ee RPE OOS SRT Oo ESERIES aaa RAS ‘SRR RNR eee KNORR RRNA RSS ASR SEN Te ERE SRS RRR RINEDD SHORES v0 1S OREM MC RMRRSEREDES © nero cenenecececeteceecrecereteren (eteteten te NOU Ucar ns BST Manele ener MnO ASG CE TE tet at aac RNs a RS RRRRRRRDS . * Oo oe Po aa oe MR SSS aCe DOSEN OSH eM MM MOMENI NCNM MMIII $06 6508S" ce CPSC OCRMEERS. |.» 0 RIES 0. sR ROCCE ICR CROC SESE SCS SS ae Se ae ea Ea ee CRE IICR: |
BO ee Ne een te eR ee RR RRR LR IRIGA* SEED. ©, °- CNSR MIEN RNR MMBC F800. 0 Ca eee a AIH LULA LO EOS ae Weare AeA eC CTE G a ea re LUE PS LLP ATA LOC USO a So RRR, s-° “0 SPRSORLY 5-1 RNC NS NSS SME SSSR eae RESORT ODN LO SERT RST NOSIS
BS Paeain-”, SERBS ORAS RBI” 28200028000 SSeS A ALVA LCA oe ace a caL a ele a Taree paca e 0 RR CR ce AS eee ee ec ca cc ce ea eae ae SSNS OD SS RSS EBERRON SPER IRM 7 0 2 C0 a a" tfatateeg paces sien Ser saat ate le aR tynr tee cetee. sets reecteese sees lelelahetatelntotaretetate etter oo ie RRS Saeee oo
BERRA? RODE Ae,.*, SON Senne SRNL aa ee aa RS RRS SM RSS MD MN ISHSESD. | So Ssti "vO UMMM ION MAS MARONIBES 8s a lesec cereal Sec ste eee ot ea a Tee ea ate oe aa a SA TAG ET at WR ee 2 a TRS: s,5 aaa aaa SRR DSRS s! CNR SRI SS RSS RSE SERIO ISS Seog SC RE RNSERRRSOS = oo” -* Sn ONE aaa
ol cata ARS SRR 2D. 9 a RRR IR eC SR CESS a ORR SENE SM ALN,» SOR AON ION SSCS URN MES RSM 9. nce na eer rT aE eae Ra OAT ae AUTON aE AONE BN Cea ETE CAAA ee ALATA CATA a AD O20, RD DIRS 5S SOTERA -0c SESOIOR? «SES SORE NO De NED SCS SCION RTI SCL Tas oan ren aces 2 oa Roce RRS eNO Deeleelelalele Laeeta settee ee Eee CEE 5s RIEU REEN ENOTES aC ara DOREEEE SSO ER iris aEOre REE ESSRICOCOCRCOS ,” AMICI SN COUELE AEOOERCRERIRENSS, ¢,*,2a DOREREREODRS, 4 0840020 06/4)9 004.4 6°09a8 1040, 2 cD =I) Rg >< SERSES 8 o oe RR2cee ST, SIMRO 0 ae 2BS RRNOMESR Cs etreeeeocca CECI CCLE REN i, OO CalE CARB LV ceatece CD 9 ee aOR! 88S cee le ela) NO a5403, RES206,8°4-405 9.5050 SOMMIRIR Rao es 00 Rw00ARITA as alaeBORR, Le elena aeRSa =T Teaa. es Leela eo TROUST tS RSE
PIER CRIMMEMBMODS.¢ 9 00.500 02 Ve CCCI ENE CN OEE e OCA GRICE oO a a ERR OCS Se 100 CE Oa RR a oS I aCe eee ORR ABRs Oct ye Se ae Tas a OO! Se ee ne oees
ia af) jatatit. 7 Tuo IIS OSGI Sat a SOSELES PERSO son tO SEN SOE SECS RSS ST TTT) 2ROR RRS TAS IDR 8S ke Ly oi aT RIS, oo oo» ce. 8,2)eas>,a Se 0 SC anes eTWsare Te atpe veers eve svarotatetetatacataharegtatctyratetytotcte ACH Iarwl tlt, lalalelelelals lel Lalas laleezelelelareteceleletace RERANCH ARSE RON SeatayOs TSE nN SURO: ehabyhetatatyt Rea RDS SSN oS RON Sea Nae DaSMSO eat RR Reo nrerersteteceetticananare Me Peep aca etata tatePahe! latateeatatets ateeaalg tet yt FEE SSCS STROSS Noe PSOE IONSt SidSN ON aOR SRT SS TREO NS EES Racecetetatstotatelonetetaterntetatels vstererctntetetunstetatstctatetatet stot atetabateOctaPeeGtaPSSGBlR MOMMA SOS Tar aT aT NS Sere ot tybaeat tester a ata eearerer eee esate ces arene regener ALE Leo ethcne sce ODAC aT RACH LSNT Ue ptoTaba setae
roan Neaatnnge ene neat ora SeahL ea Tenn Sean AoE Ee OE ERTS EOE ETOP NEO THRO RETR HEEL Lene LAL ETHTNST CLAS a acaba etabetatetnatel lets itesetatetatets tele acetate stats NATL TEE UT Stan Phas est tel and Ber sesetetot tetas etate rte tct mee atat tats tatatentabstobabatatedatathotet ete eate ted aNeRe. coronene teleseruereh cose acareenenegeeace gegen MMT eLataeeTn agora lieessrecahacsigeenslalyaresotncstareryietanenetetatanstateeet sta
PORES Saat SRA RISEN NIL LSS RRTRCAS SeL OT SOS SO OS SRE DRONE OS Sa eS SAD ROR NS SSeS RRR Bes eccerarcscsessernceancnatrasaictn obese nenrebe be atnetacentetbeto astern aaeep ie tanee iets icone elec o catatonia eat tats eae etate haa Patetatale iT cetisng meget segura senmnenaeenatg Bp oecececaracwsnscsaasecesscaraverhtyista‘ererata‘yvalacsts “fetatntanatonarettatatrtotanereret tot tod ro ctot any tes act t ec ta Aged OME Mag Rett bad gateratnrnennc on Stirinataracnrasesstonpenesteattt tee sesicecacentatsteesnenenatecetay
PARR aR ae eee Peat era SST RIS AO RSS OT Ro EES OURS OCR ERRGESNS SC SSO gD iS ek SEARED RR SSR RS OLSSON. Berns ccscecece a cerelenatlate alacennialt Leia ecelo te eel aa ease taratasatacaedtete recor ecetatecaset rengaerrecenec nner TelenE Se a Ne Ci OED nc RR SAE ARP. atta elata a ate ea at ena ral aaron nee reser NERC Naa IS tS ERORERRN SSRN” a WISP Oa RE RRS ORE RIE MMR et tr at Sn I> Be ates setiseneantestccnercrsivesonnrneee ony f eNOS Cpe AanES- Oe eee SRRR EE SS RGR aa Boro ororegerotereiepageetesrreaetenehoneiersiesnreceat restore eeeeenteg oeerestse neeAEe Ngtesre Mecatatetyta tea ter acer a ca “eee REINS Iwas 6 CN DMT ntiotaatceatctetoh ENN ahs Senn SNC SSNS eae SSE. sete toh eater na laletat stata ateletatcieteteh alata ca EONRe"ec ta etoetave aere create aR Reatier tecar tires Nae ara aca ate netal ate i nteretatatetet eaotatetatebet RtatstetatatetseatotsSytatctetesntetstetcter tot aegrtalSatcttes a tetetetebabatatate ten tip cottncs teres ctenere meters teteanet rela ARMNBMMTRC Ne soand onerereeecatetet te ne ale eecrtceatereneee ain areata T at rhat nat tatytanct etic t tet tatet tt Beever reneever leyrctge eyheAy Seen ey ayn EA e Hee a 4 EERO Le DL EOR EN ALMAE CED A OIORLES SMO FORCES C1eL ERO EER a en eee NOH PE ROOST CS SIDES AGRE SES SRST SSRIS aR TOES
Ron scctarcttegececeastcent aieRIOREN eade let teeter tao -0-Pn".. AD Sr Oe Tar eR “ SIREN SRN SEERA NE eee RIE CERES sn tata aeS e aaRS et teeSADT teh RIED. £278 ES, i ot a SeRNID tata ta cata ae Nee weal osES ote Rena : ESSE eRe ne RS a SOON eR MR RNSAeNIOSISS's o's hy o's"... s RRR RNS ts SORE SOeerSOA RE Tnrarateg NEARER RSENS
"SRD Rans Sateen SaaS SRNR SCRRSONRDRC MSROERIES. #102) 0. 1-00, «SSRI AN DOCH Stee OSE OSE CRE Te eG SSS ; RMRetRR ene Raat aR 7-072. «. ERO SNORE Ree Do CRTC eae a OOS SDSS >.ONCE L No: Bane + CS»CIRSRORRERDE CARN Rs eet PIO clatter sh IPS asCRRIR ras SestNites aye Bree eSERE mee33Sota Raat € me, SSSResSRIR Ratatat SSM esas ROIS elareh es ecs resale ose mone ean eae eatatattytytyUtatataty yGectyeatytstatatats a SO a aewla aaahAREER asaeretorecetgeat stacey SRRRRARIOR Re ORE ee e ags ESAstat ORM Se8s 's-0wae 980000 TOR 8a 20, AMeee AA,Repro Sa Bratsa.ees a LEOS Se ea >,
SOUNRC ACRES, .*-°.'. SOD RaRaaEY MINEO b+ RMAER IC 99.3.6 Raettioeie: Soe oe PR ROR SA a a ..'3 anett.eh'.8.". OS ROSES: So AtiSRR a SR RIN REIN ANE RRIeeerie OC SES CSiNROE... A NNR MNOS OR a ORME A NR OT RGR OE€ RRO a 0 05 OCReetRR A . “EE Rath Sad a .:.Bee eeDRE , SE RRS” OC EN, SERRE Meetesete + MMR tetscecetonsunrcseereteres E REeeLepr SI oR BSAA Aionoa ++», =. A noes, LE RRR ESROSS | SRS RR LS RINT Be ND5... Ne! SR eS RA Re SE y's! SADA ECRaET Fst: See cet t's - SR MMMM CeceRRR Sea ee ea SND.ERIS SRROO DOR RRR °CRs Bor oa ale OTE IS. SSR RARE > kee aBS See Pogo Seen. IRROSE aSRRR PRETRE, OED NSIT REE: 2,SCR CRE ARON a AERC” Si a3SOR BE ae” 7DR oS "i98BERR Ia nea RE viewattage, Baan Lai :PBED Pa 9 -0"*-* SOOT» RRR a es” RRR0RR NCR ¢ POCRORE. eneaaMoe! RR RS ODsea Ree a MRRtan x. :PO SE: LEE Re scoiad a ates nee 1M Ne ASR RES, tases ete 2 SOR Fee ORR aR NON OS Rese’ Moet nt . XE oe i RE re +n: BOOED 8835 2: : RNID, [ala aa lateg 8 settee, SO ata acesetesdrsstatcaecerecantaPetcessetctasetatetaty we MRR ee loosROSES 4 : (SERRE eo : Se TeSo tg ' : 211.1 SISO SSC I ‘.Se"otstetataratctatecateienareteretaroterens RIMES. . one . pare RRS ae RRR Kon eaenea ate’ a RI
Pe. A ARR RE,',.” SNe ee ueatacasa eNOS Nie” . a -e BRR CEoTSRR Ser” on . ee ga" : : Ba: -osececesocececacosesscertsecesececesesmctatatytetstae ctf ha RNR IOR RONce IOR Aieatoes etetatare egetee beSS See3a wt Rae . os . SSSR: meieee, “See Jel . - os :OOO SR. RRR RRS 2 eR IRR . Be rae ad BRIS *050°8 soa ycytycacprateCaterecacace*oceres Heras ecerers Steet Bete eRe ane pole we , o «IB SR aGaniaae recs : RR eRRNR SR : :1RN, esSesesssencnesegenenereransesencehocseeoetenenonetetenecotetey oesatatosatecatatar iervreseceretenrsvateerterrecarte reneeBene, tte SEEGER er enema nma tenentree .Aa ‘scears(Scereregnyee en viianraete ho: "RS ge ee Spit | RRR AE See wes Ipiplaletatetetererenverare barter gee . :NoCD ,ARS K oo :EO oof a PRI RM MRM tec RSceentanersreseonerettn 2 _ RR RY : : RCteen ENneectete CR IS area eeceegntnctte despa eeete Tree araSEER, eee ae. :SPREE oie -1948 ee ReaRey «cee MIO aR eeeny sn7Jo 1 RRR WESR rereRR . tof.eRe acerecetarectente
ESR RO NO A=” a Pe Cees, . . OC ay:SORES SOR SRAM Re Cont” RUSSCi:eRSOREN SRSTOn ait:cesses wee RRS «URreset SRR, RRNA” A eR, a | RRS SRS NOI SOS RRR ccsess Re Ome s ir a Lk pet pertetioee RSS SRRsR RRR Umm tatesettetctetatetatlt toteROSES tateteratatstetetel tetMCR ieee”
SASS IR RCRA EMR IIGD RAY, S850 Oe Tent Rae! RI : . : A+ + Rt” MPO ee Oe oon ervcocavesecto0-0-07879-4 908.1. 4,8-478,00 90 8700,9. 00874, 6.074_400.0.0, 003 Aa ae .*, RR ease CRE : CE - OUR ORR WII A Sei IIE ROA EAI Rn ne RRA NOS RN DR i. vis a pS RRA, AAAI RISENER ORRUE SOOO AS ORIOL na OE«Sieh 5 RG acess Sv eee: RRR O DOERR Hee SeaMRE RR aa -RMS SERIF RACER ay SOS: cooAR FTA ANE ED «SRR REDahhh EET eres scecccsceansegitssceceaseerecectatmstatcteeistatststetatetytatetetcetiet tt tere haDOCTOR RE oe . AR PRSM eee,NR ca aaiaiatace NERA toon | IIR: SE Re REN Sa RR een REM IOSIC I=". ARES a SRO. me 1 AE TN RR” OE RAS NAN RRR Bo RRA ERT SERRE NERS OO CS SER aes _ SORE AOE Baek Paes COLT e : Oaienatsteharete renee SCOR cecerececevecoleleracecerenilacererereceleanenececsceuerebeneseaa PMCS. MSU Y,9,° (0°, - AMRIT C1, EM yn . 7 Pra AR RAMEN tats esatsacsiatatetatatetctetatatatetatstetabarestpceateterecat eset saree st ataneceratacae ener Sopnenen to tatc AROS ROSE + RRR oD SNP? 6s AEE OO ; Er: RRR RRR ee SIRE OREGR MER Ryne «ERR oe 8 KIC RRRS RAR REM Bs RSRRMROSP aR os csceacersertes tise testeenctentregentestettatctcanen anemia an tia on Ot tas AOC RRR Sacco NACE sen tse Cre) sR r. SIRS 2 SRR REN SEDER SCIEN ERE SNS KR, RRA OU Ts IIR RSKAM atsosea cccnccacelase SN ENDaesNNN SONS ST RSM TF oo” Ser Reeve orevacatyroneceriroce’ntbtbs hrm. «agin o"s aug0e), «Raia 0-0, RARER 8 SERRE: ROTORsoedbeoe CRSeesti RRS RSEnetiseeeninasenacncieis Re RR MNE Ee EN NSTK >=):KSC MARR et REN RRMA RMS ME EE sancti te: OOP Qhbececenernsecacenecesieselassiecestutasstatatyeatitatarettatec raresticatatatitite SCO RMCAA GORD mek ACRRMRR ee ne as aSoReRa avert corarnTSSeCACSSICHCHTEsO ort RCN GRE RO MORNE NON ee MMe ose to" 0 test ors ageereotstee teennntend
ry * . + » ‘
IRE PERMM NTERNTY* : RRRENERERRERRRER RABE ote IRN, cannes AKL CORRE RRR OOS PE” RRO ROLES REE RE Me RRR GROaratelecetarceBprcaie CTE oy sc SOR ae eee aeoneeereltaale, en cece neeieleyeenelenee RERUNREN ROMEMEMEROL CY "ASSP ER ERE REEDS UTE ESS INI 5 Rees RPE ROR «RENIN RRRARTO DRE CSCRE: RNR E IRIN, ECERS nce NCR RRRSE ORR RE IRIN.as ROoy MSMMREIC 8s. fo tsts areas tetatetststetetatetetatatstytetatotstte eeieretasetele
ee 1 SIR 8 00a RMI NN CN ON AMD ro ER ee ERTS RAR RR AER REMERON. ERM R EMER RRR ER READ REE REN ASN Re NM ee ET. ess gens ave nb eer v miereseceste8. one Seater ctatatatc ta tatatatatatatytrtetstecanenss panne a eA 10s. RE RET RPC RR RE RL BD, SR Se a a SC ae SP ea
PNERRRDSMIRY - CREME T nies RANE EM AER ERTS SAEED ONS”... REED RST URAS SEEN PASSER RSM RU NEE VERE R RABE RARE REN NH MSO ROI ORME BEERS Rants cs ataatcte atnt str Nat Sate rca Saat RENNES SRS AKER” =. CRRA OSS RRS SN aN eS RE PARDEE RR NRE R BERANE DES SERSEAE. 9 SSA AMER AE SRNR RMS NS PN TREER ERDAS EREY RRR EAE RAE EARS ALES MRE RRMA RRR ARES SIS SELON INNA MS Seat ctataiy pgetedettateteegcteetytete sat prasnsenreto REREAD IMEI RI toa a meet Biase SLE R SERRE RAE RES SR NR a aR Ce nee eS ea at a
CURRIER ER ARR RES NS RB? RY, BRT ates Tat RNAS RE RE Eee NEN SMa MR RS RR RRR RE RRR RA REN RAR RA RARER ES REAM SEAR SH NS ANN SEN RS EERE E RAD. “RT ERE Mma Reanct tannin eratotrisoneceteeatireacntetesnatstorcstetetetrsageratisnie erenn eleteeseni eters asneeadcenrepegeannaeneseeae
POET RE URE RE REREN HR MMS RENE RRR ME SORMIICY.® = 80) 48 FRR ERRRB NER R RNR SNOT EOO ET” Ye eR eS esrtetatatatetatrcotetatsio'etetetatenereserate RARE ARR RRR ERE ARAN I RNR RN iste ee tear ~ SRA ae ROOD Soo 5 sire meneucn rpopeenobiNyee nesta anos amenennmeat
Setatitatetatatetetecelatetetet ecete cece scareSRR eo Fr oa ta 00a aU areRRR eae ears Slatsnara caret ar aeetehata ttatattater ARUN’ ACen Scent OAA ce Ans CENAA RIOR EMRpoh ORReINE NADAS RING Sascha DeeOR RS SEE EANORR COSI Sete Sones RE St eR SS RAEN ONS EES Ea SO SS EAR RNS Coes RS ates ORS Sennen aSe SOROS ON RA atatearatrn DSN aeaantelNs an Rae IRO'S NASA ATA AIRS nt HIS ROL ODS TIRE RR AnSO SOR SIN ne ears SON NITES SaaS EN
aSup nCRCOEIC nee ehCCH ee aa ENS Se Sak ee eae PERK E Sa eM E NRE RETNA TR RRR EMSS ARR RASA RRS RR ae a NaN SER CER RRA RR REE RR RRM SR RR RRR NN BN RO RMR RR ERE RR RI MaRS SCL IS Se Se OS Oe eo TS SOON SOE ESCO BCE EBLS Sn OPEC nasa Rae Oa Oto 8 ae ENN R SRNR RRO RMT NTE RK RETR SERN SN MR RMR MRE RAM MMMM HN RE BIN NA Ni Ree ae ee tt RRR RR ERR ERM ARETE SNE R Nae eee RN RK eT a ee ar i nts et Ste MESS Ste SOC BER BS BE SS CS en re oe) FT SAT COAT SMa acta A PTATO LOA OSrUOMSADOge yee MELA ALAC ALA DpOLOgaseCPATPEL EDD MALACOAGwgectoegastag tata t st Paia ty ttgtetargaty tetas tetetararesstetste atecarerera.tcerarecarelerese:macararalerecel#tarererecer 5,000 toWs ecb ecerMsecBstcehse,enastaeststyte¥ytaestctatatatatstetitgtgtgtghetaranatatytaterecatice et soarelaterarscncecal eters euarecmearereresscnecs MPs eeahyertcaetaeetycatstgtsecsctatatetatatensns oretatTacerarereleracarathcere letelecereseLele a ACH ASAT EDS CE DSTO eDASONTRTAC
EON ATI AAT A aT ATA A ae Aa RL ta anna ELIA ALAC DELTA LO TAAL ASO ALL MAS BLASS Mg OSBSOECMGALOSHT AGM GBOAGtGCAgBCMtaNSSGSGPN east gteSacotarer otal tel steer srALel Uncrate eSasee Dressed Me BlRCOr OSE eTHLP,#CO Talc AAO, 8, (4a ASIA ALPEMS A LECMO0QP HBC PLEO LEOTM gtatresnet abana tetatatetetetatgceteracaterssarstarerecirereserecersonra: tear eraieceyaceeetetrtiestysceselece tee stesety ta ctgteretatetatee seater ater eTenecec cane eT er Unn MTOM OTOL ETELO Le a Poa Fae ea IE OEE eo cea DPD eat een eee eee ernest a tN Sate Aree DEOL eTA TAT PLR Qcer Oral reser ereeRISLOTOIBLRIELHCOLE AIBC ABTAL OLEAN A OMe Pe POTS tat at eta tatatese henna psa ea neen SCHOTT DOE ACHTe er HesVIALBOALHCETEL#IPLALS LOL #CRLOTEL MS GPLOHGDLPLMGPIGDS AL GALe et TeyH GP tGHLUa NGS GtaH ORs tater etotatytetptacceateretotera arena ctmteretatotanar@rW elPLOrerW OselP ieee ne ect nL SHEET MCH TELE LE MLHGRCatOSHONH State ttabsttatatetetatetatanetatateter ca DeL Sci DeLeleSeteTICeNMeS Elec Rape eerar
Se eee ae MS RES RoR NORM MRA NRA RED ER CARRE KARAM RAE See en NSS aL NERS ENE RRR OR RRMA RN ERR ON yas REE ERE MER ERK EEE MEER EERE REESE SMe SE oe ee OER MRR NT eR DiS Ri ea
Sere SY SCE EC eur ear a enn SiS ReaD nT tr Satan e ite Nate LALLA TTT oA EL ALEC Sea eset ta talatatattpn rs race pcorebeteteneooterpevtataretseesdT@sererenactrtyayeres eraser eraceracelerealncelacfyersses#stsets fs yScPctctoestgteest Pants tatatatatstatatotetatatatetatatesereecne tererarelaceraterecttooeseceranmsasere tuareresectanstetetatamsertatatanseatetcnatatetatcesttasatatetatatetatetecotetstetacateseterelelate anelececectgacelare WIAA Menee a HLA Dee aati Te ele SS SDT INCA OEMS TATED Da ADEA STABLE HEATH a AUT OUR DES EECOE ODM OD BPN ASOOMLASPSHEREPRUTIP NS FOHEEEDOTUSELASTSPOHGMGEGMSSAGHSSGMGMaASAOMSTOM Pe atatatatatatetetettetetalet ateCe eres MENON UEEREN HEUTE SS TEE ESE S HOSEA TET E SD ERED EG See eA AE REE NEE E NT eam RRO ee Eee AAT
Figure Open-air rhythmic gymnastic exercises at the Dalcroze scnoo! in al
*
Hellerau around 1 8) 1 3. From a contem po! ary postcal d.
NOR . ve Lot Oe a: cea teaTL 27 OR eit,8 EE . . .I :ey. BE IT es cimt
3141871 2) RIS ae a a aaa RES Set . : Be MONET Die oboe a mee
oo Rs 9g ea Ra aS ae oe Be . an wt at we ata ae ee ele Te tg Tee Delabe alee Tria ste iis en st aC ar MRT SO CAT CSET SEEDS SSIS SESE OL SSCL CHESTER LD ESCO DREGE SSE SE CET SEODTEST SOOO” SOE SEIT ERIE SEL SE MBSE SOUCEC RESIS EC SOS EES detect ars
tet tate, ett SERRE R EEE Tae Ee eee Se IIA ae ln . 7s y Eo OC ARECIN SUIS ICSE Ye Oe oO ae CORSE De OOR OC He oe OC DL Cn DLE BR SUS OSD RCE SIRE LSCSRESEIRUESD SEGRE» + "a" +e” 9" 0) OOPS RE SR SS ST Ne Tea ee ea
UREN UERESERINICS ohakishn cnr tes er iene vnrpiprenniennt, 8 Setar st Le £ Tete sitiSRS bb eshte ean TgSDS Ie eas Ss IS SORIA ae ROR REDS SoSSTEELE CORESOT CASTOR 1s)" SRR SSS Ce RRR RRERD RNs SMRCoN ERAN tee einen en Ms oe POSER LSSneers OPEL SERIE REEL RSE RN MEER BST EUR FeSO CS) ENTE 2 RRB oo PETES SOE a Eo GOCE SRRSDSEY=°=°2°—°-1.°.°-'5°r WS, SLD g aireeielvie eee crnanadeat rte juunlth inSCO ty CRE
WSN an core ALECE6830s EN ESH URSel ae celad Ge TIL WdteaeRicepecioteb lenirendcdlegt gt etn. gtrtacpeat natesalafaetatly i STC OC en US neseI CE STATea NCS a NOSIS SEE oa DOataczecel LET a DEUS EUfeletleteietalelc TT SEM GU GUS UT ETE SEUSS 7 SESE ehERRNO DISTALaN LAT tataERMC Pal stattotate.2oalste/ Tet EHH OR aataleecig RReeaSTRIN ON 00 Tete Dele beet betel tee cetet ata eee e a a eee Dass Care Dekel a alg aaa a eeLEO lee SOON CATE a ee ROR ce Teles te PAEDIATR GID DU IT Te eta flu olay 9laret ess ATMTSIATS CACM, 53674 18 40740006 FUR EES Cn AIO Ege ESR ane CTE ROMEO SONG SSC an JOO OE EDEN PCM OTS OC PCED SUC LI oc he OP LET EGR ot SCO ATER AL STS ES Oe eT Ta 1 ES BHAI aa Taleo ele LD Delta gpa ele: € aletalea saleele ls ear Tega er lela” feels alee lele lata sD le ele) aaa teeta aL ec STEM RSET STDS Aree OLE BIRL CIRCA A BALE, ORONO OTe Metal a's a? AOR AER EE RO RE ER OC BM RON REREAD aaa eon a AAD UT EDT SOR RL MRR ees ERT RG ASS Teas a OC TR AT a eee eee les city nae Cay ele tanec ety TALES enenRCagnrecgye cece oe Dect syertraSe styDOI tyeatabetatatate ty F 0 Sate ETTtEC S ETRCSEE SESH STREETS 0 OR RS SE oRRR ERRMSG Secoea sccon"y erate pe rosTenet SN RRoe RRR RONSON POSTE SL ORES PASE RE Cavian erenice Renae tee aenece “Sheets eeOLEREE CURE AESIIS 2 OSE ISOS SSR Sees ME ORDER COLES ESEonBSCS CIC 198306 LUCE SScECPTSOLE SE C PERCENT oaeeaR RMD yoo tceneltcas LTRS et tet oS RR Ro TNS c eee AV
SUPE ACgRaMag ea LTE a0 SERGI EEE es MIR eee ECR cet ect ne ean ECE ACEI tee NRO cg aeMERIC ceric oee cekcr eid ee enna eee en nibie (cuegne nant i iudriinede aneeltitamnron nie ince SPOUSE MERD. S00SeattTREO area OSL RDS a ea Mee us RSORE TENERE NRAsore RE RENEE RRMA aint SE -2.-."s17 CEL >A RPSE ERROR RI RRSIAC RRS SITIES SR REEEa MEER Neer CICS USSG OCHO oneness ee noite unites tatiana soos nen bkniayagih RUSE RRR RES 0. .°-< 5 ee RCC REL RER RN BRN K MORNE TTR EREN REC R ASTRO EO, |" "|: ane eee Nee EE SRK MR RRS N SRR SSN SESE PSIC EES Es Dea a AREER SSSR ZCSO SGC SSIES SODAS SE MIRON. #2 on MKS RH SRR RRE ett SHEENA Ee Rie te ERR NaSEBERR R EMER ERR ER ORI EES pS eterno gran sengterun wargatannce neecnce cetteye «cigars, anningan RRS. § Rtn A ERRORS ee Ean ETRE RSROS SNDNS AS A?,'.' SERED RARER EGAN RENND DORA CR Na eR Shee ee ees eee N ENE RES RRA ERRRE TERR PERI EETOT LEECas I ET I at ISIN OTERE CSCCEA, eR geCan ss gp ileityetnh se Ue er mT A UAT OR aT relapyaac Tabecwal klatgnLyoyaeonc ty nage a yligs RMR OEIC “SCE RRO Oo EE OREN AYA AALS, *,*,', GRMN AMEE SINT NT SC RRR R TEE RRR MRR SER RMR RIES ORI TIDES GLE LOD AEE EDT | AR er pcr ar ateteca ele OCCU ALE Dae alels, cay neilnnsgetne shgiiile, Luiasyyietecc lca tele atldatieninre seated nee ee tet SS st RI Ie tates ANS AGAS". 1.50)! SERRE Rew EN AN MMR ESO Ro DERN RB RI RDI Sei RSE BSS i aa EGO tia Snares SISAOS Seae SO POITIER DORIS POSSE ILLS SESS SSRIS OUERRESEOD 1 2 SESRCSR EIEN REESE EIN RE RECIOOT,*CSCORSROC OTS SE SCs CSE DROSS Sea SSO RE Sl
par EERIE “2 SO EISole SOO nietMDREERSIE inate ter creel) 8 5)ne SeOR Eee naeRR MtRIC ES SOE Rae RIL a RRR EER OL ARE RARE DS aE RRSeed oNDIES one begga STATSrTere, tals es: CS SR C00 TOC Gt Sr Or DSCC SC SRC EGOS2dvcetay OC CCDS ESCO REEDS CEES alSea ete Tele oie ateleatelagetates celleSOT et, SSP WN F666 e'n 0 Aha. RIES SO ISSN DBNR RE REESE Aaa STNRAE at Sa DE poe TDL Deatlel a cee GST ee tae US BNATATE We RUDD ARBICD a tess aaaye wan tcigigeytgemaainoitis TenantEGC ofialarOt felabengtadetealel tabeletete algeEC Taal: Sar Sra Sa IU IRENE ESCSCEDISY D077 CREME EC EDEL ERSTE LSC SEEDS SSR o”"4° ‘02 SOP RIES SEE Re AA Oe EE TS NRRL ES IE MN SEN ROR CRS MIRE SRI, Saarinen DSIRE IDLE SCOR Ste G50 ROSE SOCAL SDSS SCORER 6 cs SoS RSENS: “." 2.2 0 0.609.000 40 6 4. 0. «6 OE ar OP ay Se at Oe OO SP SR BO OE BE HC SA Neale le lales lalate ta eel Late e ae ata lee on te tate = Tete ee ae eee OME as. eC Re a eae on ee Ce ea
ale SUS ELIT DL I ad UIESARE ICES CNR ESR LCEORSESEIRSRIRSCE S28" «"ALTE «701070 "s“0@0 0-8." 00,90, ¢ ta SCS ae ene GSASEW Set em St MN SSSR NEerCRN MRAACR OCR)TO SSDs ee VEEN ate Tahal he aDe a aT ea aIONS SA OSTA STAT TS ete ygtelere tela] ls alae ree ae sles is POMEL ee SanT Man oes RRR RN RRS 82S SIO TTATAL ETE CRT aR alga0 detatatat telaenhtctat ct Corie op CAREC ELERA EOAURTS RAPE POL Gr TR GE eT mgtlee ORE LeTa le TIE a RR goa etn EDT aaa eBLT Ae eyEEARTEL
peePaTaIGESEAT TED Date tee heeIco te Tee saaIRE S088SRC aC, |,CORIEICRRY'-*ee ee ce eR NS NK 0-7 TORRE IC MN RR SRI IES OCR SSR OSEIRIE Ses SNS plslolaleleleDel ele NLR ek eae) Doe DD letsno oraSEE toe DaStSEI RECORDERS ©" KR S850ge006 800OL +0Ialele + SIRS SEI+191) EESTI =o. 00-0.*. 0s OE. °., aBPS ARERR AERIS NOC Ny ICR HENalah ICM SERS ICRE SLIEMA SOR ME TIA RE OOMICIOICMN LEE WOT CE OC WO SS SCRE Soe Be EIEIO «8 8-5 ", °,7,",(,2,', (0 gg OR” hae nena EE ee pat pe ee ba ea nell sere ay Teel el loa l Dirt arate leet atta) SEs eels RM AD UEFA Eo. sa LRTI Teh RPE RRR MS 1 Ae Rae A eee SR Ie eae late
SCE SERIT MERE NICE ROC SESEMICCICOEIED "15-0 0.9,9, 0.0.6.0 00 oO eC RS SR eg NE ek ee ONT ELE eR ET es tenet elt Toa oars i aoe aE OOS DDE RETR RSERSRECEAs 'c tS CR RMB 1 1+ 6 0.0.0 RM CERI A URN a crete co cetstate pi etatptartta Men: el coreererg esa AL Ly calelalele a ela lal TS ale ay
_ SISPIneySreciE CPUS EESEACSCTESESPISSEICREECIES "+ s6"r-9"6.0-0 01s SCC * Sea wee eyee Seea,Ce a a ee Stadt SEED TT leo ale eae«I aneFo : Sa3 Ow i RE a et RR REL Sa.at atetsks AOS SOA. * OOO eee ets at RRC oe we Pee er eae es sel 8 1” etdeelala eeey's ne aera eaeytetane ta Vint ars aSESE ee Settee ty A en I 7 Cl peeCal aeeea“nS Te”REE alDRONES 8) 888 EeSC 8A eeeaoe ele oingticitetg seg hte erPERRESEMEEIED’ cee Sore QRORS GGG roeaR ooeae re LE eT ete«4St gtapele CUeattsve ea 2wee tne eeTe SEE Se Stea od ean Saele DOERR? ~~, SADR OER RPE 9 210OMOEA 87070 6 0, TL SRA SOM, S541) Ra «'yc'c"a-0""0°4-0 gnc SST honest sdptn RRR SCRtn RMI AeR REISS SINCERE GRRCSS RRIE Se a ROSE,” 30°58, oY GR i Sea 00's EEOCREAR mst eenRRR CORRS ea tate teaasatataatuanneieneetre Nietaletnststetatetrtatst ath RURDS RIRON Aanaeons Sn Nat MRM aT ofa cTe sO STEREO aR oo RS eS Soe CaP Sa SRM ERNE ME MGICocnestos eNotes Seen 314 1s” 1 0ASO 2A SRD at oe RIN TORE STE © SO| © SPEC SE RRMERIRSEEES "0"rn'an'o'c°s"0.0° ARR ONS REY Foe Ne Sits RR TR EEE tate ctnr tote R Lt tteenact Ses. atace cacti 3 85a ate patet aN se pT eR RT TD Feet st 20072 oe8 ao 1a sR OLR REIGN OIG COLES ©. +0 ESE NRSC Se Oo aan at eG REGIS. 7, 5 OMNIS MGIRDRDLGRILDS, "0, (0 0070.09. 7.8 9.08 ASO AN MRI A IC TaN DG I a ROTO ITI ALIN TK gts NN, 9 SE SERRE cap SA RIGID 9 -2° + MORSE nn. ws "0 2s. CERES SNCS I Hee RSE Me SOE SER ORR SEER a Da Ge te a es a GD aon niptot ste tseteente tee SARs SONS ARRAS MRR AK. NORMED SEMEN 2 OO RIOR Ra Ca TC rele tet RRC erste Elen aener hen nan ecacgerogrenetatatctecets tet et ater stasaretra see cehaca Manages eon ieceeceee ac eE ean ca rece AIRE cee Cnn nen eens AR BIROORR eee Slacacescoten henner baaaninnnly SORELY Oe. RRR RES RR RRR ESS PK RIOT RS oC ee STN
PORES Oe Rea ee nara eae ss MORONS BRE RN RR RES ROC ES BSA MARAIS ene OSS RES BSE ASS REE RSD REDE RE SAREE UN UDR SRDS RSME SOG MRSA NOT nNOS Sana cnn na Oa RRS eis saagameeemeeenarnne ng SERRE aR RN Pitetetetstaceseceracas AR RIS SPOS MO RE RT Sn Seo? oe Pate RRC ater Lonceencererr sa teee eR ORE MeN stem serecrteretenanstictes MUNI se TSR iaettnnctn anche eset ueresra sities: Recaseaanaaae Meee Rae RSS RRR ENROL SO ee tree Reansenmsenionsreenn aa meme TN Nes SRR ORR: Bae aeeaRneRR ERE REITSRE RITSN tesUU setiesce ee rfeececienntanineen ghaieER meester Sees CO Soopatstatanceteteteceteaeee Ra Peter cuncanaNeceseratetarataCeterinens 5 EOS SERS ae ha ee TA oat hetatates ONeaORNNARAN ge ecage Setslatten lteter atin rat ners eal etn rocte crit alten epteeer acne 3B Be Nand UNM RMN UN RN ERRRR EMERY HON D4. 000'476'e tC eK RORpenne ROE ERR MARRese RSwit tn ce CCE RO RMI RS PRR RR MRM ICC hE te iterates MA a ERAN Rta SNESSM -0-PaW SRG acing SIMMS * ORES RERRGR ©.a2Se ARES oh Sst SOGtet agee etatecntet ace ote catetatetstets tneatatarssrsuonetansc tennis eeheteeaeaeameeae Ce crores,
So SERER CORES CA eR caer rj conga noe cigars erecta error ar naar seo UO Se eee een as eR aes args o.oo aeeaemaaunnee eaters aoe ere rigs mee ee crate aac Nbc mince aera anitn sehen nach ORR
PARR NER RA RRS A MEARE CSN Ca RRO et SOR GROTH ISR... CORDON ae ES ERR RE cis PU ee eee ORM LASER RR RONG see SE SIRO cay SO Ries sexe ROS 5 xa SRNR IR NOOO Ree mea OE ARERR DR DNR RRR SES Bass Soon
ARRAS EARN Nie CCI Nea tec seesics Srna SRE OO ER IRS ORY SENS SRO ro asta tr." *-'s!. tte SSN Seta RA Ot SINE OR hd cea Raa ROR SOIDED DEES. atacans y's nece teeta esata ee genera SRR T UN Tae e eal etege vlenelale seg ane ea ALI DeLe create eae RR aSE aA atta Rea Ea ARNE ROMER MORNE CSIC e 2c ORME osea c etatatgttgtatesntatataceetaetateteteneciteegtetprettorelanctattetatet ter eetam at tig set nt st oh eae are RR OD re aC ae Seb sts MRR ERE REDIo n =o haat RR OSD RR EC RNS SRS ag RE NSIS SRE RRR Octo Ss OSLO SRR. SE RS RE RSET. SSR ON RSs One a eR BRR oa ROR EO SRE SRR CRAB RBRARR RSS MRR S itor
Rae avant stir ieeterterep hresa ERS ier OR RR RRR SARE RRs RO RSC SRR SRR co CCsate”ercneee EON SE RRO SSRI SRN Ss Oa Bt RR ReMRSS SER eahniio ies ermine een earatetatatetyratett atater ar Datetet OCCTeee eeataviscecneteretateneeet tenet RNS SERS RMB, CORED Sh EOS Sabah reennceseensgearennennaensonennccnsnenneacremat Laol” cereSee RR ORR hn ee ery gett:+WA connate DILCHIASSON ADEs STRSTR ERERN nai KN Se OOD ARR NESavo REST ST IU TRS SN ererece Se SARScen ese NA IMA ASN Oh esetst hcl rests se send canta etsactetete Ra KARE RRS AON SR SAORI eR RateIRKer een tas tataaerate o cuetote lear aca breersratiaaeneaiatarsesetenetasstetenatnsseine st N=MME Speen SONS Eecece RETNA i Pak Mee RORMaRS ERR CCM RN, ee CR ecole
ona ane etait tater alec te neces steletos ote eaecaaros oats 445" s RE PON, | SCRE Sn a arena eceab cer Ween RR HER ESR ON SRC ee SNS RI RECN: wh o> ti nae eae ROS DUERMO OORT ate ann cha ec" SORES"! aa RSS Ee AREAS LE, SRS OLS SSDS Coo eae Rete MSE AEDS esatstatatat aves SRNR at 4 Peep ORS RRR RRR andar to chau cee rien RO RSS SERRE SEE a aR aOR Ne ORS Sai ORR a Be ee gate NCR a origi oan Saccay Meenas ee eet ee ORR RSE SEER
Caanstatcaececnsacereisseceracectiesaniotrer cae e's. 8 errr“eye e TOY CO RE ateesntat NatlMMARE SRE OE NRRL NICO CE CLUES STN hsoat10°C NS EELS SEO a SR ites te eeccrateagetstes tates ORM RMI CSSSR ONC TEDW RSME sarees Ses Batata otche Ra RE SRN ENON RRR atat nt fScMRMORALRere 0216sere STALATATaTACaTMa nsants.111cacels hiatal etasalasnaoeessganern cad SonBearadhs certs areneeatererenbeerosbenn eae EN aronatan enter ieee inegeigrienioee Bic serns aPEONRRRSIEE SRE -0 SS 9D Boao tate artic rca Oe oaRON OE NC NO NONE.RRR: emma IRENE SAN SOMME MESH OSPREY MR AUCNCORN O88, 0,0. Hee MVE Oct eDAt eS
TPN Mecetarecetetatehenelacntarscaceteteressheretatatate’oyrty'ssTehetale'a" EN eeeSires eR aNGM AREER ASEAN DHMH AERA REREADNERS ARID Bier ecanees Senad SESNR NISSEN SoePercent ONE M MI 5 S00,ooo 000 SoU. 0 oeRR ES SAA ERICA MOR RRR AREY SOROS SSC Rt Re CN MCAS UT leSerapacocetrante'e’atesecy’ etthrentaateaeennen eee tor eeeme Sateen! c"s0s" 5-2" RN aCNS Se RTE EaA An aan aiaRNR ee ea Sik RE tMRR K REN NE ORES CORREA RESBEES SSRSeRS MCN PR< -+SSSR A oSEESSEC ESIESDOERRRSRECS 1-20RIESE” 2-0707t 03"RRM BRSER RD SRB9 SORIA assesses esp CART SRReea bot SEEtns ercnng eae RUERRC STR SCRE BERD SRRESRSENCR RITES tec scen ctescastat atestORR toverss SSE ESSERE RSGRC SISSON DOT TS RIE OSU” RSTO Ra RO RPO cies ata's e's ch tett SSRaseORS Ss RR 0Shes
PHO RR eM ERSMASIRIT SSSR. 0, 0,0.0-0.900. AER aS 8 ea ah Re eae MM eRe eR AMEN SNM N MS SOCMRR SOO ORE OC OCR MSC3-RICCI ©.»RRR 0 0.0DID "n"0Re OMS RRSUIRE YMRSE TESE SE SERRE, EAE "22°20" 0 5 SOROS ONDlaeeD IES kn OSE RS RRR RCI Ae eC cr oa a an ee ae ReNSEC NEN ASD ew SDN EER 'acc"e one Satetatatste enc an ate 0.074.004, a Mats e's0"7's-1" oeshahsn9"0_) ea ES NCSC IEN. «ON SOIR ICNACR AOC Ae SNE OCUSNS IC BO MOOI, «900-0. BS"UES 0°0'n'0"s ENOOK eI RPRDEERESE HpWU so 2-0 8- oho 8. COR ae, CECE ete DODD DA Tne Qadseiccs REAR RRR CARMINE * 8s" "ron "ets 0.0.0.4. RIMM AR MAREN? e974: 2m CN NE ON Seb oo Sea OSI DA MK SO SO DLS OE CS SR RESCUES eS RCC COREE SCOR ITS. 9'0 0.0 0x DoS SORES SG COED 0 OOO EB OBR A901 S00 DIRE SEES 905° SOC ROME BESS i a AKO A SRC S's SS SC CSS» SORES ORNS REMC MISES == + 0-5 n_8000.0. 970-0 MORIN ITN 2. 0.0- 00-1 RRR Sa OS OREN DED SCN. Se SOG CR ON SSE ESO SEIS MORI DNS ODER NOREEN ©. + 0— “0"0"0.8 IOI + 0.00 0 SSO CREDO: SEBEDEORES > 9 SESE SCAR SEREOL CRC NCCC SD SLC ICSC OCC BAAS MSE SO ICI ORR MO SCC CRM ESE SLN OC OX AUR SCRE Se Se vole aT Restle eel el alee Dine ed lelelelelatatetay eee lable DD eel el lel tle elaleleletelelee « a ses aed yell Teledeletetatate rede te te latelade tale lelelel iets aletete atte tate als 2tetaa tte lata! alee hella ta fa" RNS 9 2 GR Aa Sa Zana eke sale Datetylelalelatahalints Tale l ets le alg eal a olaley alate siete sletale ls sete le ecelaeteleterateleretetetattetets (ates RELIST ES SRE ESTOS sD eel ele ee elas le eealabels le eel ee ea relate an ae eT aaa Col De ela ea ale n ee alae Tela ae lal oe ee ay ele ee alel Ulealelatele sD tata stele ei
Danette ately ota lel Tole etary set fal telat elatalelalolelatete') le nlatels als Dele le late teteT eth tetera EEN Re nT ee tse totes eels t eo rlatstate fet sty Ile ele elelelelalelety a leletals sa Oat aTa lee ERROR EE MC ICSE RI Wek BM SO OED 8 EESTI SEMEN TR SSUES RCE A DC ECS COC ee ee Sree: ae Sr elated lalate coe Cela Tale ate Dela eee ele Tele ee eat tele! . Tetehele aT, i si llelsR
RIERA IAS ESTILO ICSC ERL DE CALDER ISLS SEC SRE SED ee SCEESC SESE REAMRERESESESS -: +" Ee ORR OC ERIN. anne . ee Ss ces tee ENO URR GON. . erp, : . : - at MEMNNSMEMECERORENEEDIS cw str cca crn ee an le aegmg oRmee, ONE SR On
. i vote Petes Net tte 1 a te oo. ro co oe tn a tr 1 tai ROCESS. tC OE OC ee cee, set Pen ae ae
.. ag AE NEE CEE Hate 2 oe Slt ke GUESS 9 . . . on we oo MMMM MMMM MOEN 0020 cir ele eta cee a ae ee a se ee ee NM el te Te MP eal. aaa’ BEEN A Peer a ee ‘ 7 St a aa a oot . . a . “oot. het 0 OAR Ce woe Tae IIB RE Tele etelel Tele etetalevetel Ue et Tee Tele tela eelet a ola aa el
eeMen ne eilecee .onoee rr noe. Suen nba hes : to a«reer BES Sisco Pe RRSOe aR DEDDET SOULS ODD OOD OSU OEE DD go 2Rae: : :urate .' ae - eeitent ~ +1 a eS. Oe a eale cots6 fe GET a oot. Ol ‘ee Pave To yitea tee . SI ‘ ea .eh.eee .oe Sn) ESSE EE RE rcflat :CU oa eOeh VS hee DMECEEnieier: = rn = it fC” “- wn ut)it100000.) SSR+SSO eR se Cees “ote sce Se UT -eyaAR? “Ses Bote NAS 7 'Sal we 0 -eae ESE woe) ee RRR eeTe aaanal Te ee te ee ne eteDDD, as Ug Gy tw ECDL hint CT DELS a rr . ‘ : UEEREREOEMREESS Oty nr sone oo ehh UD io Sa arc acc aaa : ‘See a . : eee sepeeee—" ~ wie : : . + > + lala ee ea RROD vas tc atte «+: SS RS CECE: ete vs orit Donn Dott ta iia dai Benet . : an . . ao 1) oR SGEOGES SS CSIR. sme Douro oe oe tt oa a SSS ec ee >
we . ho nat yon oh eS - - ‘ . : lo 4) tae se a ree
: RE oe ORR AMaEEONS 7 . sot oan. vols : : . +MMRMDEMR 2 o0eelacelele oleleveletalceccelele See ee Y aeRSE rl . SEROTEC "Ze ae. | Se BI NE ek na a OI aaa -S|. sone . . tees + + 1 hSDN at Se tt90208 ce at OE SRC RERRERRRE SE oS ta aes . oy RR SERIES ED RS. yee a wats Pa ve DRRMARMMERM ‘ toners rr re ea . bone. yee PEPER nag cbs Caen lull cuore 118) pond an MRSORI) SDE ABO anes aE Siinaat NE PROD. . .ER : . TONES ” : Slo8cs 1 SSIS SCRA SERSrc0Onc . cols woo. SRREY. EES RUSE.
ePIC ETn ESree) gy Se Seer 7 on " na . oe rootela aaa a aMek eeeeeeeasale ae! 6 rr saws sae on vreae teOD we.UES SRE aly dite bateTate hats teTa apeat ee ere eaateieen tee te PREPUEMEEOEOE eo SI SEE : Ll oot aaa Rae SL:*, se tt .7se" ines) Be a. tie .Tha :.ue .wae :a.ee : co cs) RTS lel Eee ea le ele soe selec a re ot Poe ae . +. DET. a Pee yc Day, . 'EO soe Oe we . wel weeee sessed -rr! 3”. |SaRS. RRS eee aeteee ee5ek oat . :..PUPRRERESRERERERRRY,tk ete 0D Db D SLLED DOU DL ccee cc.ONES aa vaDe mae MMR ROU SSAe SSE RR Sa a. :: :soe .°noha 28s SRR NE I SERIES ENE MN SELASE Ee EE eceDa age ne, ESce MEE ESEcagebe SRM ESO.CALC +: «6 6 220 MEICSE Ot Me Shr eter ah at ee SEITE aR SN aRsnasoaere RC ER RS att SER RMSE ee scssee anti tattatan tamepn.ecto ADE cece TRota cc OOD... aS ety a*|*. erates ccer acetate eae ecarenece Tees cuneTAtAESaZETWEOTsSoTeSGc st SVE lel AlOseaCecete feceseat Oneeteleloterenerecelaa a a a OARS ER a a aR aSa SSE a ORaR SOSI SG OUTED a GROSS SG SC UOCDO SURES Se Mie SEDER ENE ce EERE nycatysstaishy eeccry IER ICICI, =,onavenbseve"e LRN RPI a tesa seeeraretenateeat Net eteneene ti renenen essen cesar et eee nen SSP leetUAESTatelereteletetetecere eee retool tat alate a oTalete le ealataar (a Ee Oe OE SESSSR BIRaL BEI ODSSOO ADO LC CO 0 GL Meee neeERENCES eee stakeUSNR», Raga 1, TeCOMMONS lene aN Bea. ene ore oc asicncecati 0 eS athe etnslats a ae
TENA eae ete NE ae er tar ae Aneta Nate teta So akties SES ROSETTE OLDS Sr NSE SCN SSO NOR SERN SN ORES: SS OU SISOS SSSR OL SOO CNS Os SESE SORES D7 SSE cen SS ease SSA SSN SSL yaC aie Or BN A SOMBIE scl sfones conosco ficer cries oertarraearge
SODERNE MRE EN REAR RRND EMER AMER NDNA MRD St SatatscO Nh este tits tenses i otentattecetate eter licicre slay strleeleteietnretet erage igeqrteheneeneetraetereeerearahettte Pech hee OE a RR SRS SENSE ODT OCEAN SI OO SE SES SRI SN OD SSAC CRC ODS ISOC SD SRS OSS SR RODS ARREEGISDS? SSCS ONO SEMMRERER C8 cnci Soccer se nro
weselteeiracleananatitatecacataienateceteehenccataberacetecatisatatatalstatr hPa a aS Se ee a aR SSS SSN MNS GE RIAN. ¢0 80221. 8, 8.28 78 U PO CttPGP Nt tahaegtatabanatatatatsintatetetcoatateletegetese operate ueastalvye ere tacesetetestaegtg theyre stsSyeMtonateeMe yee coce a NCSA aTACASNWDATOTOSO OD DOC RTSTRTOSD TUEATOTEEATATOCS STISFTOSEESNEL SETA ORO SECC oa T0049 ROP RPS NP SPSL it alae a SN NTO WEN ecarerec cared enact teed FERN EPO RLE RL ELOLAL SERGALPLEDBLODDCALETROATACDCTLEC AL E#- SL ILEACICACBLOCALRSOLAT# 9 CCOOSCEULE SSO TSR SCM BICMOS SEIS BOE ON SOIC CRI ORR OBES SRO SRE SS CICORTE NS RESIGNED A DEES SSD OE EERE Sse”, 1 \"s°- “oC RMS RR EM MRA MM ONE R ERI NT oars os eect cree re Cee
sSalareertecerelec otc erate eae th RRR utntgt ae ae SNSote RRR SNM ASIEN rceSeleee sconeeee cca Tecar eT ATeaners RO LATO At DSO ACASRE ATS PAA ea ere a ecebavataasare scetecelscerereserstels lcs ET lel elie rt Rpg coco 2 Pee tele tetaaleve ae ots tsaSolas aa ie Pati tetetgtatsclara tatete cerca Taterere aMg tataeRe tatstatatat tetan te SA)fa een een en ee eee AL eeeAnETATAE ee ee eeOC eeRTT ee CATE eee eget tan Tso ataSNEEMEET at ee A aWTA TMHET SieW Be eeeTae SeeTSoATEATA Oe eeeCeTa Be Oe a ON ree +seaa eelala ee aeebaletenetecenstn ae eee Te aN elas eee es a'sye) eTetaee a 5-9" eo were Ne” to! a>a aSR cote lelagalaletelesaneseptenssecaetetatatatetetaratesy sr otto SRS Se na ORR RS OS SRR SSDS EDR RDA SDE DEED IESE ODN OR IE MIEMEE EISSN MMANSD 0572s “ahaa a alse ecaarerosacarosacennacacaTaecaceterel Lenaselereateracanateceate y scalatatetytatacors ccetelels atasarsterstacatatetgtattiatyce scat) Tete tel SN Tes tite Leann tee beteteta 37D Sata PaaS REST, ".°-*.°-"-*.*,° SSRN ORES OR NOOENORR = novo stotenentegerstalstetaget ener re neregeh
CE I OO Oe Neen ee eee ee ee ee en en ne tg eee a ae + 7) + «I RIE SOREN Re MT RESET HERE ON Se St 0 ME CE CC SS ee ee ke a ee a ? es 2 sae EF ag a a ute cs te pa at erat en PE DD hie cena enn
RSC SH NIRS on SOO SIONS ct RR RR Rae NOE RCE SARA ERS RDM MDD N MRM MIMD IN ens nincecmenSnr trom yaa /aecu Tanase eratae Mtmta Oseene TR TT Pra ore wee AteLaCe Ts CLL a TSO ODI Sow Te ALCL OLENELND DATES WLeDaA er ererasace ote lecarere eneseLebal 3 Iegeca ere alatateletatat catarelajatal eters faTaga tale’ sra feted Tittle ea titetetal eter 1s bvarcbenetetatetsfatetet a oo ER” See
Saat een SEN NOS MEH NUEN SSR MN cs apaysnyern st MEM NaN Hasan nc yc atacetet er otetatetecotecetetetatatererecot etetgtetatacstetaecetrtecatatetersistorelst tabitatetscaatetitatecsmtrabats ttc! stat fatets#s Byte tat a RR SSSR ORSER SDC SS SOARES OSS SERRE TEC ONIN SSE GS TESCO SOOO XO OC NOSES SORENESS SERRE OSCARS RSENS SIO ICES Berar acete a Oa ER. oo) Oe atetale ete tafetateietetateletacetere/stalatet eles eR RMD IOS RAY eae aa a aa Ta EDS ELD ee aa SSIS OSE SSE ESOS SSN SHERRI XSPEC Pe merece cee enSADR Tere a ATES HOTT ALI sea ATRLBATRLOTOAT OTD LEDETOT TALUS END Sg tao ODOT TRTAZ ATED ATET area ACEDN WLR DADRA TAT ASOT Eee ea Tana PASTOR AAS ENR IRC @tg soca One Teens TALES CADRE RSE RGA aerate altel alata dre sts tata Se MRR Leelee a
suniigintaanietsan tS ee ern a eeche? RR.-'-eR eR ER Oe NER RRR MENS RU S RUNNERS nrnec CMBR crc atintnn sirtettnnnrencnitcresgntrrseetieqingeccne oss cannietcepalapattererses nenteLecs baieseancien testa aLezct sar nese SeSESE SADA Ge ESSN ice tNOR AMR ane aoe oe SRNR, ecg menace PitinnAEE Mame MAM tens neesRSME ener treecdrctecat alas ee eee tetereset et ecacenegeteseteseneNcnpeceneeteg LILIcen casescat Secedets sar Ore OSNUAS APE RRR seyieatetanteep COO POR Sa aR SOavaneregenaeinaatgereseseggipeane OE coca SRC aCanacotece SO ae a ERCalolelacereleo RIC bs SOO RR Stcae CSUR SEER NSN ROR EONS TSR pa SRE SSR casaEN RCSed STON Laat RNRRNA ee RE RRR ROR ae aoctarecetsrerstarsaPerasetesacerst a aechaerarens! aa ae aan a sti Aa aR SME DEEN MRAM, nant Peocola tonstatalecnne ocuscinitaar egies kicrencartrayene easelsSFE eth ba ecenel eR geTecA eCe eg PALATE ALICE ELA LSE TREATIES 8cteARADNan aca ags celelelaTel else etale fel ala) Cal pyasat eaceconer 20 ORRRRRRRR Sy ---. Car take teeet«fat yttate reneRR Tatalecstesatec RRE CARAS Se sharers eae aRee ee ae ee ee RRM MRRs MNS SME .° 08 878 8 maegs AAT Itanaes tatatsteettat en erege sobeerh reaa popegageneg egnye soCate gibeete rhe tp 8a Re, RRR otleean OaaR Ra MRataT IER aSRR NNBR SSX SSRNe000 MOIR. ©-0---+--SERRE ESEeaERR Feat LTRS te? Fat etatatetet shel vtatetalatatn tsraves atatat tat eES Cs SO etasscamnenee In COGN Dea DGNP D GDER SNRIRREEI ICSU WMUIRMON -6e'5o'uath Gas toy" DxPe BBHLT ERT TA OTE Ng DORstant CESKY 8 9° ORreer IAAT STO TUES ATE A ENTE Fbagehits TGA Oe, trasdategsdatenere EC OTE LOTnategr A STR Cane TeT eee CROSS ne ea eRRE Se aNO DARDEN, URSCMARINY.-.“2-!.*-*-0 0 ARO ecoROSIE e VALET BASS. 8. 2328S RNIN nstertonszeta testo ts toseenregebese tase tees respec any gee s7e WUtLCATHTUTATSTNLTDCOTRTEE ECL UTSTADETFTUATTE SCH PTSTALaTOTACSTETATOTSTENSETOtESolaretatetelatatetatetsteteN Sa SRS is Oi RDS RSS’ 0°," aaa Sn an CROSS BSD Dg SS aaa a IEE Ee SLIGO SSG ACS. "-°.'-" MEARE oS*- "SOR RO RSESMO SSSR IRORNSRIN sooo - 0-1 CMR yeas r nas 7s oso RROD Rao oleae ss a RI Satin asec scesere RMU MRR rE erate rcerc erat sccenatreabes reece eeeeatietan rene tree eater erro nese Meee arstethcennlecicisich SLacarelar IEICALEhac vasate, seWtOCeceseceCeysns el SOsOTeGecene arenes see ne OSS SSO c016, os St Sea ea aaa SSR Rs OR OOS NR RODS SURES Coo 0" 1- "0. = 7 RRR ses "> o-7s ORR ORR NNERSERRN or> oe nS ERRNO soos neo cc ene neo rar earns RO A?
eee Ie ate heya 72 aaa! « ae 1 ot 00 CCL a aioe ose nee nc ede ee ee ne en nee a en nn ene nen ra eA PN PaO R RRR I 75a oa oo oars 0 Aes ROE RE” =» 22" 2 POR ID # 8 ATE TNS 9 eo. se URN IMO ers “ooo lens a8
Pm ate a 4787809920 ey, eat ea ate a a ae a OO DG ea aD aan ae eae Ae aaa Dee aT SOLE ERE ae tat OD hah ma aE Rat a Oho athe dh Pi aaNet eelatetater tet 2". 5" a a ae a ae a ee So OL Te Ce 0 Dae SERENE Oe ee EE EERE TERED. { « "sé ssa "6"e AWW. Fe 0 0s 6 0-1 RR OM RD bs "be sr +? MRM © + 8 2 se + ee aa ae a fet 0 ie, | «eM aeS aos ta eee tote tesco tain nt a eR aE EES Se RSS Ea ESSERE Sp RSSSE OG SOIR CASES OSES ISOS BERIT EES SES NOSE ESI SURED MNOS SOE WON NOONIRD 018718 4.0 AHR M oe oe ele olny ate a ofl nee el alae Sa EVA att ae RASS TPLA SNARE a RR 85 200.85 000512200) SS PROS oo 2. SARE fa. Pata SONG 8. NORE ges nga oe SERRA erer TETRA: OCR OR RAAT RSS SEN SSR ee nae Hai REAR DCE DENSE SODA SORES SE SSSR SSE EDEN OC MONT DNS N SON SAMDIODISOD INS 05'S OMINMM ceo g hehe arena Selle ALE Serene aes AEC STATe TRL vOF LATO TEMCIV ACE Dos TAURI noo CEREAL CLOTS ORC a SRR 00 cal ao 0> . S900 OSIRIS: --- 1071s!) RS cOe
1 aera anes iar ae rar a hea . . ater FS ena ana gn aaa 9 a” a a REE RAE EOE IE OE SE SEDER SSE ECS NE ee a ee CN CR MAO 8/8 ss a at DO Oe Re Me Oo v= oss 2a DS
BMA astiteittnerstcttns GMOS ANE TS innnD tf OL MEL M ON nnn] OLD gu bn DOCEDELESD bi UD be! SECS CRORE RT aE SSR OEDS FDIC SSD SuSE PEORIA OU SO SE ISR 860050100405 42 "RSG 2s SIRS 8302), - RR aR RRR RRR = -= 1-21-10 AIRES =>, 7 cc ra SES aoracesaltenete eae ca ee ar) ‘ ee een De dale TeDedelelele te ne DeTets a leoleleTela leva te ala! elelalele lela atalalaselaea ee 9 0/0) 016 Rae IIIa AE II IIa a AN DO Ta aeRO ELAS RISC RT IID aa POSER”... -, Suir ep tirty atin ian ag ag ar RINT SERRE ix SMO SEES 0 ERC ESORCIEMERER,S «v1 «eR NAA S ANA MRO 600 + 6 eR ON OSS Se Memeo eteree tsetse eet lle oT bee CDT Srp nn STR TDS COLD UU SE errr ca ante tacetecticetetetetatatleletytete! 1! htt a a cc ec a ea aN, SC ea a ac iN te aS SRS Scan S . ‘Gir Saeco SoS TIS SMR SESE CSCSEERRERSERROENEDED”- >_> >.“ MRERORSSN RSID SRO RESO ROE SERED Pam nnemnnetree SEE EEG DNS DL AD SILI Os URE SED oD SS tae Sapa DES OR SCEE BEDI nT SCOE SCD EN IS NODC SIEM MEETING const oo co onycy nec eicha elec sneeossele area Tarececy eiatetesacaracrsst anette SMeuSetaeTafele Tete tnsael Tvtetalaratecatetetalaralazelitetatetehinesnttcto2et ROP Gta atcha asa Tata ter et Te ett Re TT WATER, We INE RURMR ro SAE Conta ates Teteti eens Ue ao fe faethe ee ete Ly COMM MPT rl TeeclESyl ERTS lant ts SenDg SEL oe USARceD E DS GSE DT DTI DE EEL aeT Seta tsDedede Sota eaelead 1 a le a aaldol a SD DS OPI Huaae Sn”aR 6 tae tat eno tatan a OS SEER RREESESE CC's WCSrSUSE 8-0a10,REISS CROCEPGCE SCOTaE SO+2) 7~— >. ERROR N SSRN SOIC AEN Se SRE BEM ears ODlle Tae De atele 6101 ASL PI ESRI OneOat BTR Seiten 5 Rt OaDONO CREEOREO RODS «Oh aECR SSR -- 6ORONO WSnate SOS] ee EESRE RRR Re teser eaaelsie eee alee: eee eel ele Seen eeeTS nnDD receST ne en eeeDD eenal a een en nnnDSI n nee e aie ne enn ee aennnee a rare ne (alee acne te ek RR RE OO SS IMR HRI 1 Se CORP eI OT S.on .” -*. "Cet NOSED. YW SPREE SERGE ITERATE a 0aeMTR ela SINTRA aes ga alenO a elle aCalalalelalaleletele lean 1Ke eSRNC oc a eae DEN ICN6 RM SO 10.6esor EME RRRek LRtee RRae HN EMpoe MTS S 8S CORSO«. 9.Sa °°?METERS -"' + 9. «3's. + cc iDRT ar EGRN °°. SOROS aot stat at eat taterSao ataLae eya ale eeealae aleoeERI ean Wis wee Oe ee eeeloeelelaiat ee eo eM eeela eRaleOM ewe € 84 wa eeSSSR
ae eeORE acen aeEIR eaIEeee Sec . . Ens Tepe St SD iaTET a ES cn ca ea em,” ih FT eeOe haeeeesaeTAO DtSAS Sena Dt PRETION Ste he otBEE hot REE hsIIeee RTses LOLS CeaeRICE aE ries SEE :IIE TTICET IEEetaEa nT SEE UEa OT CSOT St oa EGET EEToie RMwD SSM RCRA OPM CENTS MG Noone eee eeOS eR 2ESERIES.” see Re ee
Sane S ORR ESR ER RE REeho RRS aanDU ERE etGEE ReeO0 Sn Sa eeeaLREESE eee ene ncesere eI CE CCCOOO cc ccCETL a ac a eS Becontree BDpete Coste lnaT Sie RSSMR aR o's EMRE RR 8tol ete COE ealle are ar Sa Se Sr Seat SEC oe Cotne OPE REDed EET OE nnDS Te PTS es SS SON SSS RE SREB MRSS, 628006 Celebre tenerTa elices cals ace te lee ay | RAG PA SSR IRSR SEA SE Oe SIDE SRA SE SET SEES OK SSE SS OO REAR KAHU RS RNR Re REO REER SRE RRR ERENT 5S SET SOREN SSMS NaS prpSoe Th alavaTe le sles ecetalete el ilete ale satel e legis calg lal alate stele cate e aoe Ha
RSIS NG Ie Roc Sn hs GD ayeracaceseceraceece aT a aT CE 0 EE OX 8 RRR UME #CAE MME MIRREN, 60 fe.0000050 cco otiigtersigeatesats crit satnspeisererssssometctctyeatt . CRS SE oe ee eee arsaC SAL SECS ACACIRO CA ECHIATALOCOTRTACL ACACIA CRA ACR BeER caeleeeee aa aaa bel 5x a abel ae ea al Dee Da acer a Cae Teecale abeTELe Stes fs rai isWLELH ala a RUM 8 MERA REE RA A808 NTS eV ele ce lalate eel a laECA a ereeADey Sea DeaSCR a ceEE ee OCR ag ECR
te .
_ SCIENSES DeRC ETteee tare Rarae ran anE SE lleleleelf I Daewee DDD De eet al De a, eos a CR I ET a SERRE TE WN hit RSL OMNI WN oa ele els eects oe |SUR SEED See iataan we 7 ee- DTD . . ee eeheeae : wee «1-7-7. OeCALI See ah ea lerey ean, eT. aSgSerene "ORIEN eectaeae ev ececncssoce ete leesoleleces Seca ATI ane WATS RBS LEAT eeeloc DN Ce ISL es ee Bese lelaTetsDELETE relat aden lat lalelaele elite oS oe LetaSO lelaleletel Dletllar er aletetste lett steets ele eleoDELILE Debate sete sTeD te loT Te le] eelk 7 SO oA’ Soa ee Deca TSE T Te ai Mt gteTscone Tele steele BALE Ele, CELI LEER Tealebb GIIS Silat GUE DEEDS TNa DL DFDasSOC, wana a aRRM gy RN REESE TST eeeeaegdea Den staleca eles eta ale tele Te gy RRR CIC SCRPSLE SOL SLOE EL STC ACOLSCSE ST aE STELST ACRE nr DUCE SEO EE OE ETO GRE STSCI SESE SEO SO OS Oe SEER ERS ARRAN SX EO ORE RE eI PRRRE XN ARNOU SRR ORMA RRR AMR NN ES 6 60 oe ver ees nee MCU e lea ae ea OCC ae Oa Cena
Berea Detetea lett tele Sete y aly lata nell ote Te De elected Dele setae Sabet tete lela eet UD et lated te detatete re cate) sa So SSS RS SESS MRR NMC MICROM I ce seca Dae e a ge eg ele eTaD Reece aca 6D ek ees eee SERRRERER REESE KSEE ES EMR RENE U MSS REESE oie REM ESS DEERE OR IES OM REM M ROS MM REMSMUN IS x0 670" 6°1-0-20°C cca leca Seca ace 8c nO ee SPATE CUED 10 1 a a a er TEES -
Ba ee ae Le TT Te Ne Dele Te 2 TET Te al esl 010 Oa NNN”, Se MPEP INMRD DSS, fy0 css pico | ye lath inate GINA pole Dell slag
Beeler al leOSCR enlaces OnnUSI SINE ith aCRORE SN eREERO, Soto econ in 8one hi cCalius 2legis Deena ‘SE ROSIE DOOR SSSRDl) OCATO REE OG 809,088 800005800008 eee 8Llane AH OLE 00 ae ae nS. BeitICEnse rT es a el nee ben ER STSOMIE ee gia oie roa 07067078 i A eS 9.0.9 NS4ARERR RR pret acaa 5coat lang it (it ‘COCs os OC ee SA COSCO EO EDC SOOO SOC AROCSC MORes ICA O- 1.076 80.1 0 "1°01 4RRR 0!4 9 078 ca 0° e tt 6cs 6 4°04 000,088 a a a aM, - Ties al blair na : “SORE SRS RRI OL SCE ASTD SE SE REESE Sr BESTEST ESR SESE SE BEST STOS SESS IC SOERS TESEGT SEITE BSE SEDO ESE SIRO SCE Es SS REESE ST SRE SOS OE Se aa ORAS SRS RR BERET 26-000 SSR USE SEE LER: StnaSE Se Sia as SSCA Et LT Se EC ST SA SORES RTC CO LESERS
[SERN a DESEIT RING IG SETI RETA SEE EAE ETSE SOO SE DS SARE SENOS SE SEDGE SELEOE SESE SAREEESE SEE SE DCS SATE IRE SAAS OE SRE EE SE SORE DENT SOMES SOMEONE IEW wh 'e'n “eye 9 "eo aha a0 "073107119 1004-08 One T RIC ED ATO C10. 0080-001 ane aE a ERE RE RES SEE
Ben ahelelee ela Dele tated fo lalate ata ate da sleet alsa alae ete) Does talet ss eleatial Tee ee olalalelateledstehale fae lelabele lalate -lets[alal cst ro SS SS SMR ROS MIME RSM a Oy sa ee ele lalate ela Taya alee lees ale oT Tale a Late alee ee eee alee eT
Bp So 2oTe bo tes ono SE Dre ceteledetepetetars stele Mra tetete Gu ose noon! et EE EEE Ee ete ET a ec AS ARRS 1: SSRIS Bam Ree tSree tC Da De Se Dota Gaels ate etateda a ote soba detest Db telettel
‘SSE beater ekeIPR a OSinne ES RS SDE eater a «dF 00 sity DERceweterien a Ee ER Remney ee” Bein Tr Ae eeeSoC tee Stes Tilia IngSecolelecesaleetececatetaleletetylabateles'e\acotec ne i ES EA a a Ro ARERR steer i sy ey Sea nigng nen eimcr Breccia a etetel ery ee latn ly TET en a ga TTT Sas le ete DCD aD gee ale nee ee eta tela oe UENO 1 ee Es RMR ACR SE Cee sa Cr Cee ee a aa oe aoe cee
‘EORTC SECON EDDA aS CS TSS OE Ea aI SUE ERECT SEA IESE Sn SO IEL ARES SSE ESOS ERENT SUSE LSE EGIL ESS A MSIE NE LEDGER SEACERSSST Cans c's "'o ea ot eSate te tatetatctatatanate’s ar stataleOeptitetstatata et otras 6 GNC eae aaa Renae aa eae te ae ee ee -
Bec erera lei eta eee Delete eeyalelate ada ee elesate lela-aloes ele ale Tale ee lee aT. .eeaaa. STL DDT EOESaat UOC ate OS ae DCR ele Sas, ee eee"aT el elles DL Cacreeacec Cearorneara ays we ane alee .SEEDED, memes ROSE a CEERI at Na at ad a's peeey ae ay BSE ESE On ites Ee SLIPS aoe RRR Oeeer enter oa Luncrnn Beco eter nn tteSISO tat br elesLen bl eden benUSTED atey Mt beyoe Senet ed Bt DES OESao DET OL ERccs RRRLone RSLS, |en SERRA Coe Telaere on) walatelsl is tet eit, UT Wale
Brat DD ei a otLeSoa lasted ST ll aLTLoSOS od SS Tas) StSoe SRRSPR OR ORE, 19,» egstCWO Cae uel Steteaceti ates icaeiten stem Bo UeNODOSA on ines ee Lanta DOL a eae on SOUSA GSR ROMER REORNS sco elesTST lla nar feecsieetyecenantadeny of nth STS SSD Dig Bsc ovelelyls Telstelelyielalets etetstaetely celelel Solaletalel Delelateletee cietels AEA CEC OSC OCD OR RESPIR DROID N80 0"0-p's~0-00-0 0 9 0 03.014 07) 670-0_0-17010°0-0 1 CHRON D- 0-0-9 0" 9700.60” 6_1” 1-270" EEE >
ARR ESEOS ER Oe RE CRESree SSE SSRIS SOREL SES alee SOT ees DD OO SRO DOSES SEO EINOEE 0"'ve'es“o' su o"0‘e\y"0" ne e’hee"o"P-0'a-0-f,0-0.0.0-0-3' 0 MMMM NB ED 0. tcr-07e's-0-6-0.1"0-0 0 RC ee ee Ree eC eeeoeater aesnS aes aE OR NE CMDN SENS ReoEEE cAee Ne arene RES Be =F Bt DES RY SEE SE meek ay eee eae:lee lateecele ataSCT. ets) eeeencore ee Pere eta SR tat ne ODE a oe . resTE oeCOTTE -, Par ereenenr ante ae,6saUTeT ee 4 CSD 4 a aeRE wmSeat be ate aneERE SeOOE .".57.".”.°. 5s Ss Bee a NAAT TEAS an ar ae AL ae TRL TEBE, OE EPL Ese nent 0) ULATED ae anne ete ecatesaeelelateleeeleeceleleeece eleSin CERIO Ir o0-07e10.0"8°0. 0's SR 5.7.0.8 Raa aE ENC REEPe Loe SPares aE SE COREE TESTER ae, —
BEGUE eras tritrcetatyteretecetetetet atteEUUST Delt genie arecie SUS cet seat aceSara's ae eee ARERR RARER sce RETR ERR i ORE OOR TC Rerhea ee . BRE SET UEC LET NEES EET OE, DEED UGEE SEENteSEES UL EI SMELL! RIES Se, MORMON Aaceyeeheceece lehel LS eet teh cat tateles Ge tei reteotter 0 telatatate
ees ot ee eS
Reece allele el ae eal arel Le lees Daa letate ee eee ele ee elle eleleceletnlalatal 1 ely lee’ ale! cosas lea! 5192S TRAC Re I Od eis arae TS eS Oto ee ECS vie viele Ca lelatalete’s ese
BTS TE EST CSTE SORTS SoeG2 SCSI S: Se nene reece0enn ee peatetas ster s Kaen he viatane Paes ee Soe toe a Leeheel a TOO Ceehiv ae geacu eee Sn Te ee UTE Bosses ornEES ee GANTT ah enhEULESS Ti spe 0Nhcli NRE a) UT ESreeen TORRES eeeeeeeat crt A Rear eo Oooo aTNSSalad neh On a TAD eae
Rese We TATA Le ee LCA LD LSID DLO 2 cc aR a cee Ie SERN oo VAIL ARETE See) ILIAD 0D LAD DELLS Ena OTe COD WO SEARS CAE aC REESE aE OE ROSES SETS SO SOL TA BE BOC ERT SOCCER ECE ERENT abe ehee"a "a ese ace sca ci's oes ace ae RE REE CANCE A aetere 8: ee eo a Se EE SES Se Se ESE OE | BPR Ne niOEOSI Eee hal RRRESEDA ETSI COC SS 2OEaDEaaSeaORR RECDE 3828 er Bare te Sole og teltghen ntis ced SESE COEDS URE OE SOS SE SOE OEE oH SEERMNpantae E 8K ¢ 9 8 8 0 00-00 0240901711 17007111 0 6 0 00 CI 88aioe UE SCN ROwatt OR ERBad ED SEglare OOO SESS BpncsTeleca eet rTete a oe eo sla Sint aTa Da Tele ea a ete ag ae Set eee Tee ge tee! BORER ehecn-acefe"y ere “7yr-e"s 1171" 9"s 09,6 Oe ER CREST ee CE CREO ECE Besar tele ated Bete teeth Tee bela er BS Dols sa epte letae 8 GD at ED UT MEL ECS SS RTD DEA See cca carat LeLren eteeat yale Cotter te a atele le fes benecele tora ets ete oD De aD Te a) De Dee eee STR es il
Ber IN re ae ge ee a ete ae ee Dea Tat te tes alee oe a RCE ety see eeMateateer ts So et: SEO ETE EE Ee SEE ERT CON ED Cy age ere ate reads
Ber ate telesales Te eae ANT Te Tale le wey acele e veel Tale ee soe stata eaten rele aye ee RAR ERAS SERPS. 8c0 8080.8 280006 84 EC OC CRC SOE SESE EEO Se SE
‘SOR a Aan NIA ROSEN ARE RR SES RN RIES RECS RARE RRRREMRIRS So tse sctcon sae 8 ee 1 E O a R e R OC Ra RIS -
Becca lace staat tele etelela le eleataa le ade stele ee) lead le ele ecatelaltelete lees [et Lalaleletels! os lelelele faces, 11+ ee a MRI ea ae te "o! yTsTe le ateeam encase esl eS eee ale Lala ea aS ee leDa alae ley ala lot oe DTA Deel dala ela, saat ea leat tata lalate lata ala ae
ssa TA REIN ee ATS Dela el el eacate hie edepaa cara cob SoPat eat cnet et etetete ee a eS Aa Te ARE ESS aaa Ra TEI EE SEE TORII aa ERC SLO RPLTSSSIOEIOC CoG DER THESES Denies eating”
Besant esa Nett ae Delete abet ot OE etal tats Delete te et eles Sa eT Lal aD als eG MIO Renee eee aa Solace heap renew ta a Dee aly lat ety te alate la el elale ty ell ote ateat oleae ae DD e galas ela alee stale ey ele eee eae a eg RRR Oa Sa aN TEER eae rie nara SSSI SESS DOSE SE SED EEE SLCE Dido SSOBSESOE RS ERCASERRESSICEISS *1-0,0,0,0.8.2.202,8.8.9.600 27. 408,9,1-0, 6,000 SON ho 0 i ana ween oe en eter Lipa eal orl elaleyg lige tear ial scataba
BENE IS Le el anata ided DIO SUPE Leg DT Den Toe ee esto SCRE tS CELI ON gh USES Tae eT OOP ETE CS CP Re, OTe CUT aa
| Bsc SRS Ce UCR AE RS RM RRO RR MMOR RIS 8 -0-0° 606.8 a Cn roca elt 4 0711 o 10 6 10K RRR HSS 0 08S hc a cc ec oC i ce ee ee ee a SCRE. ace colette state teret tele ate lotstalelalele es) elplelste cele ilelelalalalals lela] leletelalsleolalelslylelslatefelelelalelecetaletat +a te eT ele SOR RRR SBS a TAT wa wR a eae ye cetyl Tecra Decal lalate” cele ats dal lelelel lela? alee Deleted alee ete Tala le eels Tal eal oC aaa ae alate aa Deeg
pees Rte re hee ain) Destine tenable CLE NS Tug ig eh che so SEE GRRE Cn NTMI R tc” Done hye! Solo eva tetera sneetettyelet ge tert hoe vay ae levela stateless lf Bete ORY EOCENE OR EOE CG1 MO EEC ERECT SS aaa OSCE torte ceria saree nttls SLO AEA,ODI 6 AtLOA St aitCeatESO OURCASSIUS titan AoneLIEN oats Ten Beene ea CeCe TET ESE AS SOTO, PT CECE Fe GROTTO SD TGCLL ER e268 athtoot oO sat RON ec ST ERE TCL TT A DOD: aS Deets STV Dea leis bois SOs SIS Teta Dey etn bet eter ees TD TID sete eo ahVeR mM esD coeecese eT fe efaeT Le ele sells alent sleet ealite Salat gteletate le 7 DST eae staal aaa eal eae a eres a Dea : RS SSEBp iter CE OO, CO SEGUE ORL ILELSE C S RRR So 886852 eRe fo ACEC N ete Elen eee as LAUD re tos Sone ils a een ehh TG oe fe TefelaTa AyD ela ayy Tele eet elev etelelal a aTala a hates el olala el eT etelale eel als eT elyle Tele ale neste lets eal elt eal lees 127th ee Roe ATs eme wR Mme ree 853! TST ele a Tes Sy ale taal sls a a Tye sles el ae! Teele aed Celatela’ aotals lelelalaletsle ele ls Terelelee so al Lele ea eae aad —SIRapaeeea epee otaein PERRI IT REECE REREIC ULES a ERIC OSE CCESED a SOL oi Gd EOL EE Ss GO EOE Os SEUSS CSRS aC nee 'o eta tsi eee arr RCRD ea cen A a a ee aL CRD abetae eof lee ese eeaa steal Catala acetate ota ete ee tats on or ae selene
| CREAR pepaE oe EER EES SEESen MESte OC EIGEN EES EE RESIS a nea" Crt END seer Saat sn gece tk ee oe A Eo ee ae eeeaerate CIC CNET Behr reSe eseEKtaEEO eee OE UIICESS OD Sota eteEea RC cc aESE E82 AeRC SRSM SaME SCO SEENeeBere et"elig7aine a eT SgCeotacatec ao a BB Pesce a EST IAI gg Gone Slee og gc NID SDD Slope de le ee ate tt Tee ae WPataSstetstete cet wala e clot itetytete cetote IMMA re pale aate gee erat ERSMELS SaaS Lp Sage e DRI IATATET RD ct latte 9 OUT UTE ER EUR NTE ene TeT eT eat
Bion eR ee ate tite CCEA TEDW TALE CEST CCE GETTER ES a tS EPNNEat ee coc laaclecate tle lelece ca ately alate! lel lala eceteleela ehereletales Tereray geletaT@ly eT ag aT OG AT eNOS GSU TALOSTaLSETES Let S BBS 7 OC ORT TESTE BR CS OTE EGY Sse M Hn Rena EEE Sa te Se TLS aa lis se sla elsaeles olen o Tele niet shes» slog t ingedetelielelagsaa Bip sca feo steTere Teralataly a oe ep leaty alates are eee yao aerate ee es Ue Tee eet eon ae os Tegel eC et RR SIMs Re pinnehele ala ew le eal nine aaa alain late ae ele ta Tala eelale la ela Teta lea Tap a Lael Des ate Cea ee Oe ae eee ae a ale ale ea eee BTR ‘SARIS Ne SCENE CNSR AOE SAS SS ESSE EOE SEG evs = = 0" * =~"... 1.0, SR nities cotta) Doar tetretanetig toca [nan teretterstararateag Beso le alelelallalatel ple a Tals Tala lalate alo eles ele lah la leal gale a ae ala aa Tea alee aaa eel ae a 0 a's aaa weal e ele slayer selele le ela sala Teale ela aly a eels ae ele el ele alae ele aes lel ele oleae ale le sea Tale lea) Delile Lee] alelslady alae sel sale SSSR IER REISE DEE EES SORES ESE SESE SE MP SESE SE ECE EEE SCM OSES EESTI EN 0-809 ec re "1 ea" 1 0d ROSEN OE SCEE SeRL ERASE SESE OS ER SES EERE SE SEaE REESE EERO SERESE RY SLE ARES TS SEC GEE Or TOAST ESCO EEICOE AT POCO EOL OR OS St CE REE SE OGE OA tL WOOT WO)
. Bees es eT) I aD TOS 8 OR esate NOSE tag Tels TSMR ply le aT Des ope Teese Coils dns Dllne ib ieici Dc] iedigesr ct ey cat a vtecec ac enececa
«SECS ae OOS CARE EEO OE EOE SCE N00 0-0-6" 270 y 0"9 "ros 0°02 RO ee oe Se ee ee ek ee ore oe ee oe Ne Ee IS)
Bennett eee DE DELETES TD Ut SLU Ln Detects LSet lela et a aire Te Tes Ses WT tah ead ST La Debedaletelee ts vote ot Telsdatt g tate Tl otsts ae tilets 0 DT bbe else tet elalsCetetal etal ells eee Teele
‘REREAD E RARE RRM RRR RIE REEree RRM MERRIER DOERR 80. oeeDreams one eo7r'Ue 10-0 Lae CC DOREaeRO SO Cetailed ETE eevee ORL SE ‘ Pennant ert th eet DLT. RTT ES ELS LCL SMBS Be eet HePe Tron LoD oe alcatel tel0°08 ate teteta eTeh seee DS DeCS aoaREI pheleialeca Galatal atesSCaero
Bee UENCE EULESS TE LCESLERLD VATED IRTP 28 fe ON ORSON a fete 9ST TNE SOO OEY EE an AOU a Ce a Le EADIE a LE OEY CREPE € CELIO RTs g ES CA CRE CE RICE ele eae Bate a NECA TES
Benne ee eta IS elas ele tea RR UR BRRISORE Rees. 22a l TielA+ areata a ielgietlel oe aielelel alate ene le ad fa ele lee e eay)eee ele SEES olay earn ee es eeePE a Tee [BBSRC ROU e RE SCR RCN + COWL CNT eos 0-0 e616. 9.lalate 11a. ee 0.Dale | 2402 eCal eee a aelceghee SOS lees Cyarea Seaaan ER EI “SRR astet abe aaa NaEIR ICRC DEAS ESET ERR CRESS ER EISEN SEI Wve > CAC eno Cae SAAR RR eS peecere a eae note ae rete ee ate tpg tenet phe oN tote n le Cae Ee aE RETR RCRST RE OE tee Saas TR SESE AOL ST oe aT SE AR St ICES Tn APSE SESC OE DO oP ee ee
Be eee Ae ecRRA a ee een oeLORE tg Cee REUSE rats! vies SRLS oC CEE oiler eo eel ene eta Cee peeraaa De)RED SIMDESET MSL ORORROSSOTICRE E GTS oman get itt Bae ee es CCR EEE Sra SULT ALR 8 Een FRCae0000. 100,170.04, 00.0.0. EEI Te SERRE OR SRR NS NN MORNE SIE MOT OSES MMSE STM SECU 0c "D'a°0 "SNR C8000. 9"0-0"078,8" 9-1 0 0'N sO 0 ROSE aE a eat SOG EE SE SEO EE STOTT OGRE Or SE cbs be EM TE SLES TE PURCELL ES ST ee | Ta Neh aad at at ae eee ae Oe SEE Rae SAGE ee a eee cae iat bs marty st, 8 8_4,.0 Sew BBA 4 2 9804+ ss 8 OOO a me are hoa itd et eta te tate * eter Tet Tae ate Se tate Bett Moe ete te we ret a! tate atte ste rat fae Seta et ete e ete tatet et ae tetas SSR eee USAR DMR MR SOCIILSOC MNCL tes" a-a'e Mist. t -ecs-1_7 t1 1°09 0.8"9.00008, 8, ) iC on ee ee ee ce ee eee eee ee Ce ee ees AREER A RRA RRM RNR MAMAN fc a so-o-ecs/airecereia1 “1 6is't e1e-s7ests0.0-9; RRS RSS a RSS CR SC ae ee SEE OC RE OEE ER IOICIEN RN SSR RR ARRAN A AME SME SESE oS NS RISERS IRI Soe" 0 ceo" ocd vet end 6.1 e'4s6a's 1 9" ocel e820 se ec ee ee ee a co eo ah ae ee Se eae tere See hE cco oe ene SRT ae Cae a Beet ERLE ETAT ERR Netter nats Tetatgtrtetst CS, tot st "ss a PIRI RES Sef fete aMeS TEES ENT eT BTN ee ey gS R TSS SOSA AAT Ty gee otha tate lta atetatety gotta gta thetetete ae sateen teteteha yates phe gets Dep lg aeleta ta ea eae eee
RM ARA RO RRS eS OE EES MM SON SN SOE MME GG bone “sehr "s "977 °1s e177" -*) 19 %s"9' ee ee Ce ee oe ee eo a oe i ae oe a ce ioe hor ee a Stee nce ot hs GE Nhe ear CS SSoaesae a ese SEK SDSS SRE SEIS SSS Ci SSSR SRSESRSRSERRSRS conch e Ss0)otsaSa ac NSOS SINS OIESESDCSAE SI SSOS Uin wa Sa Sate ana aE TENN OLEAN CTS SH ILEUS OTC RR RO RRR aks RDA TS CATS H ae aC ep acace ace NWA ARAL S CRSH gage, Le CATAL Y cach eam e a ogal DRAG a a ecen Decesh oDASadateda eo scalles ca 00a sh Dash aSage, ales Da ota! ifenenasagesetecererecatenetese
Bence’ e"oly"s" arate y orale” plea Tea 9s Tee ne 8) Tatyana ee Te VATS a T8 ee 2°82! e 988 0's NR RRR MR a ek ek es eels clase a mise eee ele erase tara eis alee eta ele a ele Teles la olelelalet ete lelelalacel alee etal alee letele ole yn lalataale elecalelgtel oa elar late gala stale eal e aga Ce eR aa
SERN eee SIRS SIC Be BER aS OC GE DBT SE NOOSE SRST eee a's Safety's oe 7n7 ao a h6 708 8 7 eae ee et Se TSS GOS ie SEER Coa GE RSD BaD OO LES PSE SE SOE SCR ED Oo Na oS Oa SOA OSs aR
{RIC RN SN SCI IC MM MCE ea ts Sc 08 ee lelae eee 04 7 eo. Sea a ae So EB Oe OS OO OOO {SRO ea ES CME RM MIO I MK ROME CRAKS CRD 8 7 tc se ss 400 01007970 8"9 476-8 a Se a ee Ce Ce Ce SE SE ee BEES OC CE SE OB Oe CR ER SEE BOE SEDC NC OF BO EMEA SUCRE DC ENC OT OTE WE SECO SE IY SOE
RSENS aR SING SN NO I AUS I Ok wees yrs eer "pcre aly ey + 7s Se SCS Rae SN Me CSE NORD SER Ba SGE E SE SOE SD Ot ORES SSO OS SOOO GES OE ETOCS OSS SEC SE RR ESO rt SRE RR EEC EE ERE SEE ot
NS eC MON A OAC ICICM VR se rast 307 97 Te aa 7n ae 8 1 9/2 OER LE CO EaatpISE IES STSLEE SEITE SDDCE SE SIIAOE SEOTNT OT SESEEE SEES GE CAN UCELOR SOD” SE OEEESEOSE RE SERRE ROR RR MM RESTON RIOR SRI MOMENI WH RRR ICRHOT HS. o-0ras 8 0c ele see 604010 E0080 Se a A ae SL eC SC SO RO SORE SOT Oe SP TCC DORE HERE GS NNEC PRS EOC SES SRNR RRR RRM MI MEMO RR IRON MCSA ORR MAIN De cs erace sey ¢ 7's sos cs! ay “y7eTs'9 00s tS a a acco ea aa SIC RIC TOM gOS CSCS NBC GE Se Os BESS SAO Se SOS PE SE SS CE ESIC SE ONE SERRE NST SET MO AES tee eee AEN ET AEN EEN TNE ANON Rha) eet aaa a REE SR soo SR SRA SILA MINA SEALE STS PRR oa RD alas RATE eck ay Nr Se RR De a bled ocletatetg totale rete as atpte tea atone ate eases Sef Sta eR AR CIR OCR ON SOILS SC OC ERIC RMEICAESLIC Boi Te" acbToss Te" c01"b1 676 0672029 a! 178070 2 ea ea RR CN SC So Ce Be SEE Se See Se Oat EO a RT SOE SE SSS SEC TON COT Od SOS EEO eS SRRRSSAE ERAN ERMA ERE RIOR RARER CMMI NOM MMMM RRM RIAD. 8.9 9 osrcene ee + oor “ee oie" y "rid 00s Oe ae a i i i a ie eS ee ee acca ec eC St Seo ee co aS SEN oC CEN CE RCO RO IC SRR MK ARR RNA RARER MRR N MN IRN MARRS ORO SSR IRE 9 se 0 00°8 6007 4 + 609106 9 520.0 10708" 0 SEO RS SS SS SSO BEDI BRE ESC Srey geratestlte bathe ec etehetetneatetet ohetnte ratitatacatetstoatennta Be icotarnracpiosecateceTecaalesecarAceTeer ecg a aECA ROOTS EETACE TITS ECS CTRTIAE ST C67. SOOO ICC ER CRM SIRI e ec ace Ler ACARI ATS STATED TE STEERS A CSET AC ETPSO OA RATS eB TER ELLE An ICES e ales ee CEL LOA nbn SCO US mM ean Ceann eno licnicinatiieseceaben
SERENA RRR RNR ER PRE NRE R RENE RENE MMEENER EMER RNS Tree ier ries ete Oe eee eae eee aes a eee MaRS eee ee Cee Resa EN S
q*xs&y c
COA ORR ERR RR E E U RR R E RE ORE REMM CA O O
A
N
MN
R
N
R
N
° ™“ re ¢*3 a al, 0) .
O
N
E
O
< nn5rom I¢ a +7}¢€ 475 SRRRAEN ER SO Ph ie A SSeS id aN eran CaSMESS St oeNS SRDSE te SE NO SOE OE SR BOS BORED OA ES NG MEE ESE SS msnesc aN Mm FNCRAABK aa i GP Pie Pah a Sea RY ER ROE REDE REAAe EROS Se NMRA Bt DIET Duta PRFea er i RRR RRS+SA ,'-" ORS PONS ERS DIN SRR SAE IMERERA 5 SRO MATA srcane NER RN KS ReSUSE a oeORE oS OR Oe SO aSC SSSR i Ga aI ii eM aaa ca tara Pa Ter SP.|RIOR ep? :RNoat aaNet aaa ere I 8ESS CD 2 MN TA aOSRA amOotaSees ataSRnag ttORC atERM De Oe WO MO RICE etFo 71‘ Tote tat shane aleLYK RR IBeROS BRISA ER AORTIC
RNR ERUKne REMC RE SRR REESERENE mt ee SRB ns et RN
a een” . rere! PRI Pa Ps ada a aad te he Ph ate a i et ht BB a OIG ame Sa age) a eS a Dk DO rir eS FPG a a ea NP SES SSSI ESCUELA Ot ROE SO - ranean CRM OMMD, 900,900,005 8000000 n 808A cece PE OES PEA A aL Ol ROSE ENtala tan atatetbatateaatatatenenesoebectar, aterbe ghiatyratehecetotacureta’etataral at eteral abebetaticedgtababytet ttt tees titastE A, | RRA E.BUETAB SoC SoBeRTOS TaR tTTOAST rT eee TaUE Pate ara aoe neaeg atebeectenetetheratatatecatatatatatatatatetsbetatat t MP MACE GRS AEA LIA LCA eatgtatatatatatatatatetaretatatabetetetetaty tatsNE, tetatatetetet ety tstgty tet tete sete t PR800 EBS ELE Se RO 88Ot B08 8SecO fe Ae Vette te ets talalatet eteter a eer Peat Se ie a eS aatatetare «oa! OCR Ae I ON, 858 FLE LE Ne anectsa atatCCE OTR PTATA’ ONE, PTE Tobtne PCAC PrHee Beaetetae lec teperevenatemetissnettersrerrusisessns tasElalelalelefal
Pico noe 00 OC OC SO RR OR a WD ea a coe 2) CHUTE: RRRRG SIRS SDS Besta PS a SUSE DR Dc AOI BW I On SNH CICS BN i SS ODO a a OP SCPE NS” 9 co” “ncncotetececuee + 0-4" "0'4 SUN KM RM Ban RN SOS Re RRR DONTE SCSI Sra ISO GC i SR ES
I SO I DI a Oh Ne te aaa . overs ROKK RK MRK E ERM KMRL ERM ER EA ELAR RA LA ROR MER te SS he a ea eae Se a ee aE SEN Sie OMENS 65.6402 54 6 pe + #15 018/808 RL a Dae anh eG STP OE ESIGN Oa SR STN SR A OE EMM SSPE MCT oratateTatatala palatal etal etSee etreNe tpt tatte ett atatgtetat gmee tate tee ates taeatawLe (nD eae ' RREARA CMR ES OMS ONE RR MN RR MR SERN ERE SETS ERS RRM RON ERAN RESra RSSaE n BSS RRREIT MERMAID craves oT 010°) os Oe RSSCe RMOBC NNER Ree Ne eeCO Le te ne ee erelela’ eae eens taeatetet eae See Nee ht tet a ae SYeteRESO AEtee. "FPbe0.828.0,0.000,0 ROL) I a Oe00.0.0, Saree°, aati te ee a eeRMB ke kM stCa ATeaeew RATS kee Oe ae I Oe eee eaeCRNA nen ane ON CORT RENE0.000 RENT CIeroe SC tec SOE OE SO SSE CCE 5MRE ia aE are rtd BB ner rem arte ty SSW i tS RIOC 0SR 8 Ot IA ISeetae aD atBsOSE Oat iheGTS De8sDe =8 a TERN SN ERI RII OR wise CN ONatsts I CR A«RO OC HH er Od Oaatt tae ia SE DTS i OW eB ae SOOPER IPIRRENE S186 Tee eSee _: oe oeaBae a-— . _ oo S re Cs eeSa 8ore ae Be |xeea ee - ae a#£ oe a Bs ffAes on _ oe oe Pe =na | a_oe Bee A oroe 8edee See seas Be . eae_ :oe ig | ‘eeaoeae Be Ve aue — aS eeae es _is38 3Bo es eae ee eo| Bs ba _bee Sgee 4ae ee ee Be Bee iS Bae ae Baa Phos oes vsah es“Se _ -_.‘ bos |ae esae eae ean2 oeee eaeoe “ Soe ee vs oe eeee ete
:_oe ie - : re a a aa 3 aeons . RN oS ae cee 9 Bee ress xEe Dea:oe a=aoes is se Ree Sites Sas oy Rei ra) one Rete aerea_— ss=a. Bae ge _. _ eee — sy es oe 3 pate eeae eee aeReneS .» ets Sot ee SS eh otoes ae 8 ey a oo7. oreRaa PS cm | eatSe Sone a Soeaare Ress _ a reeretRobe °) nae Boe racesae a8as . i, Cre py Bes a ? ae: of Sie BC none oe oe eek os eas ns ie stated ss ee Soe ae ee Pon “ ae nee van ae eee os oe es x Bee re oe es eS et sage S ae one os venoes he ” ee % s water ‘." s SESe a scene ares . erates oe
‘s os - Za ce cee ee ao oe Ae oN rs ate 3 Se oN a : oe aa seas eg Sos sea = sf se ss oe ce ae re secs ae ee sae: BAS oe oe . _ os es eee es os ae So see’ Ss: EL ape an ees oe Of anes ans ect: cece ees ase sea So: ae, ee ~ o 2 B ere eesiete ee eee aesoe an cen ot Ss _.oe ed7 re aaoe i aeoS eee_ee _oeoeRae aoeaeas ¥ ‘a~~ oe eekBees ee oe |psFepie so se.se esne oe an ‘ce i ¥os sete See es oe Beepies cs .ore a_oe a xE-one Agee re ret: ape 0 FS. on ie a4 So Leoe aie ceee Se —
b>: an ; 5 see me ” xy ioe ae ete ae on ees st ee os aa 5 Pat ae Bas os Se Rie red ve 5 RX. 8 ss ee sae cn ei a a Senco 209 Sees es my ice ees *. . Pees or see ae .. ce % Sen an cen < - ms oo oy ies cae site oF HO chins
Bos Sh aon Choe oe eee eeeofaes ae eae — oe tBe a _.*ioon sae Sea pete sere Seeriae Pe oe oe Ree of Ses‘Nex Soe aie 3 a- Laue ee SSE aaSake eraSey -oo.. 7. ee ebSe xh. aa Sea ore‘ Sak oe 88Se Re oo eeaoe ae :”.
a Bee —a ne aoe a: .A= oe ses_-aa rie" ttex=. Be Sr2 Seas Se oe eee Roeee~~eete . ae os Bee Re pas Boe Se 8 ae se aoe seeeee ne aoe B ror a ae ee ens > sees oe: ee ows Rs-sare a nase chee ie oss hae on oe rere 0 eer -
:be — oe ae iyoeasoe _oo:,Seas: 3_oe| _. ee | “—Sek: i. | ce oeEke ee— aeSs see eaa| SSaas— oo ES a ee oe ee oe me oo_ene acoe Sa Pea 9 ee 7 2 Lee oO : eS - re Pats aoe “eesa eat es eh ceeeesestas a te aoSee aoe2eae 73 aeooais _: aoe we aeSS Eee oy — x ._es oeSoe ieras 4 Sn sa oessae Soe aaern a*es teeBee* :ar oS. oS. a9 _ae a mt boo:.. ee arteBe A ‘ cn ay Sats cok oh eaten Bros meat = |x Remo oe Bae
Bo Rees 8 Tae aCo _. +eeoepees ae ome 7 Boe otion0 se fetal ax se sie . axes Bone oR Bo na ee wine aeoeee‘n eeBex oe see recess eteeee 6 SaeeoF eyBD oe eo 3cs _Ssoe oo oeoeoe sss Rar cer 3 ssa ra Bae ees xeas ERS osahsone od*: _ Bos neaeeae axes oe tate? oy eestate ?onSis eta _Bie eeoo 5‘ Sess Ratan ce =mS See serosa = nae f xa8poe een oe see mens ctsee aeoS mite eeoeoo oe 3 aS a>ae ie nae pone ee _oes Sons ee Sea rene m ae a7:. : race ae oe~oese 3 Soe aon a een Bee. ae:Se Sees is teres be in ses etSee orSe ate Sees os cto ee ta aro “y eS os oo fon — ioe ae ore aoe Se eee we oc ay ee . ps a
Re Seah ne Soe BRK cree et ee Ses Me aan me aes 209, oe Soe: oe bo an sae ee ee ot cee . ad Re cae ee ae Ee . “ee oe ca tat oa fas rae 9 Fs sae eeicon’ ac set KE oa oe ee ekone ee .sir wo oan ae ~ we ae aoe “ee sieiose eee cae eine So wees _. ae et ret —— See Nu aeSs*a. ser 7aoe Stata ‘ oe ro
Bs: ee ny Sues aoo weetals ue neoe) ieate es esBae ee men cate ee my oofoes vexom roe 4Bas SAK cre “" roy. See 9ae eeon osxo gyes os eis mephe sot fess Bay a_ chee es4 ela aoe es soca aes Buse mod a ata is es Senn “5 * oe *PERE pe“.Fc mee ee nA, Ses mert eae its ee oe ae 2‘: cere ar ate es Been "9 oe or isee Ry was ee ee can on sees “oem eee pee as ta) aes Bars Boe ie oe aes $9 aS vee Sie: ee ees oe oe 7ee 8ane Seer: Bets as fist: re See sen oe Se ee oe ae Bibs oe Re < a +s oe “ ah os ee Soe = za _ Ss oe ee a 8 SS ay BH) = ‘ Ses Re Seas Soa wa ‘ “ Bee en . fre . ‘ i Sere eo a rae ii sees ee _ ae 25 sos ea ae SEY See _. ays ca Ht Ae Rx eis oa oe St Boe _ Ss m Rs Sees Ss ore poe ak ae ceo | oe eee ans a oe . 2S eae ee & oe Sites ro ee + eee ee a Loe ne ao san a | ae mn oe TEE a — oe ce as Rs ee “ 8 eS een Soe Rae Re Bee oes Se See | ce ee SAN ee : A Soa Stas yan ve ie vt .) ae 0 eee v ae on “ os Pets aah re ene ae ce. ve ee ae nae nine a 5 a ied cae ee poe eer ‘ sare ee oa ae eee ae eae 8 ea Been » se ah sas sao ret 8 a oh eae eS ree BA et sar 2 ane ee a a ae oF Shee mes Se = oe 5*at*“s ee e‘aoe ors Se ye aeamAs 2zee *arahd as Sais ‘Mee iSte ee eer See reat .aswe ine ae st aEo oe oo _ee See ee co ce exace care Sa och 2: re Seas Set
t* Se ee ee aoe .8 ate on Aes .ween Oo ee _ a o «. Sas _ae: on oo sae _~ Be aH :‘ _ce :F — a = ~ q; ee_o. és 4 NSSa % Pen wsun te a=te2. eee sas “3 . xeas wa»a~jear a ma ree) Se ee neeeae Se 5) a Ree SespH A pote 3 reeSes Speoe =eoe SON eee :caeeae. ate eesoe o SoaRe “oe nas oe mre x ee seen,neTyon cox che Leeaeoe wae ee aerepete sesoes seek Biepes sete Se oS S
BS vass eo i‘: ee oe % 4Bs ”J8esee:
es xSax oea)ey*eA ane hats eve ss ace ‘earn re esaaac me mes a rat BS ee Bat Bae aeaeoe iRte 2stmy eeee ane“7 oS *Bas Soaos nnSAR OSS ae x,oe *xa, eesees ie. = Mf 8sa Bee ee terefsxa Bae aan Hee ec =ae 8oe ane ee ae ee ANS aSeeSaat eeoeprey Sekt as xso ae .sae er a, rene =ee 0Ban sae 3ons ae ees See Bes Bue oo. ney a) ane Se.me SONS oo acer aee esee eS ue ee xe 2 Si Bh a0at aa ssne 5ae isae au cree ceerates Rone RS cs, Se 5Ss.oe vs ne 5teas “ in ae ee“ss ee cee Ae: rae tsores en Se weme crs Se See Se) aeee nesae ace rsoe en aa ee ean as 9an eh arae. SeSa 3 aa +ms Cee co'“5 $0 ed :tePom) gts Den nace ae xx coke ee eek eras om Bae sae acaare Bees . Sar vee Ratan “ 0 " on 1ey eet ee 4 Sige cae ay ean os “3 oe oe ae es Rast ee < os me srt os
oS De S. oF 25 tsbites oxae nenBee oOee eee ¥ee aeash Sasaos oetat 5 oe a eae oero sen SySee s orem ae me sens neoh Sete ne Bet at: ony_. oe 0 aees eS “i SS ace .‘" SOR SORENESS 8 «Si SCR at JINR RR tA RRR, Focal alelelala seca ale eretepetetesetelateteCacelelalecarelatacele erycetetel sre etele slelete Delete net ene ea
a le telly ole Tale ae elelat tale ate ate etal eletgteta torte eta le a talaty Tele lateiesneteee kre lelatatat yg’ acetate lytnta ts talereratarereratececr’s. 9/0) ee BIOT® 07ers Sater etey 07 '0in 5 "(CRM ICA. 8 oath Taie lalate ele ee . +» RARER cote EOI et eNOS RON NaS SPSS nS ori ae ee Dele eel dele Dee talela eT ete
Sap eS RNS R DER SSSR REE RREME NAAN RAR DRM SRE RERAEER ERLE OR TT ne Ce Aen rrnctcternicncnenncercesener ec tenidetet gee Waele Ra cere ei ce a. ee RNS RRS Sa EUROS SSR CARI met RRR ARERR ESTES RE STEMS EE ERS SRLS ROC Seat Seat Sa a
NOLS CS UCT IIL OLT CC CAUCE Ie ER CER ER RRR RESO Nate e's.: RR RRR RRM RS Been iwitiestents”.- 3 Po RRR RR I 94151 AO OCR ET: SRR SSCS SESE NS SS RS SS SSS SESE abscess aces RR NSS ace host onpoeet Riso REERRISSREN SM EC coca eer ae cnc n marr ante tt un nentiraeas cttervestiesranh stone tee RIE nescence eae: Reesrescmeeseenere:: 2 ELI cosas ease BRE esse ngbbtete ceiettieeiete store rete neler stiles nen NWA on cCeeecn en oan len
SoS StseeT AES Rio eteaR aE SSIS MAAR ARAN URE MERO Nes nn srancenssstn truce mnnuacanthns aareeecnbanaetereteesatrt taerbtis eae pee Saree ope SER ten fois eetcs AT ESECARE RRS! “atateletrtletaeTeecegSme + By Sao esata ssi teens tts eRe to0 7 SCE RS AS CMS SU DN GION ULSI CALS ecOrDcOLScOLALAlectaMltccecmtettSt HI tSRC PS HP Pans ALPEN Leer Al LISTED Donen ltl
Pau aPR DE epi SeDRES IESE DS SEN DSISE TEMES LODO DEDETD a~ 5°68" Pa ees tees SRR RE RAN ORR ARONA Rte RR Renn _ rettaterecitaterpsateteiatat ss) CR EER ROE 18 eg [ASS RE . ARN RIOR o ORILY eR ETH ac aaa a aha ena"478'a/0° DRONE ON Se CERIO OI RT NCR CATE Ae At CIT ea et Par
sic etatarareteta tate at atetatecaser esata caPanec cee netere deter sae te oe RES ARS Nea ence eee RN eS Sinan atte SRSA Sooo Sa eeCAS TREE ACO RSETRC ESPN ls, cacelatele ASSN eS : BEEP SIP 00,250 RRM th RRR RR EAR R REM E Oe esececen a te ee cmTere Le ease ceamem Ree sgt ectitnte etanitonatientcsels sheomtanesieieites Stee TETRIS eS Ren aa eT ase retacenerarntatrs = Sate sy atarennts oN pesteciictestctiete WERE RARER EERE |. CERRINA US Soe REIS ag , aoe + ERR Rie caseateenetemticase en ok en CORRS IO CI STS SPORES se Ronnntenenanaannee nto ‘ shanneeorerrer eeeSo Seeeees Sates ah Sree Ssieseres ° eanAG stoteh sooo SRR Sie. AP." RRRRRAEE. 99 te MEMESececesscrnac SS coneedi arene tees aRaE neeemer es SN eae5 Sta RRESAceSE Non SE
EARRRERE ST Cn) tinecereermn Sebearne REAR ERR RERE RESE SRE NMEA REETSS CRDPERUSE serscacececrets REP Lt RR RRR ROS. BERR NEN SR EME NR ananst tres Sain TU OEE AERA CT COTS EEaESS osERA DOES eaeMAREE SCE Date OR ERearRE RRpene SUE SEER RR RSE RRREteviptpe eh. eseg esMON I RRO eReoctet ahr SO RRS RRR A eee cree eee eee ese ee eae sotetetetelesstansteterstetatetstsdstabstetenssetstefatstetetatyetatetetetetotat tetete fet tetet tefeteh tetas trttetee tet arteteeeesetet terete er tetetea ts el Aa a aa OS aR oan A RRR. «Sa 2 Lp at SERS RRO RRS Naha ne OWE R NN 0 RER EERE RE RRR ROMER RS SS nN o a REN SS ee OO Re Ee SS Oa
Vela ee Spa e RN RAE RAK RR RN RMON RNR NRK ARAN ERR RER RNASE AREER ERE MSR RE MRAP ER EERE RL ARERR RAE ERIN IN ARERR RRA KERR RA RS Sei so A MEE Ee KN SA. ORB 5 ee “Ls SA ASIOORES BRR RR SABER SS SSR KREMER AY) Re RRR SA BRN SENN RAM RDR RESP EOP Oa Sete stettitatatacsicitecoe ete ceanncenes TrID 2A AOR ee CSS acter eebeet et aneetoeeeanertenneeasntenatnevnrieeent ir steatespaceopice: acesatre ateraecetecerasecy ec esehet ane Ona oN SR Ra ERC NCS SR RAST MORSE. SAR EMBRRREBND oso saseceseearnactcecenecevantccartotcenececnkacageenrcssestccaseesugmnspteseceahsegatcareeceneisatecaate teste seatomatiae topemoemmanetnoegtsemeetmamerseacgie sctencotincateeesans
TPE ASCHER FatOe tata Pat cesta tatatenstatanatgretet otatutetetetatoa PteeR ere neat st atane es tester atten Racmeeeatrceratssetateta tess etetOC a ORWOO pies RECN CARRERE RRR CER ET Soe MRE RCM RMTse ieeeee RRSPete ee Oe eM eeatrtonetatotatetensnatatatetatatytatsnatyenenentutstrtrtatenetewetetstatenetetetstatatetatetseatetetst a MM ee ih a eeOF eeBH aeBPO ee ee ee EO MeOYaeOSa NH astetetsensctetessentyentasatatornesesetenetteanseatatotacstntetececnsetaieecatormtersietelencterereretacera’rtarecatecstaveiels i TO ot 8etWOO Bo On Se NW? SE CR On a matateanatyestetgtatetstatatatytataretetetatetotet A A Be Oe EO) vwY? 32 COR SC a tetenant NO 8scwo We OC NACE ONC OIMcpeaneneniaitire SDC atetetata cteame niet tatatnle oa: aa ROR NIK Se we SRN SH ORM NBME OSEa TO OWNae tOai iCe NCSD woe catgtetatatatatgtehatanetatatatatetete ee pAatehyatetatytatetaTec acy:naea olatatie’ ee SM Ian AC SRNKC) DEM SEI ty SENN re i.ctrSECC Suseta ODN SRans er SC Sn aS RR IS OTS SSCC idSR iONOES EN iatSEE Nai ai iCee Aa earats SERS ssaledetatihtatatatetatatetgtrtatctetstitsseterrtrveretetererctatetetestucetatsteteen a" eee sratRe steht Aeee ea aOR ORa ON eT EE Rene SORES OSE EROS SU
RE eS RR iE ee eS RN ee Ne ee ee SEE oN Me eS«SRE em EIU TEREE EAS EALTAT ete tteRAIN IORI HAD SSNESCO SoE ttt OR oft SSOER ASUARTCC RR RNR REN NIN RRR '0aTA-O' NS SESNaiantatonacecaretececonstorerstetetecatecetstareterstovelerstersteritecabetptaterstetacatetetaleterstatsratefere’etetstelntaleiscoticatatenniretersiecncce REReRO I TINSSee R EEN aORNS AES t-UCacale'6,0"0-0-6°-* OO TON RRNOC RASA RRRREMI COSC O7a'e 0-0-6 A Cae Ak oc POE'S 0-5" 4'8 8-8-8 BOR SARC OOS OR OT OOS OULS DOO DELS OUL CUO O EITM LI etam tse
RAS RAEN NA SICS SSRI SEEN RMSE R SEEN SS SES RODEN NCE SRS SORES SORES IST a ONS eotais. 170 cae EE See OT Be NST nee!’ (SES SOO OTS rene Meena eaeauremmne cemeteries Sher tated terpenes etcetera terete neem cedeledeatetetitet cratetetedsteteceececatanetetateteceleretela Ta retnrecatacecaeceecaranera neta tetecatecenbtenetecetecetesctineetatstatetetaserateteratetatatastatetetate RP PamseNa stan atcl acta e tates IRM ee ne sc atatetetetatetatare eetacetee ce tataeetatetetstateneyy ee egret ate anata s ota, Sears ey oa as ea eR eI RS N60, #8, 60S SEREEXEAEE RRS EERE ERS KERR SER RRM E RRR REAR RRM REN BRIS SRD seetetens.”. BRAUER RED eRe E EERE RRA RSPRRER EERE DRERRAT BRERA RASTA ORE REE MURR RESUME ER EERRSE RES ERE MER ONIN e CR Ce eRe RRR 8: same ieee hr nticr ca tin Cea tenements ee Re eee SERRA SSER SOT ARAN NERS ERE SERS R EES ER RRR SEER EER SEDER RR SR RENE RS REAR EERE MRC
[EEE EERE EEE SEES SSE tetrcirereescscoretiecreceeaceeseasetecebetetelegee eaeae MRR OOS SRS Rc OR DOR ROMS S: SUBBOE SR KORE RRR SMBs ossctedsesntelycareleTyasesetiesory test evsons eres gaas pon wR MURR arcy tes eMC SE ESN sEL toes ALEC es aaa RDeHL COT ET MSADRSNS HERAT SCACUCeaSHSELUHce cent castecanaancesesecnceeaece Rac erecaneeaegtattse Caer rrrrrrccccr renee nec cc ccc nr ecnnc erence scree tar cease totic tesetastis ret Chae Oe SRS a NR ROR SS SOSRSRRRRSSSSEN MON REESE RINT RARER NaS RRR RSERDRDODLISDRS -ssnenete'ete"satessnatytstetatteratsh to" tos a aia RSTO Apes etrinteteisiietersieeaatatrtansterereceaieirethe:rieransit oteterartrsre rie soetansieielececo-siela pity eer arateotaretetvcarnnarena eee manneeteceel™
inlbtelatetetetettetetateteretetelatetelslateterare tetedesmrecacecelecalececrrerataretelecesstararersrocacersvat ns ortreeeae Sepcerecneceeceens KENRSKAKN ERK KE AREA RM SN SERRA RAEN CNM RAM RN RMN RINE RRR MMMM RNIN. 0 00v a8 sien e-e-ele"eTelere te a Fos 0-0 6° U RR ROR BAKER MTN ION KR INS RMN NHRC IM 1 I ON WO ESSEC 1 AHR EERE ERC Ce Oe RES ACORN EEE EERE Stone natatstotatetaeasstenanan Rietcanaannet catafpronabetarscateratenecstrhiestatets's calstabytetetstecsco2otatsrataeeneteeetsteeetatenrtnsstetecstsfasetriacarer, statattanenaee te ptanetatersth'e Co aa a a a Sa Oeereentertersaesececetetpasecaceieteceryseseresereseieiseeon eG aaesteesesnstsespehesesseere cesta eae taeretere: sel esereserereseleseteisecenisinessresesnyetnsennnecineerinnsaeet gereennnenenate:
OO Oe Ore FeaiRE 8 8oraFe 8k Ae REMEERER Se AE Re Setetbk ep OS 8RES 8G RAK 8"49susatnenieteenen 2sbi 0 onlshrsnrsrsincsaapbrtess 6 old eere6esSRA SOR OOS 6 8 6 0 7 6ints ss tata CRO ee RR ORmmm IE eM mnnee IC MOlott RE of'saiiaOe he Oe fatee aie ORman REE a a caRN aa aIRitts atAe tatee aamee a aa ea aha a a Su Ou EU aderen ea al Sa Neh a, tatatetntntn ete aterSMD Suma ES avay tatatatwrerbrelorhidre ncenonmenensetacersrateenyn enue tera ia!See «BetSPE yraterntorelanatmnetaret« ateNNN ie IIE, Yt NS ANS Anin SRN aREE ASKS SR AaeI iita0eet I A ah A Shae TEESE rener ten tae gtar ORR ORDERS NOS SRS O1d RRR+72«+ DDE eesiranteneneamenr ee merene meee tmatsatmmene nema ome eneeeneesene!
Fen eee nena eseceetelneacaneetcansteaneeeearatecatetaeanteeeareene ee ratotnan tate Sess santasmans canine cat ater attsi ee rtteense RSS SS NERDS SaaS SR ORISA RRR RM MR MIUR 8-8-2 2,F_F0.9-0-0_900.0_ 00,00. 9 SO SERRE ESE RRR RT CRE RS SC SRE RRR SC Laerc reece enna eee ET ARE ute ec net Oe teen Sonoma Bee nabteanen etn eneaattnie octRIORDAN Meranttn. RRRRSShe SETSRON RAR A SRR RRR SSR
RAO REAR RRE “gas, RRR ER SE TEETER RNS6 ARR NMAWK ANA Necteersceraretee s-1->SRR SER RS HS RSSPorereeeenes ES No a RR RED SR WTO ERROR ors cco. ersieleroracscicoresscelaceratatovare’sicacessieraserscererarectrecareresacarereseeerensentcacmgeceseensseecere KNBR RAEN EN RINSE SER Et Se RA SNeRRRRRRSRA I on) nest, . eK" s. orm) ury~2 ae "athe vvt Ave Roe EAs tains ssa nie ere tie wie etaRR M? a OC eI NNN AMMO Ona tnenaToracanereeneTariTeTatatetevone achte’preninaha arene Ta aTarataTarane’eenaharanecatatatavaraatataratete stata’ER RHO MNOS Cn PEER ENES heRENAE Nt he aRS a ae hd RSET he eeeeae ncn nne srietisteneseterecattesaeetetaretenaateeey Sears maaan ere EUR er ancien tiie: MRR ROBE SRR RU Ns ce ac ROR RS SEN MSRM SE RIESE a" Cecchsesnne reer recelaptetgravsie sieesfereieesart races hearaceaseieusaceeratesatereeceevetartesacnenetagearergnaetenaerae-avee’ospierateeverebrateleertieerereiorpetatercerpieneietenieten eeeicesseresbrecseernnase
“aeleleteleleatoletnestalgieleeteteiate nie een SRNR CPA ERMAN E SBR A ERIC AAHSRNL 850-9 RRS Rr RE Ce aaa RR ee RRS ORE RR RR ARES ES #8 ¢c800nect terest totes n ee nag tanesnatetctataeabatatata teat tatabytetatatatetstarctetatetatatahataeabnbatatinatatetrtnitetatstrtetecstetatatatatetetetatatniatateestocstetrerertotarararseetrenererrrtataratarstetunnstarsrstncecaearanaracecrietess
+ Tealstetetela stat saranacseees i" eae eaatatetiat etn SS s Lite RRR RT RRR ORR CE RRNA RS. t.0,) ROR RN IK Bases Ne RMR ARON Se CM EMRE NSM RSMO Mos “e-AvQ'¢ "eau eT eres b enh en mal cratus atone snnestieinrsmen nee eenr ene ene emirate neeriomeemnnrmemt nti mmememe mime emit te Besos eaaoaetart neta nsccsuarsimsssuhiet oss asren amet SSRN AD SAS RNAS SRR RIN SR iS GEC! RR RRR SS RSNA Ba NSS RSH SES OA SOROS SS SSEMEBRRRES Noo" 0 cto ccccesesrssascyce-sursestysat bacasenearoest tte rbatits tates betststs tats trtsecesastataasestatststonsgaeeeeeaeeeee ecengneneee eetiectsssesesisaseassuuaasiacesesececennpeopoecesenecererececerenececererececeefecerecerecele acacece acenecececececatec tots
rinlatetateleeteteca etal ohatelatetatacanens waver rat eee eee setetea tetas Caen MMR RRR NY Eee HERA ERR RRR RSIS ACR RS RRR KR MOE I I i ERS SCORE DO Se RMA RENNER EEE. SD MSRM RARE RR ER RE MN R AREA AR SRE RRM RR ICRICR FG Ao8, o0 a1, 504-0, 6. 46S RR So NCR CH SO SENT OIC T
dee eee nu aga ASS NS aRneers RRRSEO RRR erates ae ORR tera OL ae rea RRS. RRR Oe ROSIE SOE SSS loaROR SRSRSORES SST sphi seit fececatecetstreserieterstisetuarce'raasbeteceecuecarearptartcartevers ease tecantcan trees i tasant esate ee itRRR s,s MMMM castiecnnieleareeaieinertielenresesnecereeraneretetiern itiatetetetetrrecetarece aceereteset EROH CE ERR SENNG nigcceceresteetece trices tthe etrt SRE RRR ste hee EAS RRSSR RENE BS OOM SNor MD DMROER SEND cae esantet easesartaecaseennsnceeeteneane tet Messaseetaaseestetananstiteanssreerettaratetsntsnresistrestrtsnertatennteiath SOR RR accor sars snares noesrstensnene tsarerenensetetircnestenints
arererar ere, stattarrtatetetenecssacann’ ratstetatatanat * Nera ate WC MRO 4360seet THAR UTEtet COnets YO 4taueein toytaa eb 4 bm CRS, ea na"atahtaa n'a! 37.00. aie 0 0 vs, «SiMe See SER ROO MOR AIT." 6 14° en oeats sonatas tatate se AOC REN RNS nt he he SERENA alot eta Pan anata?RRR Fy ata nana a Na! eeeeeeacataraneTehaTaTaleT OTB NEMA ae ene eneARRAN RTO Te Te OCATRTRTNT eed enCe enetrae nenaheneese OTT RUNS er yatee ORICON ne nee ete een tet EES Otte NT statatateletey "eon Reena da tetet URES fal SAA 2 RO REetROR ORE acti eterea-aN US5tea ts: R RRR ETaeCN ERN RSE MEETS SRN wR soaSLAURA NAA EPMA AAS 8 5k MRR MARAE N aHNN CMA RIA RRRSe MNO cen kh acc sca, BCE t 078 SOR Se SE SS RS
TRIES Sretrastetenetrenmasereirenny oannertete cian ett ea ARR RRR OER RES RMS RA MMM MRI RSID ANTS tss's"e'01t'0's'a"c'a't REE EN DO ERR MERE MOORS RE ERE M ARAM RRR setseee a atatatat ela tetetet Mh tbe ans tecnneteheteTahata eteTeTaMASRTETE ED UB SETS#,0'6_4(0\0/0_2.2.+ TUTETI NE See DAPI EE-OTET PETES RMR DUET OoETD
Saran Yea nG COIS SESERE SE CDT BC ESE DERE SERED RCTs SSE OESE ID TOT SCOP W590 SC DERE DE Ot MF SPT EB a SP a PP ISAT na) a rae 1 SOROS SE RON SOR YN, 2 E NI SMSC Ca RINE EIS ah RR Maar a Sa DAI IRI IGS FDC eo nace ee, re ae
SeeeDen cence cece nec ncn cece ee Ee EE EE EEO UST ilienttiten ctor rat aceite tt a aR ssa soo OS RU RR SUR DRIER nt Ce RRR nena aac ee ftsareir“ss"ccahurenaearareanpeacttecavertchisvalertatcquateacerareteec heater guecstaceececa oe’ erendtacee sees alt AcH:0 Oars SAMOA ocececicecesnceicacececeeceserecatcesareceecacicececasecereespuerilece wnsbeacescaneteneegtcenecste See RUM ER RRM RE MRM RR NSM E RNR MAR RAMS E ENT CK ROR REEMA RRR CRT CT Cnr oe a APRN REN ASCRSR RU SLeCOELELEC RICA OnEC ORES Cer ORRRSR RCT TECEIS 0h e EN ae aseattensrerararaseasctoncetatancriseaeenieoeaestarsanstonseotseatetstatstatesgrsnstnnooanstorsnsnnatatetoraneema mae atsescsseentateatanaeatetecessanssanncrraciearerat stasieorsensnanaroeecsnenentaeetnnmneenreen a
ac ESE a ot Reee eh iRR re REA eee eh ee ne KCKENERERSRRS ERM Mw newer so osESR +’ ghee gtaREtates ErRANE ee H tes tem RID 60°73 1 0-5arisaraceorasecsceo a ee a aR Re mRi ‘ncaceceraserecerens KEP KEKKRA MERKEN RARRENO RK NR MAM NN9 aMR OPSaoc15 O86 0-0-8 NWR a We WP «sos. Pe Se1-20 te OP a eR ne SRDS Be Br ScD a Pie RReaERR MER MARR SER RAR ERAN RREarte ERERee ENE MITOe RRS SIO E Ree ei CREE tC e077 SOROS 0-050 SCS RRC SA SSP SESS OO STIS SSC ES OI RSET WSSBe TSDC Sa aa m Aas sr Ra RST SR SSRIS SRR OSS Se RR Se ROR DRS SST VME ARTA NO RRR lee ose iree ee revetateiet cfetetar stats 01s RNS: SORE BORO ST Cot S RAMOS SAO RR REESE AOS RNS RAS SE EERE RE EMRE ERE MER EED Oop." 6.4.1.0.1.0.0-0 1 RRR SRE RR ER NR eR Re ee RL Neen ES aE Cae AN RSME RR ARERR RNR RE MTR RRR EEE ASRGOD Os niale nie rareeeinamraretetotaterstetatstatetatalet AD RD ABS ARRAS BERR MSS LSE REA REESE RURY SRS RSMAS S RRR E LER RRR RE MERE ER RRN RN ERE SE REMEBER ERED RES f.0500,7.0.0°0 0s SAR RR RARER RR REN RRR R EN REE SSN MSE Ra
Cee ene nnn en EEE EE EE a eg ale A Cal glol ace aal aaa ee Woe a soblsleg Pere eacertcn eee Deptt otestncnnninnnnney x ee Naat aN R eases tte tate tct tnt cegbanctgtanetateteraitetenrtatatatatelatatecacyiaeaceteterataerstatetatettatetetaterstetatetatatetstatets seer S Met ata tar acer eroer es anececaret eS Far ar eneT eA HITP OIL DES ESI SCECAC PLAT COC e BCU DEERE CPU BTID TEE aaa eee a Sean TLS SESS SIERRAS SSS ESS NN RIOR MOSS RENEE LOSS NR Se anne = NEESER BaSirer cata Settns se eceneiefes i SEMA RECORD >”) SRR RO RR TERS SN SRY BH ESERIES SSCS MON RARER DREN RAE RRR SRS SERENE. 50 000.07 a
CURRICULA SOI CRG CCU CRU CI EPBRRBRR RRR RRER TAT ERRNO Rr cco eats RTT RREIT « SeaeRRS Sat ticiececpancean umn raernecmnvenentianraenientenennnnnrean en tnenten GRR aR ERRORS OSs elie hs eee ce IL na Ree nine cneinnnneiigne,cnatatiagena a
sone seat te tetera stein NERS ate gollyEMS ale catetaly late N lele’e te ela oer rae ge RIC O a eee eee aCe ew RLare a F888 2A Soa RY SR SEEatCel aa 8089 88084806 ama 888088 ana Aaa 8 Oe aA aaa 8 ramet«7a 8A 8b 8 BA utara 8 0808,ataterelacstacevaretatarncatalatararel | CREM MMMM MND Smee eee esityeatitctatatyocatatecetncetecerecataty’ otetitacatecotetaterarstetetatacaticeatataretet aot eRe EERE RMNDelete SRSAtata ENR MRS MEM MAAA MS eMi CNSR TATE : araS888 Near91889 eh NA a9 LEGS WANE SEiaSPS EO maa PRE0098889698088 n Sea . SES Fa ot wtbcarnresetavecorstetavecenserarate’ tsbalal net oat ara r reer otro tat 60 ete Fal ty0s0 tf eee ee ee eee ee eee cee cored eee eee
aoa aE TERREBONNE NSD NMS NERS WESTON ON Toles || | RNR MRAM RRR Igo” TMB Re tatanetrtetn teeter testes hey Rate.” |." RO WER eM RRR E EE SERS R ESN AER ESSE RRSP RR ERR RE RE RARER RRR ER ERR RES R RC REE R SEN CNT OK SERRE RARER ERE RS RAM ER SM RRS R ERE RES SEER RRA SSS eee
heat enone caer eRe RUSE RRS TL SEER EM EMINEM RIC NRT wear co fronesteeseresesesnoecaace°28.0. 4° KRM RR RSH SRN, 88 E Rt MMRREM RRND MS 8 8-88 9749 A008 rao a Sa e LAA b Ree ALLEN O Aaa ATE AAA meat MOTO Oae EPCRA STOOP DEATALD Det ence 800 8 TELaR RON aes egn sateen ttt fete ye ata atotetatesetate thee aT Wt etetehh PPA EP E Ses ateherctbtaraneta gerne
RSE Lana RAN IN aA MANET RRENR RAMA AI RCN is.” | ARR RRER RRR EERE RER MEE.” - Raateumbraaetemmerere sacar |B eal R ER eae eee ee E NBR E RNAS BSN SRNR ENB Be SRN H RII SRO SAG 0,1 ot oe eR RN LCN SS SRR SO rsa HM AERIS NER REREN RHR ORR RR ASU R SARE TENEMENT ROTC T S| | ARAN NINN BORE ROAAI RNS. UAV RENT CRRAR MYA “btn gieatcr ater | ieee Sieh ae cee: RR REE Mane RRS RSM EER SR RENEE SERA ARIS SXET1.i-. tS RRS RR EERE ERED REE aR ae eR See eae a eee ee ae
Ee MESES ae SY e CER SECTSSE CURE REN EEE ERA RERNEE EERE REDKEN T|-SEORR ERAS OOC RINa.| Sees Poe:RC tN RES ER 0008 RS Seean... CS aaa NSeeRS SNS SCSAAA NS MISS CR Fan 010-8 2k ReaORE RS Oa Se US ESICG OtaI aSIaeo SnoeaaOS OC Carr hsREN St Sehr SET St MURDER UEE ODP SPOTS SOAK GP SD OnEEMER OF Or RP WSC S501. BS nd EEeaSad SP Wh Oe . SRR ntee eae SESEREIR® TaEOC TEESE SA a aR OMFS, Kt 0SE 8, NB SSD CanesSe SETOCe SCREi SESE EEL SES he Sad St Dat St ERIE RD Wt RR Cth ote oR ie”: fete NY ponents tnestatetetateseteetatezaae eS EERO E SPEER 1556 5 aoe RRREERRRE MOGI 2= 54-8. 8° 9.0.97 0- eo 0ce 6 lee aceecel eesas ecm ae 9 eeoT Aa OcAC RSE LOLE OO SR TABBUCY BILAL EPLRIA EOL ATOC AA Ca H8 88.480 Pae OPE Lc, ee TAD ele alee
eranioe ioc pase neead SDI aetSSt Sana SR SI aT DOSE SO RED CERENT SCCNUS TICS Soca” |: | SRR RRR cin RT NM ona eecesaneenae Ramee TNS OR a eee RR Ree RAR R RRR RRR RS iT ceR SOE SSNS RRS RRO RE ht. cht SRS RRR RRS SRR SM REI CSTR RR SS OSER OOESR Rite ts Scan ecEEDiS SI SSR IETS OES CTR ERIS DSS OEESORCSES SOROS TO OSES EE DEE REL SM AACS SSSI” PRMMEETD = 0-8-0074" 0-0,0-8 4-0-0. 0"3 fos ea + aere RIE» +8" ‘< TANT0T 52,81 8705 CRC NN RCN ARS OST IO SW PS DW OORBs OOS aa naN in Jaa hepsi ran EEE ERM ay MeeREN eee Caee CeMRR STE i etenea SoRemear aie MAS aaic eeeNN eooaetrls rats?” aan tat oe? «GRIER SSS aSetaSet * SIGSCMOUMIOR, sie forer nin niece eet ayeSs fee BY Gor oP 86s€-Ueh 9 0,8.US.¥.9-F 7-5-8 8-9-8CM 8/8 BT eK DESEEPS RMR EMER MEME MM Pat CN MM Se Sa iC Se ee On ee eTaE SRR S Sau eR Ce cee Dn creer enn Sate enn REetaitROOO ERR” |. UR RRR 67070, SaPa! RRA r cits 9 6-000" 1lvlseatirlterim aa aR REE SE ESAla". ES BOSSE SEER SESE R2-678 ES0-6-9°9,1-9-9-6-8-?-6-4-0_0.4_0.0-1-9° SRL LTE SN CO SaSOhaaR SRR SERCO REE SR SR RR RO earSERRE S SET NSPS SLSESTIC ODO RE TS ROSSER SES SSRI Ces ys Dena ecetrcrseeretenrsctecensoteletetetetateteeeter Se tnaeatn SRR einer CGS Noa eRe eee Set N ae MEMES RR RES ARES ONSEN MME RNR RRM LARC EECA SERRE ERE R REE RMR TONES SERA SSR RRR RRS a ENE ER RRC Sa MER eC ia es ERRIEDES «0"0cacavcpea'aceracererere’8RNS : “RRR at ON 01-5°00009000 600".°,7OM ac 000001010 SR RNR 7EItie SRO a's CO RR es 2 >: 1RB SRR eaSRDS Sen aa DTS, aio on ereSCORE setccetn casa ccscr snc +, CRITI: "s. 048. NSC a ORSON ROM ROGER ICSI NC UriOIRO ens testo ho 1 Rana 0.202 RRS -"-"— 7 «2.0. 408088. nen 0 0 SIR IO AROSE OR I
enone lae ovate7 se aoa ROR 7s .* OSD ASERDNERC «SUDAN IR Se SSE aCe e"o0 a "e Sa aS 8. earache Ee MMR ot ate fancy 88sooo" tT8rS eCV Prato 7 yierelalelnercyeeerocna SVS.a SOOOana GOSGOr) MN BRaOR 876.5 8g |.Sea «2. SO Se MME «* 25 | AMMO ROUREUENE S614 + 5Te 4"7sa a"starts cb a 1c 1sts6 totale RN 8.4 =~ Be sNN S CN OO ARR 8ONON
W
M M M
M
D M W
M
M M
B
O
RW R M
A
W
M
ND D
N OC N ORM
O M CC
M
RRR
N MM M
R AR RMN
M M
M
M M
M
M MM
m
d RO
EEDA BBs veSERAN nalRPaati ae ea ati tlial aR LASSPela MRP AA PeRICE RN, aadCSCC laa atd + Stal SERS ANAND ASTROS oe ESOC SONIDBora OCA A a ata SP Ge aSlan COREL SRRLila SO SERIE CCRC SS Sle ERROR RSE OC SPO SA SESDia SNSitaia OO BE¥PO ODOC CSICBe ocae ere no ret aregeret eee Toren Etrete cane ee Ste teen enone tert teteteen cde hatet tthe Oe MRS ESTUTA SALMO OTT 4 40h lala l4 cata te aR a ne ol col anette acest dnet neta rete w rename gg decent ne ee ree tens eetc ec atae tetera dae geet acetal elala aiylal Talal alelelelelaletetalalaletey alee a0 lelalatele ete lel Sa
Bo seccecatetnocetrrer snore rere arene career en TREES STALLS SUa# RIB RIAL ALG TAS Ne aan AY Smee ae TAT SDe ae Aaa ee wR A Tare a eSarelececeh esas De lALeeles aS het cess shel etestle oUt STAIATSTATAISTADATSIVSTeD0a0 LETTS Tea LST alee Sala ele lesa Pie bla a olael ie ocala aletalelelalceenete gl
RSI eer acinar ncaa eam aaa GEER CEREAL NECN CIOC SEORBS BOCA ICIS ATIC A OCIE SLSR ENC C8 Ow 1 OO Gg SOE SCOR OOM COCCI 0, SOC OSC STOR SEP CEEEEESEET-
. inlet canine cen etk ren eee cra rtat at tat tee LMA OMG ESTERS ALETALAT AT Les Le oe a TADa a eee gg cnn cacetgtotols SLL TOTUNDUDGSOC UTNE OTUTatSTeTatbnpmta te terpepebeeeberonegenabenetec tenet SRO DLA ele aa alale lela le lela lalelelel el alae lade a a Ualelala le lalalaliii DE GD, Gon contest see nang fas arannrRRC eT oe arene elects ecmeOCS ee a areSEDOAL nee eaten a er tet te Ee Pea eee eee6-1, Ta Dele ea aa TeaSO age eeEIS aCe IN Sena SSE nr ee STATEny lalnlalalalsDatalel les [ely Telalsls [sole lalelREISS | Taledetelelelelalletalel ed Lebel 1 u e ¢ O M RRM SRS SNCS LL RE Se SSC aE RE SO a aD RDI EEA DI ESC IODRIE SENG OCRDEM ANN BWV ORRIN ERE EE aS (aie REE GE SOD Uelelal EDEaDelolelalalelale a OSURGOSRRLOSSDE SISSIES elle LENE eSale| on e re 1 IAL ee Lea a Lacecacelecelesetoregerep igen aenee demeyesegege pede pipetapagehegecetiPigintel Tele y aia al ls Telet ale TelalelelsDotels Tala alas aoe a eet iterates BRR cee ncn lncnneenne eeninth nen ee eelee Tene tree te eee ee er a
» SERS ancora hea Ma ae the tie hr See Sn eS SaaS saan IRIE B OES CSE REC BESE DOR ORREEREIEDE SS SA 00.0 v's u-u'o7s"a’a acu W 1K 8.5” 6 See RRR Ot ORS anna nee REE ROO a aE EE feo DEED OUR ee
r BoE CREO EC I ry tanaResistant pistaini lc eisenc cntaOne nooo ReletRRR CSE I UTE LOTTESE SEED Int ere g Lene Oe RS Le ll oy Din EET EEC SOOT G8 IESG SG RRyeeramet ela Teait NISS es niin Bae teat eae ta area coe Feng Teel, Wlaraotels atetele lelsateneve cnet SUEUR cae eR NSS STIS I diate acer Senter eee eo, cetetand (oct ncetiieled GUeTg fitness tess latent oy EMER 0 . Wi. 47, re le2: a aAa en SESE ot eySERRE pee RCAC ERERERERERERES ©. 0S °.” 4°. Osh eh O87aR erste ! *, 5Oe ae .nT neeDS a ocak RRR 8raEN TIER on yn sR IRATE AMT 9, 8682 tMeee: 959 1 2RN eC6s CEN EDS LL), cree Oa ESR DRONES. MERA °-2-2. 2. 0_/0° WO Vea? RR le.*."-> os, OR Seep Sean DESC LEEa RESO SERARIGRTON ES CLD, DB,a Uk 5 DU Occe3rere” 00 OS erereens Wess eet ee ee oracsrateree'ete' e's YO Se OM OaRIDER 8°(0 8 ra 5 ae) OT 50 I a elect yet!GSN 6)EEO REEales” RSMMC > i cam OCR tear Seen ional 58.)EA CECTTA SEM © Moe wee SOE ECTS Ot Se ana poe ela eeaneees 40,88 Ee IRE ORC RE ROOM AEDS 250-1 I e.” SRNR eRBK Sees acaba REM) SE a OER SULLY 1001 SsEL.) ae arirSSR ae OSE Se ela Oe ORNSERIEONIESER 10518088 0 SR IR nn SIDRMRORRED 8ce. 88 eRe RCS ONE ARNO PO9" 21 TORT Ab 886s ORR RACERS 8 eesROEE I Le RE dace etaeleg yey 1 NOE. SORES eRSSIs SR eaeSCSI ES rw eae . wlecie IeCCR slat al eae Bett 8 Ne SS SOS ae)ORES " . Rn” SEN neeeae 1 onNa RR RE wee eenPe DEAK Teed aks CaeARR SCACMDeNeMSrGRGED.. PIAA MERI ONO ORICA 27) at IN eR RENENS ISVS aaaa aa eis SSievateretetetare See RRR) CRE Res eee OCC NRC SRE Stn SsRR SOL «9OOP SR RRO RTECS oa co SWE OUEST ORM ERS SohoRS FatRRR sess!ARERR Se< UDR WRITS OR. rae. ith rs Se RRR RE RP Oe ON AD CORR, COR OCR ER SC OCR REND MIESS, «0 co BRS Tons re T TT E 9 RACED cares Ch ASSEN Sen Seen ERSONEMEERE SE RMACR REN. 16 e088 Re RRS 8 OR ae -
TE ee oa eRBS ER IRars” aR csOO erste caakicck rca68SRR Se MRSS cre MRE cst iouian Net ort RINE AR ORRRRGAM oes ciact nent EEBecca es Sea6>ee eo wet nsSign eeance Be 7V Ween 2 tV Th a0a « cick Ds7eAGed OOKCot . SORRELL SONI eH 6 ana 9g 8TY a sasnr TeRre anoae aces 2”.sia *.”. “1 oo RR craig Ge SR ON OOD RCS SE CHEER HC 089 mys
ae . a 2 ( ; ae < , Vi 4 Sher? Z; \ (J
St
Oby, 129, Obs, £30. be. 13),
. — Hmitdnt,
Hudebni skladba ¢. 45. Rytmus: CEP PEP SP PY acd. Utvar: Zastup. Zakladni postavent: Stoj zAnoiny levou, tyé rovné pred prsa. I. b.—4. etyfi hmicy dol@ a nahoru (celkem 8 hmitd) tyé pred prsa, v hmiru as 20cm. Soucasné osm skokd béhovych vpted. Poslednim hmitem tyé nad hlavu
, behovych vpted. .
H. 1.4, étyéi hmity vodorovne, vpted a vzad, tyée rovnd nad hlavu (s kaédym sko-
kem jeden hmit) hmiry se déji do mirného prohnuti ktiée. Soucasné osm skokd |
HiL-1IV¥ L~Hl.
- V. L.-d, zvolna ptedpadit, tyé rovné pred prsa a soudasné etyii hmity rovné vlevo a vpravo stranow osm béhovych skokd vpfed.
VI. 1.4. zvolna tye dold rovné a étyti hmiry tyée rovne vlevo stranou,osm béhovych skokd vpied.
VIIL—VIH. Opacénou cestou ty¢ rovné nad hlavu s osmi hmicy vlevo a vpravo stranou,
drj a4 Lede j 52 ) J‘ §1|
; e _sosin ~“? béhovych 4 ~—f —_skokd ~! | ndvpied, \ / \ / \ ] i i 2
\ 444 SANS NAN cherTnthe mem aa
, . 323
ae BS RE RRS RRO SRE OR SSN AN DONOR ARON SER ODT. OEE. SR aaa OC SRE. So EOS SRR: Sa ea
“ee . Oe EER REIN + > + EMEC OCR RSR RRR TR RI” eID Dertecutat Sateteceet aerate A cateteete cece ttatetet SOS SAS TRARY, MONRERER, ARES. RRR eC ee: : SSR en SiH StS. eS Sa MRERRESRRE. '-"."..-° OSHS OR NO triste RN,” -°.,-’-". RRR ORRICK ©. Ch RMR RRR RN RMR MD 2-2.SeCRE” "ORK MD MRRMEIRERES ae 6. eaiBaeapecete sme cet are.o* Panes Se lll Ls nts Se SSR ESRIgaat MED ss ORR SRO RSRMS. 2°RS::. "> SRR RN SERN 2S68 5 SSeS RESON IRN SOU ROCESS 2+. 0.» CROSS > Ee wale SOLS,
°°". 0SPS aSeaeetanatasashcacectierererere’rantestatesstacatctetete’s Snake ta aR 2” =” - "65 SRR Ie ataveve'y’aravete’e"e On "ae pre eaetatetata atata7a 80'S" ree ERS. wee SRR & i Am Se one ROIRN SORIN CoeAhat,NOTE + aLNrCe- SRS ete Se > Wee «0 2! ”
Tov oS enataratseatenateretatatgtrrecerecceatatets CS RSRamee 377 OREO MRISeeCMMI SOO. ERS 8. aS ge NETS eet. CRS Dos s |. SONS”. "| Sat iti aS. St na ia te Hi tn aH oR eae rata. OATES Re Oe OEE: SNE SSM:Goo MMS RRM OKI MR RRR, CONWILE RA MOR BS CI,» + 2 ORAS atSORE etareter ler
DERNNEES CRI RS eC RMR ERT +: 5 rate Sate MRE a teROaany, Se EEN EER te Re Re ON CnaseNee TLwlle A astele RR ee me oe Ste ReOEDRIDD'GA. oats lal le CUREIRIRD ore} POPs ean"
a "a
BR Bie Re ee ee ee ee RR RR RR os cai rss cere SS OR RO UR RR Nees a AS SS RS aR
ol i RS ORSON”. RIC RRO ILSEEL” | CURIOS | EE OR aa, ae a oe Cec I INN”. ih A Da ae ie a ND eyeeeleehl teed "e"s"e"a. = OD Gee “a°h ae OED ale wae ee ee Sale, ‘ bon Seep nena ei RE ar Oe
Eat*esrennin Ra». 1Oo 0d anene OE, Sos SER aTeeeWi NB Rg . SOO -.-:-.-”"00.0 0 2 OEE IES CC 7 Rite”. NEES”. CIRCE.”
Sonia -*- Sole” SRRORRRD “0. 2'0" SSM '01 «CDN oY ORR ROR SiR SC RRR 5 my PORN Ao. ee rectesscstarate ene mma a oresatutelecetatereteorente erences reng eget cet we a OEE EIEN we Be SRS RK HS OS TT ITN 08° eee BR a Ra RR AA Re REESE." MERE, * SIE.» * ORS
RSP 80s: S's: CDE a0:. "nN a a enero tere bf ot ates flat CRRA ORION TT."6*AMAORI een De SepLNT OTRAS CRON DOOR DCR IR 0 PRR. 9.9 -*-2-5-0. 0H UREN IEN S 2ORROR". SR RRA oe, SPoan? et ren: ance Poren rre: RMN aL SIRT ta eeWISN deanna LSoe RE eecoos SGRMR CRS a REED.» a RR etreinetacatientrent
POPES an 27a Fo eee tate ere eet tReet ee ele ele natal ala ale Tas Sal atgre « ve CNS MORES “8050 s"5""s"a "ed" 9 GEER E 4» MEM IEE SOE GEREE 8-2” CERES ROR bs EES Pre aR IIe RE Ost enh a aes CS «a la nine Re EEE ERE RS a a RIN Se Ce I 6 Re CR 5s Tat noare a ereta re OE a ER RMA ERE RI RSM MRE ME RRS CRA REELS 0,4 OR ane SO. RRR Ne ceare eaten le ee Telele Cate DedeSy teh ta ele Ren aeitene ns faccecececetabrars thre eceecnersaracesicr coe caceecoogtnenennserenecennecenns os SDR Ie LS TENG. 05 2 NCA ane aca osat sca Re nce ne hale Talna eg atetagets tegaeranatocane ns letarenrtenerctatestoranrerbegedated ated Eee Bye 47082 0c o A 6 0) ARISE 2.2. 88"s_ 6704, BEE SOS tenn sens
1 IRV! REIN SIU NT MAE OI OO LAC Ce Se . 's, ee OOOO. ey | OO eer” A OC OE Oe Ie A BE ana. WN ESPON UeEES,” .'.”.”.”2°.7 "5 Senn 0 AE Maia Aa ee Eee © Os ERK 8 hEteREN ICR i RIN CEM SO RS RI eS RIN0212-0 RE SREEESICRESEs “0° = COTE = 50 MESCAESROED” 1 ARON ROR ORI: OSTE SESE: * SERS RR ECM SLE EMS MO ESR RSEIC A” 0A 5RR L «2/5©aatetatatyt ae RNS ORI, *RRR 9-87 0,00 0.8 SRR Rs atesatecate’ Oe a OCS ina a rN OS Sen MO SSE OPE STIS TS ESERIES -UOEN ORGIES -f00. rans ooalee iaes nt enna toato:fet Seay sc EEys«oS s no es eeslo Settee a8 pare. see ee ee el St eGane peuae . Atile DI mR ae, hohe eee . neat . i ar . an 2,De. BC welt eee treet +: 1gee oetae we7RE eT ve. a-. oe 7 ‘.:DEUS Dunne ts . ‘RIDE AS eemncoocceens anea : +ae vee ED, EE.*.* Sal vele: foal Tee gh wii.oetye .Ee sharales vee Beelele seer ll ileal Bvt Tyg! : Pele 1 ie My QOGEs BUA Re eres vata st ne oe aR , ee BE asta weil ls CUA ae.
PARA Cs ORSmarae EER EOM yo = aoh | PURE, ? 40, °°. 9S sles, Ua RS LOS IEtnone se-Tele ORT On TiC ror era nro. ‘San pnnonsne + aa KTE - 7ON - - Ie .Sd nenS ~ ow ae, caveleye 6-9-8405 ‘aeeenoe BaaCee: sa ST ee agedre ate ‘ 5ae!: ee : f oberet © ie Cater Dey ZORA RAD SS - aSS: -wot Rog CORR ccc oe 0.0 RIceee RRR BRR RP fee Cn acne Reccereeece fae tt Cr), Stee) onSESE . Canna! a Se. - 26,6, 80 AL 18 RRR MOEEORET? 08-010" 87ee"0'0" Sarge ~seee~ _.wa tola >telat wee. ee ‘. :Wee :' >ae awane :eae SUPMDU USL) . ‘ BAER pecuens vl fe islet cee °.7.9_0. 9 _© gens "1-5-5". -a a 52a 0-0 hE”hpo _e_2coenneaes Oe- teSseee ve . : : neg RTS aeEE OcaATER aR IPSC ITER ROT S ST OEE ECE*tTESTE RETSE St 00 fe 4759 a ORTEGA hatSno. etotecatece tetas eta Sebease-”-°-°-*-) a5eae CUENL Ogg eet NAR LER NENA SEREE ee a egy “eeteeseers eg! OTS 4025.0, 5_0 «AIF, sono. = tt ERE a 0030 ER = Weal cee foot ssdette . ce as Mia ee ee ETS ee oteners wagered «Seegneeeroeenannen RSet % fee ts Weel ae ee Be “Oy RR 522.0088 .022.e. ER eo RRR ON oat tate te Tat elon sees "SIRS a osogienen coe an ennnn CHD UCR nto : : Bl Tel eae ae a Oi SUEEDE,,"-\.--7.°-'., ROE MNORIT ORR 2-178 0a 97k a8 2 OOOO 1 Re . a . . : ey navtpay tte 7 rte Soaee> ‘SSS Sree “| reas eed 2 vee BA Corea en ele A.6.0.0.° to SEO 271) OOOO 3”) OR Rn 2 PY”: aaa Ci ae be teeter ees See S ans i ae.
. Bere es Ce eee sleleladeas Tel Le les. oe ietate ceelote .ree PN. 4" 2eed RETR ARR ERROR RR ONE EN -RRM 'eycaatel veSTS . . RRRARE we . en 2 :ESE . Tete roa es Re ULL ae,bb gad roe ae: He, aide 9RM NEAR sane SRS SNCRAMER OSSD SRS SERS EMR RCRA 8s RE aterAE es aEE el :AE en Ronee SERNA ee ohce” : 5 ayers Pe Leases aaT rae aoe17" AS Maa skAORME RRM RNRMR 2eo aT at ae i : Nee Bicocataces pene stellt AM sor : wel yee n + eeRIRRRY eeIR CeMMMM ee a AMS Ce RS SCO AS6Lanse ef .7til :te agees lene aBee whe tsa?ee rcoeLODO INE L . : : Bone LPAI CA Ley Iertegole *sees Ps ae :Bn .RT Ste eae 1 stele ESOC IO ME MMMM OC MMIC 6 yy . ae Cate Nee Bees recat CR ECCS RE oaCy ct ea EIRP ybsee etal eat wea .tebe ar eatsigaed) ‘SBGaGienecrcsucaen pie F aD eal ese . -. DIT GE EMITS. eslececens coeD ate tielarecs .sre cit cn eee ee MeSaat ateaDEAE ei PALS ate RR ERT eeeEEE eT* HV elsTeeTeele at eleaS ele 9)SRBC 2) i a TEI sn.) eo elesROSA dele ele eae) ales etre sels at . Ta : Srey i ebTet OR+ crn: ese elias
eatece ee cree . - eM ee Te NMG er ee fee sie : met ys STAD OEE ooo rr : + : , eee ge . - . wae at ee
srs Te esaa eal:eea Ca a: alee ee eianteind Bs lle elets eenee oleen eleelahty est RTICMR NPOMR ARee ERT RCetay beela aim he annie ad a: +: wie were DeSales . a Sey eae MEE TCrele ol ee jsie ale we : vt - :alata ' ‘ Dl fale tle 1, sy ‘ fete . CeeoleEe COO eeeoePeay annyon eA sel sy ey 911 9000 a 6NeiOUTS caOEE ie lel a IO RPE 55's0 85960 sie ke [gehen bane TOreTe IA 0 aSe oe SE .Em . a.nsaee Teslela etal SET SS=a! RMR SN Samay Pee a ee ee a he oe aes ee el see a ee he nee eae w+ ord Sart 2 *, * * ae
COTA RED RE MOT RMSE ACIS ME ERC Oe SCA REO EEE ASE REESE OC BO SEE ERC COU ICRRCACO ESENSS sor sos cols 02Soa OOO TTINGE MIMI se ae SeOSdees . siele sietelela etSoesGOR ee :ee eos SURAT me Rae SH NET NE SE EOOO ICD OC ho OOEO aD Ur aE ST CPSRC OE OICCI TaDLO EO EELS OCIACOLAC DONE HOE BE SCIEN EMCEE ERErns SE NGS DSTROSE ORES CASE SERS PSE SMES ECHOES ve"“0” 6064+“a 71174, Ogee aana na SO OE STIa IGCI MESERCRNOE ~ "= >) ~ +. «7.ates + ~_ 0” eR SOR OO ee ee : L ples wollte ae ae ele Te
Par Ne eee ne nat ar a anc nD LT Ser Leeann SRG nee ae Ce Ge Dee OE ee ee Ce Ce Ce I SC De SR ORE RE Re OO BE MR 08 SPSS Ot OE Oe ROR ar ae RO LSRS, ”..~",..*.*.2,*”.*, S aD SEA TEDL MEBE tSO aet onRERRENOA SSE ORE NS” =°. °°... 9.7 *, ' > 0 ANB AR Oe a ee eee el dele etelel dele eel eet . ee age ea ed , i eet . . ” tl arte
ene aera rearCOREA ore ne ee ROT alate Taha Tae a Tea eel a Tals late eal Delve EGU te a fapEIST an ar DDE aP rar SEE O a ALDI SCIE NIE GOT BRIBE BECO SE CE SCHN ECSt SAC NIC NCR SCSC EM SCI MREMICM SEMEN 0 “etOC "eyeRSC y "ay" ate Sane eeTACOS eee Se MERCER? & > 4 6S + «ss "0"7.0.90 ¢ Sena=" a hae nnesseG a eeeC EEaoa DERG nr ne aS - ‘Mat TreehON tare teTS ot os cagtee a Phitga oe SRN OES SEIT STaeSra EDET ete tatTela STEERED G ea EC DGDUNES OUeeOR BEC OEE MEDC SESE SEOO IEaSRG AE SOE ooo 10 aDeis ODERIGI, = «== +r”en«OO Sybhl SpSe De wee tae ele aoe teeta anne nel arewr EROa MSOLE MATE ATCT ae is vir alate coats ol Dal sTeula leet plate by OD eae aT ae aseSSE eee a SEC aCee nmeDORIC angae ne ga caCSL gee een ite ara 2 pe TS 2208 o aSEASES alea's” see SORE aT ateBEDE Detainee eaten egeeeta lalaalela leet ee eS gL TI Gees OUST eet, befallen Uaeee lels er Tehere ehiSelelelal Seebela elle ely le os we Tate ache ac Par an caDM aN OB SA GRD ICES PCH NE OE SO ee DRI ESR aERn OS ee aesee aaywa eeteaeaa eae Sales ee ae eee ena eee eeeTsSOEIREOESEIR SS o's 2mige ”=".°” ,” a CeCe a rr ae ALR iar he Rdsleet arpee oa Lrae. aedtet mt tet eel veeTt‘a: Ad pec ete Petar TDF ‘SS iceRC a aR nS CO nee noe ene eee gnRRS ee ea ae aa ee DSC een aCO = aCSO RR ETT E ee ale leRMR, Ua4oie 8 ae + 'cs eaee aReyea eee se eley Selale se af ete., eta Ooeeesele ee ee arete teeta .kee he Sess Earelate W570" SRSA ote SEO RL edi OE BE OaOe TG Re SO OC RE RO RTenOt OCeeSG EE OD OU GRE IG OE OE Oe SOE SC a OSaay OCC ree” oe "e'seee "ab aeSea aac tee alee it ae ate Reamer rete onl eta a RIESE oeCO am MT FS Dts eeseee ale sole ESA Dele elay laeleiels, ste. La .we . . *onwate! PB .meee Ome ee aa NCNe00 CE eea eR SOaN ER ae aeeeRE Ree See RennD eee, aenhete ee aT atoo ate a sean ane leat ee eaeaims eaev6 eglyn pe9 yee ey OR Nae CORDS 8 5oeaaiePeepee "2° 47.". *wee 1.97else raRAPT rr ed eeene Tete ree Tie aleelehy, ledey DT . :teeta . wt oa rye sn ty BS,
eee tere tt tata a eer aeee a eats eg eg Tat ata le als ete ala gla ateALT es ety der atetang sr Dalya celal Sea aia abyl EDR ICele OP Tale SCREpoeta ANNO BDEeESCA ICSC REREER =u"2 Su" 00“Ta e0'o°e «a an atalaTeTaty taleEER, le’ etel ply ele oe ee ROTA os eT6,8 ee Oe Et ee88anne ees Be SR SOEon Se Rs eeeie hres fe ays - . . soe we ete: Tete renee saa a ea aalata ea ee aeSE a aPn a ea eeeee Teeege la Die elaeaeate eaNCH pte pete 8s 5's a ee ata. eo 2=> 9an ee ee a ee LL,oe allla la oPese E e+ Ay+" eT Obea weae Tee ce . soe reaFate heeyareata] CREE aeeae eeeae ten ee teee RE NEE LEeeaE AT OTE REG Teele OL DOIGTala DIG 1Bal ee Ugly SOE OCalg OD ee eS EG ERODED cas awea rs 1's a as ac oe a aIEerik inaeee ii re arta LOCI, 3. 4eT+ eet st >) 8Pree CeALOE ee a ane we feels eeee Co aT TeceTtoeTee etea Deletes he tA? "i Pare . anwot . Be aR LPR RGSS DESC RE RUOE SOIC EER SCORN TESTE SOR SEDC SOUR OSC SCSSOSB SETSTIE NAICS SRIS SPORE i REO SD IC PTSD SSC IC ESSOR GDSEI SORE LISBON ESS RCISERETERENRSESE ES 0000200090000 + 0 0 0, OURS SE CR Oe ROROCTEIRSE +=. ss. RO a aa OOS aaa ECORI SCISSORS IIS SC OES SSSCASCOCO DES SRE SCOCSCCSE ae era renee er rr nO eevee
CRORES a SE ENS OCI NE Ne Taare SAE ERENT It PT tO oa CaeREESE OR aE OPC CA OO a Oe PS GLSSO Oe PaESE SLCRRL ee DUOTE Ee SE OE BO ORESERCO ENE RRGOP ROORERE, "'.". "6" ."s 4°...” 5 eg hai an ccna eat ie7o an Pa PO aE», *_* 4 «>> ea MN Re DR ee aELST eer a eeernr saa eels ee esala aw ay , otisislels te et abeleleta Tyre elestelle ata eaeayeeLele ae eT eeHCG a Te wage pp tal in Pe as CORI OOOOI eSCIR n Oe OarSE aaOr PIES SDS SER RET 970.5. a RRO, EP, eeeSele se Se aelala ae cae On CRETE SSE Se Oe RO Ee SESE eC ReCRONE EO EE Oe RRCORO ERR CSE OEESSORDER TS SOUT LOG UCSC LDC OO OS Oe Ee CeAt OC SESPEDE EEE Ass. 4's.5071507451101 a". 5°. + (a ce arapaaeea aeae,” *, 5 1 6~~" 0.6 F ¢ + kts >) e ¢ Oe ee BE As 4 48. | ng te ee es srelelece ets . died ara nie he ada an Ne ll Pa ae a A ec a ea ae we eta ee eee” oe . a's ate rad
COIR IES Oe DE EIT TE MS AE DL aT OF SP Ba er Pater ee ee gE Ege PRES: Bors ae ao gpa ee ala! ge eee ates To ease ate ge ste a a ee eae ra ee ae CSCO Seat on Ee Se CECE nn Oe SE san Set ROR NEne Renner eee pr enaracGeaay,”.",”.*.7."./, 7." 7.5, SigmnN Ane Rpsa eM me SOK na Ge een MaRS ASS 5a Se Pe Le a feast rr ee a Se ee CO ee a Se Ae Oe Oe OE SC Se Oe a EOE BRE Re Oe Oe aD OD DONE Rn OE OS ee Ce CR MR TE MERA REER ¢"7"4 6”. > «es 6's a an ea ht i a a nei. "°°." “"."_",”,” ,” Ahh i ae a, re ae ee oe at alele le any nee ate ot Mata otal ats Sotatet tetas 7 “ “ al ; : . ‘. Poojtee “ oo SEAT NRSTE SPST SD ant OP Nai titan DREAD DEIN CONCEDED ICH BEREAC COCOLNE REDE IOC ROC IR INC SUES Bt SECS OCAC SO NEICSG WC BCL SUEDE SUE OE DE SCIENCE ESE SOK BOE OE SE DET Br OS SEE CNS DOL SRR SSDS IED ORS RIRDEDPEDRIOSRRDEDGEG*°.°0°0~ 02") ' 7 |* >_>. 9 DR SONI RUIN SECC OOERE "pr 0 "e 4e 4°16 SR a Ce aa Se at ae eae st ee oe : hip pele SIMARD DOL Ch SC: ten ee see slew ele aeale oe Te ea ae ele alae
Raa SPELL RCN Naa aRC ETE nPG a SaIOOLIOIL TL OEIS IGS OLARDC CARI OL DG TRIED 1 BL SCOC ILL OU BCIASE OLS ICDC SRE TESS S00 SES ESE RES SRE EOE IESE CC STS SOONERS SIA SOE DESC REE SD OO RISERS ODS RTESIUNPNELESTTESORSG. ©8800 15.01. «+01 ¢_ 6. CC NSS LOIS SRC RSS 060+ 0 0. 12 cc cc rc oon RR nT CR OR DOGO COCO 700 OO Viele tee eee al] Meare a ete eT aR AA FALLOT AOS ED PERLE Ped ee cE ST ge Sonatas Letetay Melecesene lad ee roe hetele te tatem rome ars ESB ta Bets etyt Meter tet clea abate tees sale alle Tele ae tnte a ale 8 ADSL ATES Z Dee EEE t, 7 ORR SSDS Delle pedn ts ie SB ah Eat ola le | lS RDA ccs Selstelel fat falateceleteatet tty otelaty ily alata ele alee ote el seal ele le See TD SSA lela agel eld ere es Das CURED EDD NEN one le COSC ATCA L Sr Sah DARA EESD EERO SPnED Ee OnE DECREE SCORE SUG FaOODS NAL DLO COGI ISIE OG SEIT 10 O00 CDG REESE OSE BOM LDCOCSE LIS SOLE SCALE SC SLE 0 00 BE OS OCDE SCOR IC SEES IS SEDO DOE CSO SER OP SPUR SURGE SUDUEUDEDIDOISEUEEG.” = 0”. =", "2° '. ":*-_") 7. * SONA SOD IRS BO CR IGSEREDEOLAG SR © F_9°4s "4 +” 00 0s COS SC EE DAIS ae DUNES ONDE Oe en een ee Te
Sis SOC NOS SPC SC I ESOL ICSC DEICIDE EES oD SOOT SE SESE SEES ESSERE USELESS NO TESS SSD INSSSD NS IRD POISON SOE SO ECO ODE ESLER SORE DCRR DSIRE =< 61037 e 0 + 5 00 7 6 SADR SSSR, «6s +s a0 6" s_ . aac a SG nD CASS SECIS DCSE IER SUSUR BOSCO OCS SSRI SSO OSCE SES SLO SO SO ORIEN feel aate
SESS SENESE SASSO DRESS SEEN RIES CEN SSE RR GSE RRS SESS EG GED IRS SRR SSRN IO aca erae ar nae ne aE Sr OCIS GSE DCN IRIEL MDEDEROTEMRSCRED =_* a eM eit eel te evel a alae eaenew ae thle iD eeane TaeSeneST a . Sar wt . nae! . Soe ee! k . wesellove ‘ wate ve noe
SE a aS SRDS DetC EDLs INAS SESE a AA SESE SSS LORDS SSCS StS MAS URGE SESS ESORELE SEARS IESE ISC IE IOSEE RIESE LISS SSA GPL DOSESESROS SST SMC ORDS ESCO ODI SCOMIESENIDEO SODSTECLSESED NISC ONCHEERECLENOOCECAEDE SS ENCUASENIIRD UES EIEN ES DIC SONNE SRISTRSESRSRSESRSESRODEDSDS® Ce ER oe OS VTS cyanea OOS Ne NT CNC OCR DpPOUT eto OETREST RRO CEDRUS ERT IRE ERS TST REED SERS RARE ENNORE RNA SEER aeOR cessasice pserice eaasi
BSS pectic. BERR gets SRO: PRESS a ON OR SN SiS OOHEE eT OR ET ES RAS PD we eoitoyrot REean an td ALR RRO RS éS ros RESUS ENSBe ROR EDO RNR.
eS eARER A ‘iSeis atEe ce SER arco Ge BRR ODROSIN RR OENS ES a SEER GE: SSRERENS ROR oa iF fas,SAS pt SASSOE e SES Rees Re BENGE Sitios
¢ JS RE eBRSE SyERIE RRO RINA CRE SSR FEDeeokes SOAR ORS UeIR BETES E SS She PSSST aRS STXS Rato ORL ae A ene OOS San Fjlure. SERINE ea SEN Ee COs EERE Barmy SEs fioun RE Aare ed . Tl - SER ersPees OC PORN SRNLneRR oe Sue SAGER BRIS SES NO See RSS IMEE LOSE RORENE OSS seer BE SARE FE SN GR aeES ee One cents pegsNEC UN SER e agtie, feesTOROS 2 eee, SROSore a ee Ormee BE ay seaeiee OS Be? osna S a) -¥ SEXO N ROOT 5 hea 5: Bg BRL 1 NINN SON caeon : ey eC ce MSRES C222 g- ee eS EeSS RS RAIN oN Sank? + Saha ° es aS CRG OMEN NDOT EATS $30 RRS NAS SOONG IRB Soe aN eine SRE INNA eaters peor & “Shae hd SANDS Sine ea Seat) ERE: FRE So PRAT ONMRR: Oi BES t Raee] SESEMR RRPLeORR, BLE RES. BB fa te SERS DS AES* BPG BAARonNS Ee REESE ENO nes NANO NO os TEES Se Ee Eee OT es ope ENT $F SERES SES nt 1: De
r( ) —,l wmeerst ‘ RNoo ORENES Ras eaeRee CONS ee YOO a Pest PANESense ney MR ELS $8 Fe.€ BSS SAR Sf Soe SNS BOae Sexton § é, tterdam 9 17. 4OOpee eee (SP SO Uy ee . . SERRE aes ad ARS "s of, Ke Sey ol rae AC ORS RR PEN Oe Riv tote pod Res ora POMC AERSE Ae AsBRS CONE Ses Sa Oe yee Etchin . SRE ON ona SU RON AS OREN Soe Se ee EER RIRG RE g by Herman Bielin BREb ERASE SON nO UNWe ORG a BRS EL Seg OR asEMA fa: CANS SNS RS Sreaineg oe: RAIS NS VE ee SS SOPr REay) rn SeOe ox SR TEORE = ENON 33 RN aot r om BSCS SR AT | Sie cite eas 5 ney PRS aye eee S55 Sak enetcensacons SO ae ies DOOR gS EEE LES ire OR aah SAS Saas Ree 8k" Tp Ran Oe hy See Be SAE EO RARER OR SURE IANS AN, SS APE BOERS OR SSEEE EERONON . SECS RRS: AR OTS TERING. DNC UNSER NE ea ncn ery ee oe $5 BORIS tare My hw: $2 SHEN Ewe " SRE ETE, a Pos
eriands eatre In sutu t e BRS SRE SRC CSRS aR gS ae me ABRs sree OR Bas NSENR ones BESO 7Se ea Se eRe ROCESS RROD NC eesRo i Se mag eeeS Se ic OAR RON eee ° Ree CRE Besar: SEGRE Sy cater esdee HS cee SS Seteve NN Rr SON IER iene RoR aD ea SURG seat OR eaERS eeeBe Bae REO assOeNRO HN CON) NAG yee BRN
Pes FEES SNES ee PS SRE Reece Set Ee ee ASE SAG ROO oo
; RETR BREE) BSD cin mere ae nec. ree, POTS SS ee? Shi Ee, Renan One: eT a SS DAMS Sooke ANN SEER RFPaagtte TORE RESIS RSC SEO AS | SIRES SG OR SEBO aiSHE POE RCEN RDERNE Ee ay SNE SAS BREN RRS Re BAS >BeSSUASS BRAS sa eet ON Santina onl ron ero PE oe SAE ES SE ,s Cp RRR RMORE RTE or atnSene’r ssf ataher en cote totale maine menatae! ne steaaltaraans ee eae art tte Si
SII CESS I ST SSD RL cone HNO OHI ob itgiicotan nstgitanesieshtlapeCecaralecapapayatane AUD CATASAS0Dg Mele! Cao cage sme Mace 2g ATR ALAS A ATU wes playa anatase atte aT See PRG Anon aA Sp ACA CSTR SAAS STE RUC Ea 020008520802 RR RR OORT 8 esrecener eae Bo SRR 2 RRR
Naarrrrrrrrrrrcecee cece ncn eee ES nn Ine I ATEN taneatesen NTNTERI can ean nAnNnenAcan cht cine hect agi hsgn US china) UssSantanntientc aLsutionnneeterenyegensiags ciclo) ee Sapna necatase’anecance-ncete COSC IcIne 0000Si eceerghrs RPM 5000842000202. RARER een eke Pinan eR RaaN cece eit sneesnte ea ncbeeteee SSSR pene R oreSSE ADSitar Leaededes nagnathsnenet SLAnUINaS LEL-Lonsann higunetiegnonisnetaganel UILEM anna g Mania HME ge eticisenegetecieagen thats et Ou Meltight SESoetacirenetath SCSI Ta SSR santo eso ceo Fe“Wop OO RRR Sore RRCACC Seta itary eet Necatinta tReet ERE aretonetccaeecmeetene ate ASA CMRRBA he
RR EME AROS ce et ccna ute enedetet trite ea eaten ngige cian es rth Tee eGR 1 STE eine CE TS REL EST ag cee Sa Gr etc oO enone ROE eater tee tee Sop. Soha Ds pnccrS cI RENCE NESS SOROS SSSR SCSSS SET ESED ESCO OSORDSSS ENRON SUEDE SERS ESSSCRESSS SEER ESSE ESSE ESOC RESON SRS SCSRS STONES OSU SERUSRS SECESSION SDSS ESOS SSR SORSSESES SOUND PEIN REDUCE HOUSTLNS ISSCC ohne eseeeenaes ENE AR YS NEY SRAM EE NECA SR ELLY Deer EC RARER ERE: ae
Perens Setces SPS OSES ESERIAC AISI SOESGIN NDA SEESGLZSSSOSSOSDSSSOSSoRSI OS ISEENDE SORBED SINGS AEESSSLDS IDS SNESCORSE SUSAR SEDSSROEISSNCSLIGNOSE OSI SESE SSE NS DSSEDE SCORERS SSS OUSIDE SCORSESE RID RSEIESSSSSONUSASSIIET ICSC OES SECEESRICNGSECSO RUSSO ROELERICEES ST UERSSRSRICSE CENT RS NOT ORD a olo conic us aRepeatpracertcaroteluneeanetarerslesetereehcere eaten Weel oeie a ecevtetangtcbiatareceecrcer sneha atet MAAN
Seen ccc cccc cenceSLES rep TceON BEdOER SOULE EC SSETDCOTDUD ATTEN AATEDADTSTSSMERTBODDUEESIOMESOODEYCACATECATLSESONDRESAISFESATACSUBUAMISRUDAECITD BEDISOGUONASEODULOEED, SHAMEEDMDeDeDcbesepebey SARIGASAMUALsDebegscel cDAyenenesatabanrdaretar aber geleleleys, slates lel Ualearetaletetetetitidetatas longArar sitetets nee RRRRRKREE ce SER ease RD Ere rece ee naedB octet as atet ates tetatatatetat stats tote ate acence asernc Secen ENTS R ECO 8 BSDUN DSTA SRT AO Coban TNTTE ETRE TRADE a aN aoe a ea Lala stones esta eal oleate Del Dsletelela alabaster eae DRE IR ISESGIGeaTS SPR ORSaR SEEGER SOUS "00's.Ta,o's": SOEUTNE "Thadetececacepececeserersyalelasscateueueterttlerts «rhrossecreeaen ertstetyees Ara ROT UrestyecrsSsOcP ecReasOr TPIS CASA ATCOVETS ASA SSac ecw So aca eNWESDMTA ANS LA ca eDay whe aA abate at anocat neeAEA eSot as gates Maig canacet eating tataces nates otabsMeseata nL fctye, sce gaeae J UPTRLOTOD Aree ACU ae asaya age ele ea bea eacaSR be eee ica aA BLAIS LyRESESINT WATS TALESNAc? aS Teaso" 2 6 ACA aes teTa SSeTe Ses 0c Tass a ERMeamatatace tatetetatecseasateceeeeemserenteectetessttatataestenctaeyeesnteanNGeasctststsectatetaPateenesesnaseneges ee : wrt SSO REEE. 1
RURInSR So ES NCIenS URSSIC Se ICR SSSEO NOSSO ERE SSSOSS oO TET SesICUS RCORSS Con RRO RSS CDS TC Cat OEE ONSR Sa CCE ReeOSE Ce aS ORR Seon RR en LEN RNC.LER OUR RREEESCOIS EE ERE asioetnccmmencnenne apenncnnnntantmmerenner ee aes es SSCS io SORES SIS ISSSOS OSS ECOR SIGIR SECC DO ENA OC SRC SCS CSC BOCES SCR REC Aa nnaar aaOS SOIR RON SITL na CEC ED OID ODS RA RUNES OnE eS aI. 00581018 SAREE ER REASONS OCR RTE RA DRASORTS NC IN IN KN RON IC NW ORD SSCSG See STORER SESSCOLIOSIS aE SOO SSL SCE Tea oROSORIO OEIC OSCE SS SAS RSS SCI SSRN SRR ROALD AISLE SN ORS RRS ER ERECT NOS NOES ORS EE CENTERS 5010's: a SERS AS ICERR RSS HORIN ORS RASS SOUR SEhv ED
SSCS ORS He SR SCOT OES SERESSC SOR TEST SEDC SOBER ICED OCICS LET SE SEI SSNS SC OEDNSLUCSESEIE CSIC SE NOSEISE ROSSER RESESS SIDES SDSS ES Etc ISO SUSIE IOSL SO SSSI ESCSUC ICBC SDEESSNCASNGSLEGOSDED SCG SS SES SSSR SOIC S ASICS ENE SENOEE SSIS CCIE ISSGIEICIOIC” 0 HOC CICS RCOIE OCI CEES SEEREREESCS RNR ss a als Ts ata a abana fay acocecarratecesecaceece Eka SCM SCP TR ature ac feacetas veatusseatereraratecevetytatetstatatacengtatennvaeate a RoC HeaC NON SCIC SDL CMR NSCS IESCIN Set SL COCOIC SRO SGSS OSGI ERCSS NORCO N SCR OUSA Tee SE SERS SOIC SADESESRSD OE SSCS: SLS> UO PEDI ISRO CSREES OESESIGSO OIL LOS SIEGE Bg SEOGSLS COEDS SIL SRIE GDI COG BIOSSDI, SOD SGDIC SISSE EOS SUOT IC AL OURISSESEIDN V,”,”, 1 RODS NRCS RSTO ICR RRC ICRA =>. 7 SESE EN OE OER RAND RR RSS SS SO OS DALI SSN SSA AS Sad SATEEN DV a ETS enes IDE aCe PSNCWEEE ese, BUSTA WIE MLODVIgE TQ Le'U'UosEaSe WSOSOIES OUNCE Qa CMEATESITGICLETTEG SIOCLTUMGS goat acess eeecetasas pote stat steCavesescotetoppephbcosnesslec sLIMSOGUMeraafecelelanng eG CeDALHLAT@LETH CAD eS SOOM cae och gLateSacaC etal a LODeTA TASES Tae a eee RRR oo Sac Ee ee ar eco ea ete aneconecatetageca near iaenmtetn te eoteaaasr eaneetetetentorenaeaetenag Mee EES TESS cscece een Nene nee Oe IRS er nea colt tye epe ngela ngeta aang inn ISISDIT OLD UT ee LISS ORCL ES h Wea aTDencecere Stes SacegN Weare etancaeanechcgtaracane euspoasncprrechovtasrsuyenttanstecansterecscotay alatatateTecote see he Dt ae Sta Sete ee CRE MERRIE." “SSSR wratetetate tate tatetetatee yoalace atarerzsarstngtnt ot gehen etetatatotataetetetencrangatasanceetesaees abst tate ttadgestetetatat arta t oN
ORISA NR at on naa SOCIcenSSSSSSS COE A SE CLR aaaSSS ReSSS DERE RCS SGSRS ROD RES LGN ICO Ita. RC ROE i SO SEL SAE SIRE EOE OO OGG Sh NG SOON OL OL ORG DE 7 JIGS DE IR OG DA SHI I CO CE RC GORENON OR eR Cae aE ae eaeANE Se Se ae SEMER or reRRa area era oleROR Oe OCR NN Ne ICR Ce Oe Seb SO aS RESOLD tO SS SESSIONS SESE OICSSSSSPESSRESsSOSESSSS DOES OSSDAERRORS SESSION OSES SD NOSIS SCORSESE ROS OESG ERS ERRERMECR = *-0"0'-s"n "0000'S SR PE a SDODL SDE ORE RN EEA S RASS ne RARE SERRE RROD MER ERE REGS
Ges eTRR ennaa SNS ioe ac AEOa aSae Senta Sins ESRG gL IeGR eeeRIE RTLERE NE os TDa8 SISSIES USST SS OG ene ORS NR aan SRNSana ERYnana APRN ANE E ERE MR ERN TM SNSlata“b” RK RRrare ERE S RARER RK BEB KARTOe ACCT RRMA ORC NO Oe OReh eR aaron I eee LD aalSO DL Sa SRP 2272820. a? SOLE 22 1u Vat Wi oR Mae oat leeSONNE S ., soste ble]RRA Tadelet eta aualatecace @oh Rte 5 3NSERC eR Pons EOE ed et TO DIE DRIES Eup ROR canetataen net chien phn sieges cin yeteenatsty insa esunss at catecutiscrmastsietiuneanarsn tuabseaaaareesilenetnt teal taitls Qeltee e000 eeere ae eitaletcrreceyevansiarcsoucrencntaieaealevoreeeeats RRRtates ERAARE SPREE ERY ERRORS RResaea OS RNS RENAE A SRR ON RR PRIGO CACO In It SIE SRaE SDC DO in OER SO EC SOOCICI DS AERIS SE SCS ESSER AE SES ESCO SRSC ACRES SESE CRE OSSD OSCE RERESSCRO RE ESSENCES SEL PRR SGC RESO SLIG IS DRUICDR CSOD ISOC OR EES ESSGREDL AUER DAOC ISLES ISSUSSOL OL SSO CURL OE NONI OEMAIOMERDRS Ant. 0, 1 aostateta nee eee eee eye RSTn SE EDIE CICS HOSOI ST LOLS RSENS DURES SES' SE 7S DWC OR SWIM NCO SUE Od SOC EN WN SC OS PE Si BSC Sg SpE Iaeet De erie eta ceec cee ecee eee eee eee e eee EEE ELD PLEND Roe, Delco belale al leenend dabagepelnete TEETER Ae OETA ETAT TAT REE 88 OEE OS IRR RI IRE CAR, 2S ATT Ta Saat WARDHA DY Tere 9 Se Se Dele Delete Sead eget Satay nesapeeaseanes caste tabeteegheneted tet tatasndteenntataeeheh Coke bal Aagaetctebaeee stat octet Bo Magateb tated tegazenadgtehet a encecc ccceae eeeene ne cee ncn ratte cece ce neces ne nen ene ee eee renee nnn eweet tenner enceatten ecccee cee eenats eeeINTE cencepacer nanceanit eer Tereet reat cLaMrheaca teeth ate nee MORN DEMDBneeswteiaceceeccseccesssatetasetetagtgeyceasacen racaracatacecatelacecsoysuteteeacreneematacatetaesreeeptoga eal CoeaCanc eer eee ea tate lacalatatecetereracels leteratecete nlats sirssare DLL naeg Sate cata ASST SLES Teac eRe ee AALS TO DATS eA WAAR esate aCaTSS ACEcusessuedeneeelscurceteaavepepenerasessbennsnppuseesee ALaC oar fatane ace ca ceale alge seas co SeTaW Leenecnestuneconagacecatacasososeracashcscasssatscatsteratece’ ana Uaceleatatete ate lata anseetnaatetet ate tetaeabatatacattatatetasatyPetatsatstch tatetctg th PTH. tHe eed BPLOAATA est secea ease «
SESS Scar Se NSE AT ENC SRSA REAL OE SESC aR OCG ARSE RESIS ANOS SUSE SDS SIL OGL ORAS ERIE GERIL OG OSDOS DDG OIG DOUG GOS BLEEDS OOBEOE IG DOOOERIEE BC IGIC I. F0 DOIL DO DUDLICIG COCCI SL COR ESOL ASUS OC OGD DESC REE SD SNR DOOD SCIEN SURES RE RASS PRON IAC UNC ecatetc’e?s!s OEE RM ENS RS EES eRe ee aoe eas MNES NR RM EM RN RES © Wits WEN aS Nn IM ERX RICE IIE NI Tea SIC REARS MRA RAMA ESSN SSNS ERS REN STOR SMI CITE Genus EINES SiO OSS aS SEASD IE ROSS SSS ESR I OneREL Dare PEDROS SUE REED NORD ER UE MNES AREER BEER MAMER ERENT eh n's"e'e'< t+: CREAR RRR ONG NT MO eS ee ae eA TO NERS SES SNR E EAR AS CER SEE SDR ORN NS Rn SARS ARN] SEES DeDaLe egal enecepegeea a sehegegeates eis ata ataaaratncalanhoeta” slayela adel eceghyiaicthcoyptesetecrietatecs abet. uageiapaceouen ot Qa ela Acecacetntata ees Oha tse aecacs eCncnsaTOcoyr stele SOcac ata ec nena cEITOINTN UISTEIASOELSO DONT UnelA“L SOU SSCOSSEOAD/T SURED ROR DRRMOROBE I tcecelacaranatafvtareeceeeeanmeays es aceuscalepaciyacaserecacsrerate/aUacatetacovecasatace ec Cer acasaterelarasate atabatacetetatsonecatateleenetecatatpmssatarasatstsestataeataretatosatatrcaeneetatabatatecatetaest tataseseer nec ce csc cee Ee nehsecnacSeUeOsNSASADOS NE SEMDAE AT NSDTADD-DSDSDCRU ADIL ICADUSSUADLTUEVEDTODLDESDEDSSNDSISISUTSt pe sabatsntucetyhaesegeatasaenescan'eeseMACcgmneanatan cute guanLele tr ancusseangensgh val QUaceeapesasayeQigaleconineaeeTecaleSetelaswegnsar CAS CaZBDNGyUDASHCO00 TASCA ES SCHORR Ne IAC A RR aca Eo area a LONG ANS REG a eae eS etacacaracaoganace eneee re geratarac cone segtarar satel tacoletstetetatetetelatet tateastetatrtatatetrtatgeatetetet:
PERSEUS SE ERS ea nag cpinieaceeratnainie eens copacisunennneaeincrnenatiig yoapitth an arama ciety d matte mon anantingntn) mor innatsachuacisng suave issu ciceacianal aa bgetes ech nt ate Caen RR RRL os OST So ber baeasaieses pelt pinged oso setann soiahonsyenecnactaeett Saas MARNE eet R RSNA SER SNCS ear
SSN a PTC aa SD Sa eat ARNE Nee RnR ENTS ENS REAR ERAN TESS SSN CMO EMER MNES SINS MLN TSS dSLR Ne EOE oN eS TOE TOS." oes coe Se a NO RS aS aS NESSES SESS RD NOSED SOR SNCS NOSIS IOR SISOS ROSES SHS MOU URNS IES ONESTAT TOTS s yin aS Can cat atetatacahatabtcntetacatat byt ated iat cate ALA LPM Shay ceca aa aa a aH AGHA AACA ALA a AACA ADP STATA COUT ATE ATA STALL cacacecenec eee ena ac epeaeecoeeegececeaneteeetegtene sine te cetacencer lags Tetatotetctetatato teats Stat CANDO ORR Nn t at tet 24 SATA NAL ACRL Ty a A ACA Tee ALAIN ANG EECA ARs ag meat eteaseatan ne netrne tennepeetemeestateeeeeteer SeSESLIES Se ares Sass tusaseghlace abecaiatece fale cele SaDLIVG ot USK SMECETS IG av aete pen LetetaTCDarpcu ela WCACASLSAy aca ebevesOtalecat ela Cec avd ptahacatwla-osaie"atONeC ASCs SOPOTAMSSC ANSTO ts nuCLeLeD Usa pteCoc seated byepenes umugmpeoeseye alepalapeney Nrletncotanse Cleyaeececagecalalal athe es clo UBeA Ones Jace aCRtet eR RO SOMA MRAM aa ecpcecesoccfacss_ofetc!Slicatatar tecatanttatetatecstetelatetstanaraeatevatatatnsatatetctatst ste SSRs ea Rea ASR RRS ORE
RACER TOES OST CSERSSID HIS DS SRD ESE SSEEI RE SC Sten SOS SDDS SEIS SASSER OSSD ME CSOEESS SI Se IG See SNES NSE SEI SOC ASSESS SCS SERED SSESE SRS RESC RESCH ODN OSL DSC ETE DE ROTC SIREN EC REDE NC NO oa Sane esaceca ete erent RE Ne SSSR CRS SR ICLM RANI Se Nn DERI N RSON RaR he SESSeiC bt DNS O ASRS eae aE ee eager ete tateastatetenesenateetecegeeeataterreete scegeourenessracacaneracarecer eles ne cetanncennseeBrececeteceted aisveleratact cet necererenetereceteeretatetetarstelarar ern Sear Lite oR SDE oC SESE NS SON RSC OL RRO at SS SCR ICR RON RAK DOr ar essne res eivctie.s-r-r 1 ect, erests ACR Nae eae Oa SE NEES Cat a SR cae MeN GRRE nO SR ROD RENEE Erte | TNE sea RIESE DIRE SRD SSRSS DE SSS CSS sOnU SO ISSESENS GORD SEDEIELCOS SR NRSO NICO HEE SER SEGCSUC NCE SURSONS SEO SDD ICSE SEOSSSEN SOUS SSRIS ORS NORE CSCS SRS ENO RRR SRSD SE race iene telat atanat re Hasan NRL NR MOIR RBI. H, 010 1000000000805 F 815187000018, 6c EO RN A RAMI ER HIN ERROR SI NSN ot 0 ok RP IRR SDE RCE Sa SSRI SESS RSPAS SE NIIP OSTEO eU CN SG ERNIE ISIS SORE SE iS RSS PRS ISD RIOD Sepia SOD DUO DESE NESTE ICES DEAR SRN CS SISRISCIO DA SISSON ASE IC SS Ve SSRIS HEREC SORENOO SSCS DEERE ERE ESRI FERNS RM RAR RICR MURR ICR MM6-b-9°2-0,974-0 4.0 20.608 hase Orda e Nol RSC RCE SCRIC ION. BCI SM SE SROC SR MEISD SC EIN SISSON SO CDESC a Sta SOROS Tagan IaG Panne a ASI RNEEIS SiO RESISTOR SOO IIG SRD IC AA ORC SO SC SOI SG SESAGIECIRUR SESE BOCES SCSI SOMES SC SONU UCUR DESERC SEED SOS aD SO SEER SENOS SSO AGOGO RCGO ESR CREE ERO RIIDIEE nS SRDS SRDS i IES REND ID OS IRMARUSAUM SOSA ®. “708470 s1-Osgsc rer, 7. vs *009. 78-20 -"1's MMMMIMMD cetesetocecnyprece eserecegeeetstesecreststsecteretsne guaepipgscrcsescsctereectetcterctctitcrstatesstss 1-1 1A a ic ce Se ac ac rcs
Mee nner A negara ese Lehane g COO LeSU TALC ADEICCLAWMMEEMEIC ACO TACSLaSATODTHDATOCN TAT ETO ESET OEAT SE GTATASOEESOCOIEATOSCDATUSIZST TOT OSYAOMOTSTAEIMUSUSUTE TOT CSWTALTSUtStAML Hace grapasesete rgmenpeatstatenener meter cuetetngee lle are eINtcMatetalele ncatereetel el 20s aaa. Sa SoS 858°. atotateletetaterarenetrtaretelatss ste? >, SARS h ca aes eae a eS Sane aaa
Spa ac SPS nD CEC Sti PID RT gr ania SO aD ELE NOI NSSELO OCONEE OES SSS BSE OMEN SRS FDL SE SEEMS SS COC RES SEES DSI SECS SOSESESS OC SIICSES SNORE SER SSR OSC Ba OSE BERERESO STIS CCDS Se SCTE Se ICED os... oS ietatet evetetaratecscotetereracateretate’atetstectate’afet eM ORMEent ot o2hatctatetatatelet fa tatehy ee Leen EAE eee re eee eae Ae
ITS Seg aS UnEesegednseh aeaelegedeneeeeeh agen aegedeasdel eh dspsuesnventgensee chun unanesbatgeitn-ntassefepsniesesingapaneenetusinegnanneresensnoterst tannseneganararesettecatecytetater rere sleretvtecestausletesataeeeevearetansnatatssy aatrranisine"acesn ttt och staan nshatasasecneocatpnatatenese tLe SSR ce SERRA RAE ARSE AS MRR RMU C5 10°50, -. SRR MRRM RES rete SST NSE SEN ONO EUG ER NES EE Ants |
Seen cnccncncc ene cece ccc On enn IE RE PSUS LBS I OE Lane RUTHIN RC ATOTPEEC OS TELDERT SETS ATRSATATsSaS are ATNTADSCOTEDDCOTACEEUCOCITE COT SSTaNSCSEDT aveurotybanat sunpeatycatamataseeyentinaeataritotsccse ego lene Simei ISITE IIR HA O60, Re - e Sea ecer 8 ee) SOOO 2 nets SUE Nested Detar Lge EEN SIDES TIL NEEL ue dageseegepngecobegesebesetepeneeetesepenegegnsepaptavsgeaegear aces nepegegnyeeonseyanen nth snapntecapanatettrataestatecneeteseasetanitinategenss Tcl lo tytiratasenecnehcetannasntasstacacetecven graben neta genwsataescine ate eins HE INSTT Re RS RRO sen ore Sere RRR LT OP int cient els ngene enna erate gener Taya ge egeaagebeg SMe NUNS a ncape ese Sen UNSROMCeS EAATO IONS HOOT DEDASASEDUONTED ESRD EC ASIOMARDRG NOD DULADAC SUSEDACIEArateDAD arse etATG MERORSUENRTUTISSTECATATACTRTICE? Ta, aoe SDLTSD TUS QUARICOTOTESOCUSTULCUSNSUT CUANDO SUSIE MUSRSESU OSD EnASUEI Ota tatecdeoes lelalelel selects ite a ete alee ete cae! ||» ERR RRR REE RRR SIRT Sa cee NEA Eta RR ONMREET SSS aha CUMS aa De eal aa el ee
SOSRS SSRIS RG SIC SEIS SELES UESI SIS SGI SSHICCO IESE HSL JEST CIC OIEN SOISS ROM ON SSO SIROSC NESSES SNGSESEIL SEDO GRINS. SO OCS SPS gOS SESE SPD TEES SEES SEE OR OE SER LED Sr SEE ESET aD GSAT rE CS SSeS AEE REE” OS RR OCR RR Rae ocF A SATA os ONAN oo veloc Tere hita Liaae ale atycataleletetetatelet teva, shefetetatetotatecot Beene neon nec ee eee EE ISa eee iret eect reteberenenen gegen eee terefocamegeneaganatanapecetaters oy longel igrenstetetecncetecaeeten Pern eran aE eID CS SOB SHOT SS CUES SSIES ER LSE ACIS OS SODSS SOE SE SE RESESE SOU CSO DS SRST ODE REDEEE =>" os" c"soTece"svateretere’tcsteve lets’ eo ehe“t7r eee AOE, . c*ORONO “CNEL ON
. RR tet at te OTELISOT ETARE Ea “era sete ERC nae anaSS i” : .EEN RAR OCR IRReteAeR MMR HIE : ‘ZERRREMRR ARR REREAD CEREUS 5 . | SSA CRMRE . ciriatate state eta ae, oes plant settee tateleteretete rteReon soit Reterecattetesyatatetererecatecentalecaty aerate hl ‘ RETR RRR RE RRR CMa iinlreteetretsterrietes stecesrestt cM
EIN Te t'arerarececs erecocecncers tere eferere 6am . . es PRENIN MERA IOC Ban, oss A_e aca, sle-e-e-e-0ce-10c07a"e10/t 9 e 01 ; : Bietenaieteaceieieiatetateleataceceretnaeetetere Rene arnsenarnontenestniscesueraraidiyienteiceterpreetern ero
. USES lela OOO COUR EIR IRD. - orn TA eta areola KORRES ENR LSD. . : SRRMMIED ©8980 c0 Loca LeLecaLy elesbce eee SEE CED Ra RRNA NNER RARE SRNR SERRE uncer:areal : . .ORGpOERETS. Besrre ateacrcececouecccncececectcecscecececonerececsticeec0oa SoeiSSRN ae RBMsharecncaeic nts Naunisuemnenenreerncreered "SETS NS BeseRSE ROASSS SRRLoaSRRRRERER . ‘ Bites sree statretiersnest terior
|.SERRA RSE rorerenitis,. OR .~+vs ARSEET earcerry RRC :“RELEEOG CEU EREE EERE Saas Brccenteeene RE OR ENS : "ANC ‘“a22~0cEECCA EERE RRR, .MPC De ee eleeRSM eee rarele ra elevate ee ve nee a DOES SR RR cm 7 ® 5 . ‘REAR NEBR MERE REET: : RRREMR RINNE ire capitate cetiiacer : Ric nrceccnncineceie eee gall RMN Wescriserstcernsssecececssesereceresececectsese 1 Uu I e enet EERRERER a esi | in a oseEERE I oO IICRI I } e .: .oe SEO ICT . ' RE RRR RRR tg SOON ENE RARE RK EIR Es .RRR LeesRRC etatatatetetelee ea ralatatetetatate’s“etureceterececeTereretele . , , CAEN RECN NM HSS CSI TSAR ORR SRN, . bd SAREE RRs Bartnamoneiat i sivaneiircvensioveecrereie sg SE 28080-00808 208.908.0608 80 000 808080 “OSES ORS SR RIL. 3 > . ° BSCE eee eee eee eee oom REMERON ats sanvenrstreernrsnnrny RRA RRRR NAAR ARRENE ARR RIE SORE T «. NON no Dios . CN eee ae pont einichieioten "RRARRR ARR ARRMA BRARERAX REREAD RAMER CPW stonss.e.s.sielalulale’e.eelolele"slenetelst electec aca-0
. oe . Boo acecaceecalecetecacececececacecec elec ere erereceles ect a Oe UT TPT SDC g ORS ORR aR a St
: » EROSION RE eS ORICA, : : on RENEE SIONS A 8 cect ccc kes echsara ALS800 reser nresare phe . . RRANRANMRRARAARR ARK AAR RENE R es 8 CR EE EMP R RRS RIC osSS N0-e-1)n_el0:0-010-8c0.9-s/9. 800 beck aie ece79,0, ese acne ey a
. SRR AR ORE Rena eae RRR RRR RRR RRR MRR TEMES MMM NRGAERA V0" 0. RAE 3°0\vio-c"a"'u-v-1'0'00"e‘o"a"9-0"0"e-¢"0"6-n-0-0/8;0.0-0 an * SARE AS SOURCE RSS se RRR : SERIE SS SS OES RRS
. Bees ecole lesste“ecevetecniscabse CV EUR MERLE RRR EEN ROR RRR RS roa 1 TLE ICELCIIRIESS eTERRORS S RS S Se IC : ' : Prrerecacerecer RAKES ARSENE ES OC Re eR Ren, as — SERENE AMEN SRNR SI SOC OOCE REMY SANE Se ONS aT . . Pace’n ‘anion aaah te or oe oa aa Gl a RR aT SPEEEMERUMARRERANMEK RR RNEN MEK RR ER NEM MR ARE CRICK RN CRN RE RARER RE
schitz-Ku nows ki from H B ] ate 2 Be ee ERS A SAGO Nesta, RIE aCSON Se SR EDEDECIERCS St 50SEC NEON SORES OC SIRO cSt OS ESO CSE SORE ESOC ESESN We SCS 0 CRUSE MME SGD "cd Oh Se SSE LEO SON BOC AE SRE SN OM SO SC CO SU Te Se SD COMOROS
eR NR MM MCR SS CS ME ee ee Tae OE EERE bic aS Kb. ON CW MRM Sk RM at OCW AC en NW ean DEI OP 0 SPS eS e . e a ha ana ae Aataneen ac tuagheaca’ # in cea mae oaeemates eege hoepanage Shrine enCM (i ihr a ne SPREGEN TSP oO Pepcirra feetNS ahEMttOR ahERaSMNTDD ia EN i Sa alSPOR dina, RAT RRERDR RSE AEA RRO RS REN RSE EN RG DS Ena S Re RES Sie REESE Os SR RMOEEERT «3-5 S.c SEDs USK eRe RRR RH RRM ROR SERRE RRO ES NEL EEE EEOSSEN Si Ee ORS SES SS
$ 9 + ARERR AR ES REN M RNAS MME RECS SONA CRS RN Ne TR CRMC RK eR aa RD 8s MEN 0's RED CNS CREE RRR RR ee eS Se Re Ce ee Oe CN ee Ree ee TAT ST ACTA RE RT LN TA EG SE a SNE cy ROO” COB ORRNS SOME See eter ea ETE GARCN A RESET ESCART AACE REE ETDS MIE SELCHE SETAE ODEE HORCEIPORSHNC ao RCOPRSECN BLUE SSTNCIICETS SITS VNC
SPEARS SENS RMI RARER ERNE REE NR ESR NS REA SR ARES SR ERE RRR EMER ERED RRR DEER ANS. eb. SMR Oa Sean aaa Ne aN Sar eR En Sa NN CR SCN STC SENT EN eT WT at Saan SeR COS
alalsleleletatataleTebal atetscary leneca ee el 77s ee eta OLa eae WTS RATAN ee ATA ATE RES BET SIU ODE A AEDT CURIE REBT COB STTRATATVTR TERT Ff, O10 TATEL SLOAN LOIRTE UALS TL ARTALHC 9 9 ERY LOD STALETD SE RTETOCE’ BTA ASE OSES RTD DOSTANA AUC AO TT # NI RRTE STIS TOTAAL ET
TT CEE GER CO nh TR eet gy inn Rn EE en TRE Ce ee tenn ote Oc cne inc ene er COMeP enn: Deve ceper terrae peer tenrencnncrgnedssecserer: SESSESE ESSEC ORAS SOE CEOS ESEOOE OSE SEOSSOS EOS OSSD OD OSE OS OOS REE OEE SSS SE REE DEOESCoE HOUSE OSE SORES OSE SOO SE OSE OSES EE OIE ORE OSS SESS C EE
#
Schools of Bodily Expressivity
DANCE AND DANCES
As the most complex and distinctive manifestation of German modernist
body culture, Ausdruckstanz deeply stirred the imagination because it unfolded within a dynamic system of signifying practices whose emancipatory potential appeared limitless. But this system did not establish its credibility chiefly through a canon of discrete works that can be read as closely as literary pieces, artworks, plays, or films. Perhaps the emancipatory appeal of dance depended on its reluctance to leave behind concrete evidence of its forms. In any case, one cannot construct much of a history of Ausdruckstanz by analyzing particular dances of particular “authors,” because the documentation simply does not exist to produce any sustained analysis. But this absence of documentation does not mean that German dance culture
failed to produce a substantial body of works worth documenting. Many dancers resisted documenting their pieces in any detailed form, such as notation or film, because they feared that others, in an intensely competitive market, would steal their ideas or that audiences’ desire to see the dance in a live performance would evaporate. Yet the most obvious reason for the lack of documentation was great uncertainty about how to document a dance. Movements of the body produce such complex impact on perception that they challenge the power of language to describe them accurately, especially in relation to their meaning, which bestows value on signifying practices. Even today, the great majority of writing about movies, which are much more similar than dances to conventional texts, focuses on
issues of narrative and character and completely subordinates to these issues the analysis of performance elements whose value often does not depend on narrative context: acting, set design, lighting, costume design, cinematography, musical score, and editing. Signifying practices migrate 97
9 SCHOOLS OF BODILY EXPRESSIVITY
across performances and therefore across narrative contexts; one sees performance by detaching signifying practices from narrative contexts and placing them within a larger context, within a range of choices open to performers to signify a specific narrative situation. German commentators on dance during the Weimar era seemed to view the art from this perspective. They wrote prodigiously on dance but rarely described specific dances in detail. They repeatedly announced that dance was the greatest expression of individuality, of the repressed or dormant “inner being,” of national identity, yet they did not regard dance culture as foremost a repertoire of specific dances or even dance forms. The major dance chroniclers of the era—Hans Brandenburg, Fritz Bohme, Hans W. Fischer, Werner Suhr, Fritz Giese—did not describe dances so much as they
described personalities associated with habits of signification used in dances. As the chief manifestation of the profound metaphysical significance the Germans sought to ascribe to the modern body, dance could not
be reduced to dances or to highly concrete forms. To preserve the metaphorical, symbolic, and political integrity of dance, it was necessary to construct a discourse that shifted perception away from material incarna-
tions to the embodiment of a stirring—indeed, ecstatic—spirit that transcended the limits of materialism and sensory perception in even quite modernist sensibilities. Before the advent of the Third Reich, no country was more active in the
development of modern dance than Germany, but even then German dance culture self-consciously regarded itself more in relation to an expanding potential than to the solid establishment of practices that one could eventually call traditions. The motive for the metaphysical perspective seems reinforced when one examines recent attempts in Germany, the Netherlands, and the United States to reconstruct, on paper or in performance, dances by Mary Wigman, Harald Kreutzberg, Gertrud Leistikow, or the Bauhaus. These reconstructions always seem a little disappointing, even when a huge amount of money and time is expended on them, as in the Joffrey Ballet’s 1988 effort to reconstruct Nijinsky’s The Rite of Spring (19193).
As long as reconstruction primarily entails the recovery of movement, music, sets, and costumes, it will always tend to disclose the inadequacy of past performances, for the appeal of past performances depends less on those elements than on the bodies and personalities of dancers, as well as on historically unique factors that are not easily recovered. For example, if one compares Marja Braaksma’s 1990 reconstruction of Mary Wigman’s Hexentanz (1926) with Wigman’s own version of it in a 1930 film clip, one sees two entirely different dancers performing the same movements to the same music in practically the same costumes to produce two quite different images of witches, with Wigman appearing far more spooky and Braaksma far more voluptuous. We cannot reconstruct the vast majority of dances pro-
SCHOOLS OF BODILY EXPRESSIVITY — gg
duced between 1910 and 1935, but we can recover the system that enabled German dance culture to achieve such immense productivity and to make dance central to a modern perception of the body. RUDOLF LABAN
No figure of the German dance culture enjoyed a greater reputation for treating dance as an abstract system than Rudolf Laban (1879-1958), and no figure left more abundant documentation of his ambitions. In the 1920S no one wrote more on dance, no one had more students, no one had more schools devoted to his teachings, and no one seemed to have such a huge slate of enterprises devoted to dance than Laban. His life teemed with so much activity and he left behind such a vast archive of doc-
umentation in several countries that no one, least of all himself, has yet been able to construct a coherent, comprehensive biography. His memoirs, Ein Leben fur den Tanz (1935), gave a remarkably reticent and unengaging account of a life that was apparently too complicated for the author to examine with sufficient patience. Laban fabricated a powerful mystique,
and his disciples have perpetuated an aura of mystery surrounding him with a rhetoric that is sometimes even murkier than his own. But once one penetrates the cloud of reverence enshrouding him, one sees that Laban began far more projects than he could possibly complete and that productivity does not necessarily equal concrete achievement. Like Emile Jaques-
Dalcroze, Laban was neither a great artist nor a great theorist; he was a great teacher who possessed a powerful gift for motivating people to exceed their own expectations of themselves and to pursue ideals that are not easily understood. Laban came from the Hungarian nobility, and after studying art in Paris he decided to pursue a career in dance, against the wishes of his family. He received ballet training in Paris, performed with different companies in North Africa, Germany, and Vienna from 1906 to 1910, then started his own school in Munich. When war broke out, he migrated to Zurich and
then to Ascona, where he established an experimental school that integrated dance into a larger, countercultural lifestyle that included nudism, sexual adventurism, and nature worship. A great deal of legend surrounds
the Ascona period, perhaps the least adequately documented phase of Laban’s life. It was during this period that he perfected his strategy of insuring the legacy of his pedagogic ideas by cultivating powerful erotic-physical relations with his female students. He formed a kind of harem of devoted women, demonstrating that Ausdruckstanz involved the construction of a mysterious personality with an almost hypnotic control over the dynamic, liberated body. From then on, Laban’s relations with women were so com-
plicated that one must conclude he had a rare gift of making them feel
IOOo SCHOOLS OF BODILY EXPRESSIVITY
utterly unique without allowing himself to feel possessed by them (although he does seem to have needed, in the erotic sense, numerous women to sustain his sense of purpose). After the war he returned to Germany, where he established institutes in Nuremburg, Stuttgart, Mannheim, Hamburg, and Wurzburg. By 1926 he had schools dedicated to his teachings in all these cities, plus Leipzig, Basel, Munich, Salzburg, Tubingen, Berlin, Budapest, Vienna, and Nordhausen. All were run by women except the schools in Jena (Martin Gleisner) and
Hamburg (Albrecht Knust). In 1928, at the Essen Dance Congress, he introduced his method for notating dances, subsequently known as Labanotation, which has since become the most widely used system of dance notation. The same year he helped launch the journal Schrifttanz (1928-1932), published by Universal Edition of Vienna, with Alfred Schlee as editor and Laban’s perspective as an editorial principle. Between 1930 and 1934 he directed the ballet of the Berlin State Opera, and in 1936 he coordinated the dance productions for the Berlin Olympics. Because of the Nazis’ “hostility toward dance as an art and cultural language,” Laban decided that the
Third Reich lacked sufficient opportunities for him, and in 1938 he migrated to England, where he spent the rest of his life, much of which he devoted to the study of bodily movement in industrial production, asserting that the most aesthetic movements were also the most efficient.
During the 1920s, Laban produced numerous public dance performances, including Die Geblendeten, Himmel und Erde, Tannhauser Bacchanal (Mannheim, 1921), Der schwingende Tempel, Lichtwende, Prometheus, Gaukelet,
Komodie (Hamburg, 1923), Agamemnons Tod, Dammernde Rhythmen (Hamburg, 1924), Narrenspiegel and Die gebrochene Linie (Berlin, 1927). His most
ambitious choreographic project was the enormous three-hour ballet Don Juan, produced in Berlin in 1926. But in spite of his obsession with documenting dance accurately through his notation system, information about his dance productions is astonishingly meager, and none was intensely successful either commercially or critically. In an article for the Deutsche Aligemeine Zeitung (Qg February 1925), Fritz Bohme, commenting on Laban’s experiments with “musicless” dances, remarked that Laban’s sense of bodily movement was “more choreographic than musical,” by which he meant
that Laban devised movements without paying much attention to musical motivation—without, in effect, listening to rhythms or harmonies in dialogue with bodies. But Laban’s idea of dance was too complex to achieve its strongest or most lucid expression through dances. He saw dance as a mode of action that transcended the borders of institutions and conventional distinctions between nature and civilization.
In 1922 in Hamburg, he began his most serious experiments with the notion of “movement choirs.” In these exercises, conducted both indoors
SCHOOLS OF BODILY EXPRESSIVITY IOI
and outdoors, large groups combined and recombined in numerous variations to dramatize the power of dance to accommodate difference within the struggle for communal unity. Although the movement choirs appeared in theatrical productions such as Faust IJ (1922), their expressive value was much more evident in improvised or appropriated contexts (Figure 27). Throughout the 1920s, the exercises for movement choirs attained an ever greater complexity and intricacy that was specific to the moment and too difficult to duplicate or rehearse for the purposes of theatrical dance performance. However, the movement choirs were merely one element in a grandiose ambition to liberate the value of dance from its dependence on dances. Laban’s true medium was not the theatre but the school, and his most congenial form was not the dance nor even choreographic activity but the lesson, the lecture, the demonstration, the act of instructing. Laban hoped to release dance from its institutionalized confinement within the theatre and the business of touring, which he hated, as is evident from his correspondence in the Leipzig Tanzarchiv regarding the ill-fated tour of Poland in February 1928. His plan was to construct a large network of schools throughout Europe as an alternative production and performance system operating independently of conventional, tradition-bound theatre culture. To achieve this objective, Laban had to detach a cosmic notion of dance from its material manifestation in performances; he had to establish a pow-
erful, alluring value for dance more through writing about dance than through performance. But a potent aura of mysticism pervaded his writings on dance. He rarely, if ever, analyzed actual dances or bodies but constantly introduced hypothetical models and examples of movements. This antiempirical attitude almost suffocated his most theoretical and popular book, Die Welt des Tanzers (1920), which was more a meandering collection of notes than a cogently argued theory of bodily expressivity. He did not analyze dances or dancers, nor did he refer to any other thinkers on dance;
rather, he presented a vast constellation of categories of analysis. The world of the dancer consisted of this seemingly endless labyrinth of categories: “Dance as Gesture” (13), “Tonality as Gesture” (14), “Thought as Gesture” (15), “Harmony of Gestures” (20), “Body Sense and Sense of Tension” (25), “Symmetry and Asymmmetry of Gestures” (32), “Becoming
Conscious—a Symbolic Action” (34), “Appearance of Duality” (38). “Appearance of Triality” (38), “Desiring, Feeling, Knowing” (40), “Movement, Stupefaction, Instruction” (44), “Dance of Inorganic Nature” (59), “The Self as Source of Recognition” (66), “Language of the Hand” (94), “Activity and Passivity of the Spectator” (169), “Periodicity” (233), and so
on. Laban introduced several hundred theoretical categories, none of which he defined for more than a few paragraphs before moving on to the
102 SCHOOLS OF BODILY EXPRESSIVITY
next category. His writing style was majestically aphoristic and even a little oracular: Like the ecstasies of terror and hate, the ecstasies of joy and love will indicate the same contradictory signs. Whispering and calling, high and deep tones
interact. With broken voice, turbulent motives, in which stammering and poetic soaring become reconciled, the movements of surrender and the gestures of the pressing toward the thing in itself [An-sich-Pressen] are performed (179). The solo dance is a duet between dancer and environment or dancer and inner world. In the first case subjectively real, in the second case subjectively ideal. More concrete is the group or mixed movement in which rhythms of fleeing and following or inclination and repudiation enter simultaneously and with greater potency. ... The battle dance, the fertility dance, and the temple dance are the most pervasive kinds of art dance (208). Rites are symbolic actions. Their educational value and their aim is the inner vision and outer expressive capacity in the sense of a demanding and testing of plastic experience. The context of ritual is the festival. . . . Every ritual arises out of dance, tonality, and word. Definite movements, gestures, steps are bound to audible rhythms, imagined and spoken words (54).
Laban’s writing hardly ever became more precise or analytical than in | these passages from Die Welt des Tanzers, yet his language stirred a great many people. By introducing such a multitude of theoretical categories, none of which he actually applied to any concrete manifestation of dance, Laban implied that dance itself defined the limits of analytical rationality by usurping and dissolving all stable distinctions between forms. For Laban, dance was a transcendent, cosmic force that imbued everything with erotic rhythm and tension: “[I]ndeed, in all life, in all being is dance: dance of the constellations, dance of natural forces, dance of human actions and feelings, dance of cultures, dance of the arts” (156). One could even observe the power of dance in stones, for “the crystallization process is excitement and movement” (59). The uncaptioned photographs in the book, most of which showed himself and his lover, Dussia Bereska, were merely decorative illustrations with no direct relation to anything in the text. They depicted the two dancers in uncontextualized studio poses, with Bereska consistently wearing bizarre, rather mythical costumes. The photos created the impression that dance inhabited its own strange world, an immense, bewildering system of phenomenal relations detached even from the language that tried to explain it. In Gymnastik und Tanz (1926), Laban’s rhetoric was less awe-inspiring but
also less overtly theoretical. Here he did not associate dance so much with a transcendent, cosmic rhythmic principle; instead, he presented it as the superior sign of a modern expression of communal unity and social trans-
formation—dance appeared as a historically unique force of liberation
SCHOOLS OF BODILY EXPRESSIVITY 103
within European civilization. Whereas gymnastics focused on purely quantitative evaluations of bodily strength and health, dance made the body a field of expressivity possessing emotional qualities that eluded quantitative measurement. As in Die Welt des Tanzers, Laban’s analysis of the body paid no
attention to typologies or physiognomic categories, even between the sexes: he presented both the body and its movements as hypothetical constructs, reinforcing the perception of dance as a unifying phenomenon capable of accommodating manifold differences. He examined numerous parts of the body, from head to toe, in relation to their movement potential, although even here he was not altogether precise about what movement signified as
opposed to what the body part in itself signified. Dualism permeated Laban’s thinking about dance. Every movement entailed a countermovement; thus, breathing was the complement of the pause, symmetry the complement of asymmetry. Bending unfolded against arching, the swing against the turn, the flight against the fall, the spiral against the lateral profile, stamping against tiptoeing, stretching against coiling, advancing against retreating, the ring against the line, the left hand against the right, the head against the torso. The tension between symmetrical and asymmetrical movements led to further complexities: both arms could move symmetrically while the legs moved asymmetrically; the heads and legs of six bodies could move symmetrically while their legs moved asymmetrically, pulling them in different directions; all bodies could adopt a swinging motion, but some bodies might arch while others spiraled; the left leg could tiptoe while the right stamped, the outstretched arms trembled symmetrically, the head tick-tocked, and the torso arched, then bent, then swung. The major effect of this recursive dualism was to release dance from popular identification with steps, with formulaic phrases, with a focus on lower-body activity. Laban
showed that any part of the body could dance and that all were essential to a modern idea of dance. The expressivity of modern dance depended on tensions between body parts and movements, between symmetrical and asymmetrical significations. This concept of bodily “harmony” was alien to ballet, in which the ideal body moved ideally because it was free of contradictory tensions. However, Laban’s discussion of rhythm and temporality was, as usual, exasperatingly vague. He said nothing insightful about the relation between bodily rhythm and musical rhythm; having so little understanding of the power of music to control emotional responses to movement, he tried to present bodily movement as an autonomous expressive field whose mean-
ings remained stable regardless of the total sensory context. Nor did he think it worthwhile to explain the impact of costume, masks, lighting, or scenography on perception of bodily movement. The main point was to free the expressive body from overcontextualization and excessive institutionalization so that it could inhabit or appropriate completely new contexts. The
104 SCHOOLS OF BODILY EXPRESSIVITY
abundant photo illustrations helped support this task considerably, for they showed many male and female dancers, some perfectly nude, from Laban schools throughout Germany, performing indoors and outdoors, in forests and in stadiums, as if all belonged to a pulsating, universally triumphant community or social movement.
Laban was so uncertain of the appropriate context for modern dance that he became obsessively preoccupied with the relation between movement and spatiality. Theoretically, at least, he regarded space as being as dynamic as movement. In a little dialogue published in Die Tat (14/9, December 1922), Laban had a dance lover ask, “But how should one present the form and content of the dance artwork?” to which a dancer replies, “An empty space organized through manifold gestures of solo dancers and great and small dance groups. .. . A world bound and structured by the discharge of those powers which reveal themselves only through human gestures and of which word and sound know only silence” (679). In an article for Die Schonheit (22/2, 1926), he announced that dance required its own
distinct performance spaces and that the configuration most favorable to dance was the amphitheatre. In this setting spectators could watch the dance from all sides and from different perspectives, as “every dance composition builds itself as much through depth as through breadth.” Dance performance should occur before great tapestries or curtains, not behind them, because “dance is not an art of illusion” but “such a strong stylization of natural movement that an illusionary stage environment only has a corrupting effect.” In northern lands, open-air theatre was not feasible yearround, so he suggested the construction of cupolas over the amphitheatre
in the belief that great cathedrals offered the best models for the new “dance temples.” He also insisted that lighting should illuminate the “plasticity of movement” and not distract through “complicated color-effects.” Every dance temple should have different-sized performance spaces for monumentally or intimately scaled occasions. In another article for Die Tat (19/8, November 1928), he reiterated that “dance can serve the opera, the theatre, the festival, the celebration, and
many other situations,” but “today the dancework still has no venue in which it can be effectively presented to the spectator. Perhaps in the circus. In any case, not on the proscenium stage. ... Dance theatre is first of all: a space; secondly: a suitably modelled ensemble which can technically and
spiritually realize the composition of the dance poet; more remotely: the audience with a cultivated sense of form and movement.” (591). That Laban regarded space (not music) as the dominant source of energy for dance became evident from his thousands of drawings of moving bodies and then of movement alone in its most abstract images. The Leipzig Tanzarchiv contains several hundred of these drawings, but they are so cryptic that it is probably impossible to figure out what they mean. It is clear, how-
SCHOOLS OF BODILY EXPRESSIVITY 105
ever, that he sought to represent movement as an abstract, geometrical force struggling with or against space, emptiness, as he emphasized in a lecture at Berlin University on 16 April 1928, when he finally concluded that movement is “not natural, but abstract.” Laban created drawings on all kinds of paper, in different colored inks
and crayons, as if color or shading revealed the emotional quality of the movements, but in the vast majority of the sketches he put some sort of geometric frame—a circle, a square, a triangle, a hexagon, a star, intersecting trapezoids, “the crystal”—around the often fantastically arabesque movement, often giving the impression that the frame controlled or determined
the limits of the movements (Figure 28). From these drawings emerged Laban’s curious notion of the zkoseheder, a transparent cubospherical contraption that supposedly would reveal different zones of energy associated with different parts of the body and different movements, depending on the direction of the movement within a section of the zkoseheder. He made photographs of dancers moving in the koseheder, and he explained his spacebody theory in almost pedantic (though not lucid) detail in Choreographie (1926), but the impression nevertheless remained that he had imagined a cage that contained the moving body rather than a serious map for exploring dynamic relations between body and space.
Moreover, in spite of his demand for a dance performance space that allowed audiences to see the body from different perspectives, all of his images of movement viewed the dancing body from the front in a proscenium frame. All of the dance photographs of himself and of his students were taken from the front at eye level. Unlike Isenfels, the Bauhaus photographers, Schertel, Villany, Drtikol, or Rolf Herrlich, Laban never saw photography as a way to portray dance from an unusual angle or distorted distance. His visual sense was actually much stronger in the use of bizarre or fantastic costumes than in the exploitation of space, a fact that is especially clear from photographs of his simultaneously abstract and medieval “dance tragedy’ Gaukelet (1923). In his choreography, Laban tended to press bod-
ies close to each other in complicated rhythms, so that the spectator perceived a dense mass of activity without shifting focus or turning the head. He did not see movement as an extension of space, nor did he see space as an opening for movement, as indicated by his remark in an unpublished paper on “Das chorische Kunstwerk” that large public spaces give no joy when occupied by only one or two dancers (MS 88). Although Laban avoided any sort of empirical discourse on dance and certainly on dances, he nevertheless was responsible for introducing the
most successful method of recording dances, Labanotation, which he unveiled at the Essen Dance Congress of 1928. No notation system was so comprehensive in its capacity to accommodate the numerous variables of
dance performance: part(s) of the body that moved; direction, weight,
106 SCHOOLS OF BODILY EXPRESSIVITY
duration, force, rhythm, and tempo of the movement; rhythm of the music; relations between two or more moving bodies; number of movements; multiple rhythms within a movement or body; spatial relations. Laban devised a
complex code system for marking each performance variable, with the result that a sheet of Labanotation looks as abstract as a sheet of a score for large orchestra, except that Labanotation is actually more difficult to read. A law of 19 June 1901 declared that dance works enjoyed copyright protection as long as they existed in a written form, as a text. In theory, Labanotation would thus protect choreographers from pervasive plagiarization; it would also offer choreographers the capacity to create dances on paper the way composers write music, and it would ensure that dances did not die with their makers but survived as historical artifacts. As it turned out, however, Labanotation fell far short of achieving any of these objectives. Labanotation was an expensive, time-consuming process that attracted very few students and that even fewer dancers could afford to subsidize, and it was not until Laban had long established himself in England that serious training in the method finally began. In Germany he lectured vigorously on the subject with slide shows, and around 1929 he even contemplated making a Schrifttanz (written dance) film of his method, but he never applied Labanotation to any of his own dances. The main task, he decided, was to con-
struct a comprehensive set of symbols for recording all possible movements of the human body. Albrecht Knust (1896-1978) coordinated this unexpectedly gigantic project, which he completed only in the 1970s, when the entire 200-volume Kinetographie Laban was deposited in only ten
dance libraries around the world. Despite its arcaneness and typically Labanesque obscurities, Labanotation was significant for two reasons: 1) it revealed that the overwhelming majority of dances confined themselves to a tiny range of the total movement possibilities of the human body, that
choreographic imagination was incredibly blind to a huge, unexploited expressive potential; and 2) it showed that the dancing body produced such complex disturbances of perception that empirical analysis of dance was much more difficult than almost everyone realized. It was not at all easy to describe accurately bodily movements, let alone their meanings. Labanotation was like an immense dictionary; it provided the letters and words to describe discrete movements, but it was powerless to explain the meaning of the movements it described, nor could it relate variations in
movement sequences to semantic variations. By 1930 the meaning of dance seemed in desperate need of a more lucid, persuasive articulation than Laban had supplied. It was in 1930, as economic conditions for dance culture deteriorated rapidly, that Laban became ballet master for the Berlin State Opera. He hoped an official position might consolidate his influence within government circles responsible for subsidies of the arts. Although he had many
SCHOOLS OF BODILY EXPRESSIVITY 107
well-trained and gifted dancers at his disposal, his productions achieved only modest success, partly because of ballet politics and partly because his choreography seemed indifferent to musical value. His great love was the movement choir, performed by passionate amateurs. For the 150th anniversary of the Mannheim National Theatre in 1929, he staged, in the municipal stadium, a huge piece for movement choirs and speech choirs consisting of 500 men and women; the same year, in Vienna, he produced an even larger spectacle, with 10,000 performers. But the Nazis distrusted his complex, highly contrapuntal sense of rhythm and his close association with a left socialist motive for the movement choir, as exemplified in the work of his former student, Martin Gleisner. The 1930s were a glorious period in the history of mass movement spectacles, with fascists even more than the Soviets displaying considerable imagination in this form; but after 1933 the movement choir as Laban envisioned it blossomed most congenially outside of Germany, in the Netherlands, Belgium, and Czechoslovakia, especially among the Catholic-socialist organizations. Laban obviously possessed titanic ambition. If his achievements seem less than one expects of titans, it is probably because he could never resolve a great conflict within himself between theory and practice. He saw that creating a higher value for dance depended on treating it as a huge, abstract
system that functioned independently of dances and even bodies, just as language operates independently of speakers and texts. Indeed, he spoke of dance as a language and choreography as writing in movement (7anzschnift); Labanotation (Schrifttanz) was a monumental effort to find a way to write down movement. Yet he associated language not with lucid systematic communication but with mystical crypticity. His rhetoric inspired plans rather than executed them. But by building an abstract system out of cryptic language and esoteric symbolism, he also demonstrated the completely contradictory power of dance to produce the unique, mysterious personality that appealed equally to his many students. Perhaps he best summarized his ambiguous conception of dance as an enigmatic language in a lecture on the subject given with Ruth Loezer at the Volksbuhne in Berlin on 8 February 1925, when he claimed that dance was a form of runic inscription: “If we want to understand dance, we must learn to understand
the law of the rune. ... The whole history of dance is simultaneously the history of the encirclement of dance as writing [Tanzschrift]” (“Tanzsprache” program). MARY WIGMAN
Laban’s most famous student was Mary Wigman (1886-1973), who became the greatest dance artist Germany has yet produced. Much has been written about her, and I feel no need to cover the enormous terrain already traveled
108 SCHOOLS OF BODILY EXPRESSIVITY
in Hedwig Mueller’s excellent biography of Wigman and Susan Manning’s wonderfully detailed reconstructions of her dances in the 1920s. Wigman matured rather slowly as a dance artist. After receiving unsatis-
fying instruction under Dalcroze at Hellerau, she studied with Laban in Munich, then in Zurich and Ascona, where she became friendly with the dada circle around Hans Arp, Raoul Hausmann, and Hugo Ball (Melzer 103-104). But dadaistic nihilism was not compatible with her disposition toward heroic gestures. She produced her first program of dances in 1914 at the Laban school in Zurich, and she contributed dances to various Laban programs until November 1917, when she presented, again at the Laban school in Zurich, a solo program of Ekstatische Tanze. By this time she felt she
had nothing more to learn from Laban, but her next move was not clear. She retreated into monastic solitude in the mountains; with writer Felix Moeschlin, she made an alpine fantasy movie, Der Tanz um die Tanzerin (1919), which has disappeared (Dumont 53-54); and she put together solo dance programs in Davos and Zurich. The acclaim these received inspired her to test what she believed was a more demanding audience in Germany. The break with Laban had major repercussions, for over time the two came
to represent opposing tendencies in German modern dance. By the mid1920s, Laban perceived her as the dominant threat to his own ideology and worked subtly to discredit her, largely by omitting her achievements from
his prolific pronouncements on dance and by building within German dance culture powerful political blocs that opposed her. The tensions were still evident at the dance congresses in Magdeburg (1927), which Wigman
refused to attend when Laban managed to prevent her and her students from performing, in Essen (1928), and in Munich (1930). A successful tour of north German cities in 1919 brought Wigman back to Dresden, where audiences displayed the most gratifying enthusiasm. With another Laban student, the Swiss Berthe Trumpy, she founded a school in that city, acquiring as students young women stirred by her bold dance per-
formances. During the 1920s her performing ensemble expanded from four to eighteen dancers; she produced nearly one hundred solo and group dances, and her school prospered so much that by 1927 she had 360 stu-
dents enrolled at Dresden and more than 1,200 enrolled at “Wigman schools” operated by former students in Berlin, Frankfurt, Chemnitz, Riesa,
Hamburg, Leipzig, Erfurt, Magdeburg, Munich, and Freiburg. In 1931, Hanya Holm went to New York to establish a Wigman school there.
Once she had left Laban and completed her first tour in 1919, Wigman enjoyed a meteoric rise to fame. By 1924 no German dancer was as widely known outside of Germany as she, even though she had yet to make any of the great solo tours of central, eastern, and northern Europe that would later confirm her as the most important artist of modern dance on the continent. In 1921 Hans Brandenburg announced, “She is now herself a phe-
SCHOOLS OF BODILY EXPRESSIVITY 109g
nomenon, and in her style perhaps the greatest the art of dance offers.” She did not merely dance—rather, “with magic-demonic objectivity,” she
made the “absolutes” of dance, “space and movement, visible in themselves ... for [in her] the dance impulse has become cosmic, movement an eternal hieroglyph and rune, the self an encircling center” (HB 202). The same year, Ernst Blass commented rapturously that Wigman was “a wilderness, barbaric and fecund”; her “path leads into the nordic-prehistoric, into wild intertwinings with dragon heads, horses’ skulls. . .. Something nocturnal, black remains the most significant element of her consciousness. In her leaps and wild hurlings, she is often formless and consuming, inaccessibly remote” (34). In 1922 Werner Suhr, comparing her to Thomas Mann and Hans Pfitzner as representative of a “classic” German artist, explained that “Mary Wigman surrenders in the wildest frenzy to entirely explosive, overflowing movements, her arms fall with power through space, her hands are clenched, her feet stride and glide to the inner pulse, her body trembles— a swirling, unquenchable line!—in a singular, delirious forwards-upwardspush, uninhibited and untamed, for this apparent lawlessness of her dance reveals a higher law of the soul—her dance is a dionysiac festival, sensualspiritual joy, ecstasies of body and brain” (WS 102). Nor was this sort of rhetoric confined to German commentators. In 1924 the Spanish weekly picture magazine La Esfera (11/538, 26 April, 11-12) described Wigman and her students in Dresden from a more classical-Mediterranean perspective: “The last drama of Wigman’s performance . . . possessed something of
the sacred drama of the Passion and of the Suppliants, as well as the Eumenides .. . the divine simplicity of Aeschylus . . . a terrific impression of the chorus of Furies.” By 1929 Wigman had reached a creative impasse with her performance
group, so she disbanded it, returned to a cycle of solo dances entitled Schwingende Landschaft, and collaborated with Albert Talhoff on the largest
and possibly most controversial production of her entire career, the huge multimedia spectacle Totenmal, which premiered at the Munich Dance Congress of 1930. Then she embarked on the first of two grandly acclaimed solo
tours of the United States (1930-1931 and 1931-1932). However, a third (1933) U.S. tour, this one with an ensemble, was not so successful. She resumed creating new choreography for groups with Frauentdnze (1934) and Tanzgesadnge (1935) and participated in the organization of the mass Olympic dances of 1936, but otherwise all of her choreography until after World War II consisted of solos for herself. Her last public performance, of Abschied und Dank, took place in 1942.
In 1930, Wigman sought a respected outsider who could serve on the board of directors for her school and reinforce its credibility with potential
funders. Hanya Holm introduced Wigman to her boyfriend, Hanns Benkert, an executive engineer with the Siemens electric manufacturing
IIO SCHOOLS OF BODILY EXPRESSIVITY
corporation. Not only did Benkert serve on the board, he and Wigman became lovers for over a decade. As a high-level industrial planner, he exerted serious influence among the Nazi elite. Benkert could protect Wig-
man from Nazi distrust of her, but he could not overcome Goebbels’ emphatic distaste for her aesthetic, and by 1942 she found herself alone, without a company, without a school, and without her home in Dresden. After the war she attempted to revive her school in Leipzig, but she sensed
that West Berlin offered a more congenial atmosphere for her art, and there she remained from 1949 until her death, teaching, choreographing opera performances (including The Rite of Spring in 1957), and gradually becoming more remembered than anticipated.
Unlike Laban, Wigman believed that a superior value for dance depended on the ability of dance performances to move audiences, not on a theoretical perspective that transcended dancers and dances. She had no interest in establishing an alternative system for institutionalizing body culture, and pedagogical objectives for her always remained subordinate to the task of discovering and perfecting her own artistic expression. She did not question the spatial contexts designated for dance before World War I, even in such a complicated production as Totenmal; indeed, all her dances fit well on the most conventional municipal stages. They also toured comfortably because Wigman did not favor elaborate scenographic effects, although her powerful dramatic sense entailed a very imaginative use of costumes. But she and Laban did have some beliefs in common. Like her former teacher,
Wigman linked a superior value for dance to a heightened condition of abstraction established through movement, not body type, music, or narrative convention. She shared with Laban an inclination toward mystical signification, but she did not veil her feelings, as he did, in foggy crypticity. Wigman was great because she brought to dance an unprecedented magnitude of tragic feeling. For her, modern dance had to go well beyond the naive expressions of joy, innocence, and decorative idealism the public had come to expect since the heyday of Isadora Duncan: she tied conditions of ecstatic liberation to conditions of heroic sacrifice. The dance art of Anita Berber explored dark and violent regions of feeling, but Berber lacked the capacity or concentration to cultivate a tragic aesthetic, for her sense of dramatic conflict never extended beyond the image of innocence lost or dese-
crated in an inescapably sordid world. Wigman could appropriate the domain of the tragic because her morality was ambiguous. She saw the body
as the site of great, conflicting urges, neither good nor bad but equally redemptive and equally strong: the experience of ecstasy entailed the sacrifice of conventional notions of life, communal unity, and bodily harmony. For her, dance was not a release from death but an exposure of it. As Hedwig Mueller has observed in relation to Ekstatische Tanze (1917), movement toward freedom implied for Wigman a tragic “transformation of the physi-
SCHOOLS OF BODILY EXPRESSIVITY III
cal into the metaphysical,” a heroic condition that achieved its most dramatic signification through the power of bodily movement to represent the immanence of death, “the unity of desire and destruction” (Mary Wigman 186). Movement made us see what was otherwise hidden: namely, that life is 7m death rather than opposed to it. To amplify the tragic expressivity of bodily movement, Wigman linked movement to more concrete significations of feeling than either Dalcroze or Laban had. She moved the center of kinetic energy from the legs, thighs, and hips to the torso, which had the effect of dramatizing a struggle with gravity rather than an ethereal escape from it. Indeed, she often brought the body close to the dancing surface: one could dance while kneeling, sitting, crawling, reclining, or squatting. Arms and hands, she believed, should dance as much as the legs and feet. Much of the “Seraphisches Lied” section of Schwingende Landschaft has the dancer lying on her side with only her right arm and hand (and fingers) moving arabesquely (see also Bach, plate
g). A favorite device of hers was to have one arm reaching, imploring, or summoning while the other arm clung to the body, caressed it, or moved in a contrary direction to indicate energies withheld at the very moment they are released. A similar effect might occur when the dancer crossed her arms over her breasts while advancing toward the spectator but spread out her arms while turning her back to the audience; or both arms might beckon or implore but the hands remain inwardly cupped. She would make much of
rotating the hands from palms straight down to palms straight up—or palms pressed against the air and the audience before her. No one better understood the dramatic potential of exposing the palm or the back of the hand or concealing the hand altogether in the armpit, behind the back, or under the other hand. The hand shifted from being clawlike to featherlike; it swept out from the body, then clenched into a fist; it hovered, then soared or plunged. Sometimes arms and hands burrowed into the belly or breasts,
as if digging out a recalcitrant strength. Wigman also made unusually expressive use of the head, especially the eyes. She frequently danced with her eyes closed or half-closed, then opened them suddenly, briefly, in
a deep stare generally cast to her right or left (rather than forward) and away from the direction in which she moved, as if the moving body were drawn to what it could not see rather than to what it did. Wigman (1929): “The dancer’s glance is a visionary gazing. ... The eye is the focal point of the dance event” (“Der Tanzer,” 12-13). She liked having the head at an odd tilt, with the chin up, not vertically perpendicular to the ground, as in ballet. She did not neglect the feet and legs. She loved slow arcing, gliding steps, which she might integrate with slow march steps on tiptoes while the rest of the body remained statuesquely poised. Nearly always barefoot, the dancer
very often signified both caution and boldness by having one foot solidly
II2 SCHOOLS OF BODILY EXPRESSIVITY
planted on the sole and the other on tiptoe, moving in this fashion by shifting the solid foot to the tiptoe position with each step. Wigman was fond of
having the dancer advance toward the spectator in small steps, on tiptoe usually, with each step directly in front of the previous and with the body dipping on the step. She liked to bend and coil the body and seems to have appreciated curvature as much as angularity, but she avoided the balletic
tendency to straighten out or elongate the body. Her dancers shifted abruptly from small, stalking steps to lunging strides and glides. Wigman also made dramatic use of sways, teeters, and tremblings, especially in relation to rhythms of inhalation and exhalation. Although she tended to favor slow, groping, or sometimes languid tempos, the dancer constantly surprised the spectator by shifting rhythms within movements, so that even the steadiest configuration of movement contained within it unexpected discharges of energy. Wigman was a master of stillness and the pause. In the first part of Hexentanz IT (1926), for example, the dancer crouches on the floor, head sunk between her knees, in stillness; suddenly an arm shoots straight up, then down; the head rears up and stares, immobile; then the whole body rocks from side to side before the head sinks again between the
knees—pause!—then one foot stamps, then the other; then in a great, cyclonic whirl, the dancer spins around stamping and stops. Movement was unstable, unpredictable, as if the body coiled within it circulating springs of “convulsion,” as some commentators put it. Death manifested itself partly through degrees of stillness, languor, gravitational pull, inclination to the ground. Wigman believed that dance must free itself from music to establish its unique expressive power. Her first full-length concert of dances, in 1914,
contained no musical accompaniment at all, and she produced several other unaccompanied dance cycles, including Ekstatische Tanze and Die Feier
(1921). Thereafter she integrated silent dances into larger structures involving accompaniments. Like many other dancers of the era, Wigman preferred an orchestra of percussion instruments—drums, gongs, and cymbals, usually handled by a single player—and all the sound composed specif-
ically for her dances until 1939 was written for percussion instruments by Klaus Pringsheim, Willi Goetze, and Hanns Hasting, the last two being her resident music directors from, respectively, 1923 to 1929 and 1929 to 1939. By employing percussive sound, Wigman stripped music of its power to destroy or weaken visual perception of movement and at the same time showed the authority of movement to provoke emphatic auditory response
to it, for the percussion followed the dancer rather than the other way around. She did produce some dances to conventional romantic music (Bizet, Granados, Dvorak, Saint-Saens, and especially Liszt), but modernist
developments in music apparently had little impact on her perception of either the body or movement.
SCHOOLS OF BODILY EXPRESSIVITY 113
In costumes, she persistently displayed a taste for archaism and exoti-
cism. She swathed herself in flowing capes, mantels, and shawls; she delighted in bizarre hats and headpieces, austere hoods and cowls. She mostly performed in long dresses of shiny gold or a strong monotonic color,
but she seldom appeared in black (the “Schicksalslied” section of Tanzgesdnge [1935] and Niobe [1942] are interesting exceptions), and she seemed much more hesitant to bare her legs than her arms, although her legs were quite as beautiful. She liked occasionally to appear in silky, luxuriously patterned Oriental gowns for grotesque-macabre pieces (Hexentanz IT) or more melancholy works (Szenen aus einem Tanzdrama {1924], Tanz der
Brunhild [1942]). In Tanzmarchen (1925) she experimented with a bizarre intermingling of clownlike, or zanni, costumes: extravagantly exaggerated skirts, gold wigs, and romantic dresses. Eerie masks appeared on dancers in Totentanz (1926), Hexentanz II, and Totenmal, for these were instances, she explained, when the “formal transformation of the dancer demands of the dancer an effacement of the personal in favor of the typical and the intensification of the typical to the superpersonal” (HM 131). In Totenmal, Wigman was the only figure to appear without a mask; all the other dancers, large male and female speech-movement choirs, wore, as in Totentanz, masks bearing practically the same ominous expression. All the costumes for her dances strongly evoked a medieval or biblical atmosphere, and she never employed costumes that clearly situated the dance within the present. Yet images of her dances always seem modern, for it was the movement, the
positioning of bodies, that placed the image within the context of modernism. With the body veiled in archaic costumes, its movement became more visible but also more abstract; and, of course, abstraction was the most pervasive sign of modernity (Figures 29-31). Wigman introduced further abstraction into the structure of her dances.
She did not produce a program of discrete dances designed to show the diversity of her technique and expressiveness; she produced cycles of dances that explored in depth a particular emotional state, metaphor, or allegorical vision. Thus, Ekstatische Tdnze was a cycle of six dances: “The Nun,” “The Madonna,” “Idolatry,” “Sacrifice,” “The Dervish,” and “Temple Dance.” Die steben Tanze des Lebens contained dances of “Longing,” “Love,” “Desire,” “Sorrow,” “The Demon,” “Death,” and “Life,” whereas Szenen aus einem Tanzdrama entailed “Summoning,” “Wandering,” “Circle,” “Triangle,” “Chaos,” “Change,” “Vision,” “Encounter,” and “Greeting.” Opfer (1931) comprised “Swordsong,” “Sun Dance,” “Death Call,” “Earth Dance,” and “Lamentation.” In Die sieben Tanze des Lebens, she impersonated a single character who moved expressionistically through different phases of life, but in other cycles she incarnated a powerful feminine spirit that resisted confinement within the notion of “character.” One may say that these incarnations were simply different, archetypal aspects of her personality—but
Il SCHOOLS OF BODILY EXPRESSIVITY
the perception remains that she built narrative unity out of formal abstractions of emotions rather than out of psychologically motivated logic. Her narrative sense was more musical than literary; emotions generated distinct movements and actions, regardless of their context in a particular character or body. Dance cycles therefore became structured around dramatic contrasts between light and dark dances, between quick and slow, grotesque and monumental, cool and warm, lyrical and geometric, and various combinations therein. By exposing abstract relations between mood and movement and by freeing the body from the conventions of characterization,
Wigman helped push dance into the realm of montage sequencing of action, which defined much of modernist film and literature of the 1920s. She was by no means alone among dancers in pursuing this strategy. In her group dances, she applied on a larger scale the devices with which she had expanded the expressivity of the dancing body. Her perception of group and community was more complex than Laban’s, for although she liked to press bodies together in polyrhythmic, tangled clumps, as he did, she was much more imaginative in developing dynamic spaces between bod-
ies. She allowed the group to cover a larger portion of the performing space, and she displayed a strong sense of the group’s spreading out, encircling, and converging on the solo dancer (inevitably Wigman herself): she saw communal movement as a dynamic force that explodes and implodes
around the magnetic ambitions of a leader. As Manning has repeatedly observed, Wigman revealed considerable ambivalence about the relation between group and leader. Dancers often disclosed greater individuality or expressivity within the group than when they briefly stepped outside of it for a solo, a suggestion of tension between individual and community. Yet the leader rarely came out of the group, was always identifiable within it, and was never seriously challenged or confused with anyone else for the role. In Frauentanze (1934) and Tanzgesdnge (1935), Wigman made elegant, monumental use of abstract geometric group symmetry, with spacious, cinemascopic choir movements built around uniform gestures of prayer, invocation, imploration, and offering. But in some of her group dances, perhaps especially Im Zeichen des Dunklen (192'7), the dancers seemed unaware of each other, were wrapped up within themselves, moving to different rhythms, gazing in different directions or even keeping their eyes closed, yet they remained within a group insofar as they followed the leader. Although Harald Kreutzberg and Max Terpis studied briefly under Wig-
man (and she had several other male students), all of her performing groups contained only female dancers. Only after the war, when she began working with opera companies, did she really start thinking about the male dancer, most notably in The Rite of Spring (1957). Apparently she experienced some sort of intense anxiety toward the male body; in any case, she felt no inclination to explore the expressivity peculiar to it. In Tanzmarchen,
SCHOOLS OF BODILY EXPRESSIVITY Irs women impersonated explicitly male figures, and in Totenmal, which memo-
rialized soldiers killed in the war, the members of the male choir were all zombielike figures of the dead, and the only male dancer, masked, was Death.
As a teacher, Wigman exerted tremendous influence in the classroom. But she was not much of a theorist, and her authority outside of the classroom depended on her success in dance performance. Her great appeal for students lay in her promise to maximize the individuality of the student through dance: “The longing for self-expression so characteristic of our age is driving today’s girls to seek satisfaction through dancing” (MWB 104). However, this attitude had significant limitations. Her first, and possibly best, ensemble broke up in 1924 because Berthe Trimpy, Yvonne Georgi, and Gret Palucca had developed such strong personalities that they had to leave in quite separate directions to fulfill their ambitions. Moreover, the improvisational “technique” Wigman used to accommodate diversity of per-
sonalities was difficult to transfer outside of the cultic atmosphere in the Dresden studio, with its gold and red walls and with Wigman, swathed in luxurious gowns, veiled in cigarette smoke, gazing with hawklike intensity and presiding on a throne in the corner as a mysterious priestess. Trumpy’s effort to establish a Wigmanesque pedagogy in Berlin encouraged Rudolf Lammel to compare the discipline and accomplishments of her faculty and students unfavorably with those of the Estas school in Cologne. Occasionally Wigman published brief articles in dance journals. In these pieces her language remained consistently metaphorical and polemical rather than analytical. Her views on dance composition (1925) and dance curriculum (Deutsche Tanzkunst [1935]) were even cloudier than Laban’s at their most cryptic: “Whether the dancer moves as a soloist in his own creations, or plays his instrument in the orchestra of moving bodies, he always is, above all, servant to a work of art. This is the only and eternal law under which the dancer lives his entire life” (MWB 129). Yet language, both writ-
ten and spoken, was very important to her in creating her dances and her cult. She wrote out scenarios for her dances and incorporated into the manuscripts sketches, marginal comments, and cryptic movement notations, sometimes employing different colored inks and pencils. She was fond of drawing pictures that included words in the imagery; for example, a sketch she did of New York City in 1931 consisted entirely, in collage fashion, of words from signs she saw in the streets of the city (HM 173-175). She kept
extensive diaries and was definitely at her best when she wrote autobiographically, when she connected attitudes toward dance to specific events in her life. Apparently she “saw” the dances and dance cult she created through a process of inscription. The image of language gave her the image of movement (KT). In rehearsal and in the classroom, she was not content to watch and comment nor even to interpret the performance by
116 SCHOOLS OF BODILY EXPRESSIVITY
her commentary; she liked to talk to the dancers while they danced, telling them, in highly metaphorical language, not what movements to make but what feelings they should release, what effects they should produce. The urge to speak compelled her to enter the dance, but she would shout out
isolated words and phrases rather than complex or even complete sentences (film documentation in Snyder). But even though her own language to explain the meaning or theory of dance remained enshrouded “in the
sign of darkness,” so to speak, never reaching much beyond stern and somber exhortation, she differed strongly from her teacher, Laban, in supposing that the real “language of dance” was not an elaborate system operating independently of dancers or dances but a physicalization, a supreme materialization or extension of language as the controlling phenomenon constructing difference, identity, personality. But the key to her system was not her attitude toward language; it was the idea that the student does not ultimately succeed until she confidently differs from her teacher. LOHELAND
Laban and Wigman represented the most dramatic and politicized antipodes regarding the conditions for establishing the value and modernity of Ausdruckstanz. But Wigman obviously understood that although dance performances may determine the value of dance, they hardly established a life in dance. Dance performances increasingly depended more on schools than on audiences, and by 1925 being a modern dancer pervasively entailed teaching dance. Before 1925 a rather large number of dancers pursued entirely artistic careers on the stage, but by the middle of the decade very few enjoyed such an exclusive focus of their energies. The economics of performance discouraged full-time dancing careers. The German “dance frenzy” actually signified a situation in which the supply of dancers quickly
exceeded the demand for dance performance. As Laban realized, audiences for dance performance, as for opera, would expand only through a large-scale process of education and theoretical indoctrination in which masses of people learned to appreciate dance without feeling the desire to do it. However, the education of audiences occurred much more slowly than the education of dancers, not so much because of weak critical institutions within cultural media but because educational institutions, including dance schools, stressed participation in dance rather than serious analytic discourse on the meaning of it all. Dancers relied excessively on a mystical rhetoric to explain themselves—ecstatic appeals to good health, national revitalization, or cultured idealism—which, frankly, even quite mediocre performers could appropriate. When the “voice” of dance begins to sound everywhere the same, audiences become distrustful and apply ever greater pressure on dancers to supersede all thresholds of expectation—but
SCHOOLS OF BODILY EXPRESSIVITY 117
fewer and fewer can muster the imagination to meet these rising expectations. Thus, the desire to dance continues to grow, but the desire to watch dance remains static. Both Laban and Wigman intuitively grasped that language constituted the mysterious core of a deeper understanding of dance, but they themselves lacked the language to unravel it. It was easier to recruit students, whose understanding of dance was intuitive rather than theoretical, than viewers, who depended on a complex aesthetic rationale to sustain their
interest. Schools flourished everywhere. Berlin alone had 151 dance schools in 1929 (Freund 83-84), and by 1933 Germany had 5,122 professional dancers, over 30 percent of whom lived in Berlin (MS 33). But the number of dance performances scarcely matched the number of schools. To expand enrollments, dance schools formed closer alliances with gymnastics, but a practical result of this strategy was that by the late 1920s dancers began to look more and more alike: gymnastics had the effect of conventionalizing the image of dance, freedom, modernity, ecstasy. The strangest, most expressionistic, and most experimental period of German modern dance came between 1918 and 1925; the decade between 1925 and 1935 was hardly dull, but a greater sense of disappointment seemed to afflict it. By 1929 the market for schools had obviously reached the saturation point, and the following year, when another severe economic crisis began to grip the nation, modern dance culture launched a determined campaign to gain control of the subsidized opera ballet companies throughout the land, with the schools suddenly embracing ballet technique (HK 30-32). However, it is not clear whether other strategies would have yielded greater success, partly because the dominant objective of dance was not sharply in focus. Was it to produce serious works of art or to signify a new, redemptive mode of living? These objectives were incompatible, for one cannot produce serious art without taking risks that are often painful and unhealthy. Moreover, the dance world lacked the knowledge—the science, one might say—to identify the difference between the desire to dance and the desire to see dance. The Loheland school in Fulda presented a curious example of the antiart, dance-as-life cult. Hedwig von Rohden and Louise Langgaard founded the school in 1912. In 1910 they were students in Berlin of the mysterious Hedwig Kallmeyer, herself a student of the Delsarte technique taught by the American Genevieve Stebbins. Rohden-Langgaard, as they were known, also incorporated Mensendieck ideas into their school, whose students were exclusively female. Loheland integrated gymnastic dance into
a craft-centered, cultic lifestyle: daily performance of aesthetic bodily movement was part of a peculiar moral education that included gardening, physical labor, pottery, weaving, cooking, nudism, drawing, singing,
agricultural activity, and household management. In the early 1920s,
118 SCHOOLS OF BODILY EXPRESSIVITY
Rohden-Langgaard began to introduce the anthroposophical ideas of Rudolf Steiner. Hans Brandenburg remarked that both faculty and students conveyed an “image of cloistered austerity and purity” (HB 135), and Fritz Giese observed a pronounced “anti-masculinist” attitude (FGK 115) (Figure 32). Gymnastik (3/5—-6, 1928, 15-21) published a letter from a Loheland student, Ita Rost, who concluded, “Today I know I see the beginning of the path which earlier had led us to the construction of a high and powerful culture. ‘Movement’ ts the first step on this path” (21). But the study of bodily movement did not lead to an art of bodily performance. The Loheland milieu distrusted the cosmopolitan artificiality of theatre, distanced itself from all professionalism, and denied that serious dance could have anything to do with the expression of eroticism. Few of the Loheland students made dance a vocation (Niddy Impekoven was a major exception), and none of them assumed that dance was rich evidence of a unique personality. Right after the war, Loheland had a small ensemble of dancers, no more than four or five girls, which put on such things as the “silver cult play” Omnia ad majorem Dei gloriam (1920). But by 1924 the school refused to produce anything for the public, although lovely photographs of unnamed Loheland women, some nude, continued to appear in books and journals. Eva-Maria Deinhardt, Bertha Buschor, Emmi Heiner, and Edith Sutor attracted some individual attention in 1921. With A7iel and Legende, the sleek and supple Deinhardt moved as if her arms were feathers
or branches in the breeze, her whole body a glowing “transparent ornament”; Sutor, in Farben and Urasima, preferred broad wavy movements, muscular turns, Amazonic glides, and undulations on bent knees; Buschor, ina
shiny, satiny, dark pajamalike costume, did something called Stromungen using quick, convulsive movements; and Heiner “loved fast round curves” (HFT 106; HB 136). These women soon faded into oblivion, but Loheland continued to prosper as a pious, nature-worshipping community. In 1928, Rohden-Langgaard published Gymnastik, Sport, Schauspiel, which outlined the Loheland principles of bodily movement. Five core modes of action governed the body as an expressive sign: running, leaping, encircling, ball-tossing, and spear-throwing. Liberating and ecstatic experience emerged out of variations on these modes. Deinhardt (Gymnastik, 3/5-6, 1928, 7-12), citing Novalis, asserted that “music sets everything in movement,” but Loheland maintained a strict attitude toward the relation between dance and music: absolutely no percussion sounds and (contradicting Dalcroze) no emphatic submission of the body to the rhythm of the music—melody, not the beat, moved the body. Mozart therefore made the best dance music. Yet in spite of the reactionary atmosphere of this school, Rohden-Langgaard’s book contained images of startling modernity. These were highly abstract diagrams of movement possibilities issuing from the five core actions. The authors used colored pencils to describe the trajecto-
SCHOOLS OF BODILY EXPRESSIVITY IIQ
ries of the movements in a manner that exceeded the level of abstraction in Hedwig Hagemann’s diagrams; nor were these drawings at all cluttered, as were Laban’s sketches. The text hardly explained the diagrams, but they nevertheless gave a powerful image of movement itself (not the body), with emotional values of movement encoded through the color of the pencil,
degree of shading, and thickness or intensity of line. What dance “left behind,” so to speak, was not a more vivid image of the body but a starkly wild (though human) geometric abstraction, a kind of strange, bold writing in space. HELLERAU-LAXENBURG
Although the influence of Dalcrozian rhythmic gymnastics waned considerably during the war, disciples of the Swiss educator did not disappear entirely. In 1915 the building complex at Hellerau came under the management of Christine Baer-Frissell, Ernest Ferand, and Valeria Kratina, advocates of the Dalcrozian approach. But Mensendieck ideas also entered
the curriculum insofar as the school assumed a significant difference between male and female anatomies, which motivated the need for a completely feminine gymnastics. All students at the school were female. The atmosphere was free of the mysticism that pervaded so many other schools, which was not surprising, considering how carefully Dalcroze had planted his method in Gallic rationalism. Hellerau sought to free the female body without exhausting or depleting it. The school therefore condemned gymnastic acrobatics, dance virtuosity, and a focus on the perfection of movement: the female body possessed a different strength than did the male, and one measured it not by feats of acrobatic prowess but by an ability to move truthfully, confidently, and with adroit intelligence. To achieve this objective, Hellerau teachers had to modify Dalcroze’s system to accommodate greater improvisation and greater independence between bodily and musical rhythms. Nevertheless, improvisation at Hellerau was a far stricter matter than with Laban or Wigman.
In 1990, Ilse Losch, a former student, published several examples of Hellerau “improvisations” (31-50), and these show the extent to which music controlled movement and movement unfolded according to an ideal of precision (though not one of “fatiguing” complexity). With the upbeat of a quiet piece of music in 4/4 time, the right leg rises a little, bending slightly at the knee. On the first beat of the bar, the left leg bends somewhat while the right foot, with gentle, intensifying pressure, touches the floor on tiptoe, then sinks onto the full sole, with the right knee bending lightly. On the
second beat the left leg stretches to the knee while the right leg curls upward. On the third beat the right leg performs the gesture as in the first beat but more heavily, with the knee bending lightly. On the final beat the
120 SCHOOLS OF BODILY EXPRESSIVITY
left leg copies what the right leg initiated on the upbeat while the right leg stretches easily to the knee. The second measure of the music repeats these
movements on the left leg, but the dancer never moves from the initial standing position (35). Each measure—indeed, each beat—introduces a new variation. Other exercises mobilize the arms, hands, and other parts of the body, shift rhythms (such as 3/4 to 5/8 to 2/4), and incorporate group interactions between bodies, but Dalcroze’s obsession with synchronizing movement with the beat remains firmly in place.
| Movement in this context was precise without being fatiguing, complex without being oppressively intimidating (for the performer). What made dance fatiguing was not increasingly complex synchronization of movement with the musical rhythm but movement that unfolded against the beat, the body in dialogue with the music rather than in harmony with it. As mentioned previously, this failure to acknowledge tensions between bodily and musical rhythms was a great weakness of the Dalcrozian system and hampered it from producing dances that went beyond the expression of a bright, sunny joy. The system did not establish any serious emotional connection
between music and movement and made it all too easy for a mechanical sterility to dominate the exploration of bodily expressivity. But the detailed pedagogy, the exactness of the lesson plans, and the precisely measurable accomplishments offered by the exercises were quite appealing to some stu-
dents, especially those planning to become teachers. In 1934, HellerauLaxenburg even gave courses in Paris at Studio Corposano under the guidance of a Finn, Maian Pontan, who had directed courses in Vienna, Berlin (at Diem’s school), and Stockholm (AI 16-17). In 1925 the Hellerau school
accepted the invitation of the city of Vienna to relocate to Laxenburg Castle, which was its home until 1938, when the Nazis annexed Austria. Between 1921 and 1924 the outstanding Czech choreographer Jarmilla Kroschlova, who had studied under Dalcroze in Geneva, taught at Hellerau before returning to Prague, where her career blossomed. The connection to Prague eventually proved significant for the fate of the Dalcroze system.
In 1921 another Czech, from Brno, Rosalia Chladek (b. 1905), studied under Kroschlova and became so successful as a dancer, choreographer, and teacher (Basel) that in 1930 Hellerau-Laxenburg appointed her to manage the dance activities of the school, which she did until 1938.
Under Valeria Kratina, the Hellerau performance group had attracted international interest for its German premieres, in 1923, of Bartok’s The Wooden Prince (1916) and Milhaud’s L’Homme et son desir (1921) and, more
important, for its open-air productions (the genre so loved by Dalcroze) in ancient Sicilian ruins in 1925, 1926, and 1927. Chladek continued this tra-
dition by choreographing open-air productions at the Greek Theatre in Syracuse of Euripides’ [phigenia in Aulis (1933) and Sophocles’ Oedipus at Colonus (1936) and Ajax (1939). Her enthusiasm for themes of classical
SCHOOLS OF BODILY EXPRESSIVITY I21I
antiquity extended to her solo choreography for herself in Mythologischen
Suite (1936), with its separate sections devoted to Narcissus, Daphne, Pythia, Penthesilea, and Agave; to her opera choreography for Gluck’s Orfeus und Euridyke (1940); and to the dance suite Apollon und die Amazone
(1940). Like Kratina, Chladek displayed a very international taste in subject matter and music, working as comfortably with modern music (Stravinsky, Malipiero, Medtner) as with Handel or Dvorak. As a soloist, she traveled widely throughout Europe and as far as Indonesia in 1939. Indeed, a peculiarity of the Hellerau-Laxenburg school was its cultivation of dance as a sign of both internationality and modernity. Probably no other dancer after 1930 received as many offers to appear outside her homeland (both Germany and Austria) as Rosalia Chladek, but she did not have strong appeal for German audiences, even before the Nazi takeover. Wherever it operated in Europe, the Dalcroze system appeared as a foreign doctrine, and (like Dalcroze himself) one became a successful product of the doctrine by accepting the identity of a stranger to it and, quite often, to one’s audiences. Certainly this was the case with Chladek, coming as she did from Czechoslovakia. But as director of dance activities at Laxenburg, she succeeded in opening up the doctrine to the more expressive and improvisational features of “the free dance,” as she firmly preferred to call Ausdruckstanz (Welziel 19, 22; Klingenbeck 15-16). And she brought male students into the lay course in Vienna. In 1931 she choreographed a large-scale, open-air dance spectacle for the Vienna Festwoche in the Rathausplatz, performed before 15,000
spectators. [wenty-five women, ten “youths” (performed by female students), and five men danced to the music of Bizet’s L’Arlesienne Suites (1872),
yet the effect was neither Gallic nor Teutonic nor even socialistic but peculiarly “European.” The male dancers, clad in rust-brown tunics, wielded long staffs; the female group, in flowing orange gowns, carried gold shields; and the youths wore red tunics. Chladek made dramatic use of the huge space:
the three groups developed a monumental counterpoint on different planes and at great distances from each other, then converged, employing vigorous swinging, rotating, or lunging movements—movement-countermovement in parallel lines, canon-countercanon, diagonal-counterdiagonal, round-counterround, concentric circles coiling centripedally, concentric circles spreading centrifugally. In the adagio section, the women sat in a half-circle and danced entirely with their upper bodies, moving the shields in “lyrical,” undulating fashion so that the sunlight flashed off them; meanwhile the men, deep in the background, made hoeing, threshing movements with the staffs. In the carillon section, the youths usurped shields from the women while the men advanced employing scything movements. Then the soloist (Chladek herself) appeared, in a red and gold cloak, and her swirling dance brought all the groups together into a great whirlpool of
[22 SCHOOLS OF BODILY EXPRESSIVITY
“dionysiac-ecstatic vibration,” concluding what Ferand suggested “not unfairly could bear the name of ‘Eleusinian Festival’” (Alexander 4951). Yet the piece was actually an elaborate application of the same principle governing the two-bar exercise described above—left leg—right leg;
movement-countermovement;, diagonal-antidiagonal; clockwise circle within counterclockwise circle; male group—female group—with all movements exactly synchronized with all dynamics of the music (accelerando, crescendo, ostinato, and so forth). The realization of a unified, ecstatic community that transcended divisive pressures of sexual difference depended on large-scale deployment of the symmetricality-synchronicity principle introduced in the rudimentary exercise. During the 1930s Chladek devoted much of her time to performing solo
dances. In these she displayed her preference not only for stark, monumental movement but also for abstract theatrical props such as a staff, a great disk, a hoop, or a cape, as well as glamorous period costumes and archaic garments (Tanz mit Stab [1930]; Jeanne d’Arc [193.4]). Her body was
powerfully muscled, like an athlete’s, and she sought bold gestures that heightened its muscularity (Penthesilea); but she contrasted this quality with a flowing, exaggerated femininity, as in Die Kamelliendame (1938), in which she swooned and soared in a luxurious white romantic dress. Unlike Wigman, Chladek enjoyed displaying her powerful legs and introducing mysteriously androgynous touches (Narcissus; Luzifer [1938]; Michael [1938]). After World War II, she continued busily on the international dance scene,
receiving commissions, honors, appointments, and students well into the
1990s. “Strength is the source of movement,” she remarked in 1935 (Alexander 95). But Dalcroze himself worked from almost the reverse perspective, that movement is the source of strength. Thus, although Chladek showed the power of the Dalcroze system to produce a compelling artist,
she was not quite as faithful to her teacher as were the great majority of his , disciples, whose mission was to strengthen ordinary bodies easily fatigued by the rhythms of the modern world.
After World War I, Dalcroze disciples worked primarily in the public school system, where they often faced difficulties no less great than those afflicting dance artists. The Dalcroze Bund constantly struggled against bureaucratic inertia and the pervasive assumption that rhythmic gymnastics was not as practical as the study of the arts and sciences. An important figure in the rhythmic gymnastics movement, Elfriede Feudel (1881-1966), studied under Dalcroze at Hellerau and taught at the Dortmund Conservatory from 1927-1935 (Peter-Fuhr 26-27). Her Rhythmik: Theorie und Praxis der kérperlich-musikalischen Erziehung (1926) was an impressive collection of essays that coolly addressed the chief criticisms and misperceptions of rhyth-
mic gymnastics, put Dalcroze’s method into a historical perspective, clarified its aims, differentiated it from other approaches to bodily education,
SCHOOLS OF BODILY EXPRESSIVITY I23
and provided (as usual) detailed examples of “lead and follow’-type exercises. She denied that, because it did not wallow in the undisciplined, irrational pathos of Ausdruckstanz, rhythmic gymnastics was too intellectual; more surprising, she criticized the Mensendieck system for being antierotic (62), and Hedwig Nottebohm attacked arch-rival Rudolf Bode for promoting an idea of rhythm that was hopelessly vague (140). This shift from a defensive to an offensive position somewhat strengthened rhythmic gymnastics in Germany. A school opened in 1910 by Otto Blensdorf (18711947) in Elberfeldt (Wuppertal) and later moved to Jena (1928) reemerged as a prominent center for rhythmic gymnastic teaching when Blensdorf’s daughter Charlotte (already a lecturer at the Conservatory in Malmo, Sweden) received an appointment from the university to provide instruction in Dalcrozian thinking (Alexander). Students from this school, as well as from Hellerau-Laxenburg and a school in Essen run by Dalcroze student Dore Jacobs (1894-1979), revitalized hope for making rhythmic gymnastics the basis for a national program of physical education. The Nazis, however, were
hostile to rhythmic gymnastics, which furthermore attracted many Jewish women, and they put their faith in Bode’s program. The political ramifications of the Dalcroze system become more apparent if we look at the situation of rhythmic gymnastics in Czechoslovakia. Kroschlova had returned to Prague in 1924 because she realized that rhythmic gymnastics “did not lead to dance expression” (EST 135), but the innovative dance work she did in her native city nevertheless seemed to validate the attitude toward the body implanted in her by Dalcroze. Another student of Dalcroze, Anna Dubska, had managed a popular school for rhythmic gymnastics since 1912, and through her the notion emerged persuasively that the Dalcroze system demonstrated its credibility not through beautiful dances but through behavioral changes in individuals. In 1913 the powerful Sokol (Falcon) Organization of physical educators and bureaucrats, which had close ties to the labor movement, began to absorb Dalcrozian ideas into a large-scale plan to create a strong body culture in Czechoslovakia. Under the leadership of Hanna Burgerova-Dubova, Sokol’s physical education program expanded ambitiously, propelled by Dalcrozian objec-
tives but also by the ideas of people such as Klages, Bacher, Bode, Mensendieck, and Duncan, as well as native Czechs such as Karel Pospisel and Augustin Ocenasek (EST 142-144; Sokol 33-38). The Sokol body culture program did not define itself entirely in terms of a response to inter-
nal, uniquely national pressures, as was the habit in Germany; it treated body culture as an international network of ideas that produced an embodiment of power and identity.
In 1929 Sokol collaborated with the Czech government to produce an immense book, Zaklady rytmického telocuiku sokolského, which presented an
official, state-sanctioned method for the rhythmic gymnastic education of
I24 SCHOOLS OF BODILY EXPRESSIVITY
girls and young women. The book was designed more for (public school) teachers than for students. Professor Karel Weigner announced that men and women have quite different bodily constitutions that respond to differ-
ent principles of rhythm: “[M]Jen tend toward a katabolic principle of courage, inventiveness, and change; women tend toward an anabolic principle of conservatism, continuity, and patience, with the most difficult and noble goal of maternity” (vil). But in spite of this somewhat limited view of sexual difference and the fact that all the authors were men, the book was an amazing and certainly luxurious production, testifying to a spectacularly deep concern with how to manage the modern female body. After several chapters of scholarly, pretty solid theoretical-historical overview, the book presented a vast treatise on rhythmic gymnastic practice, replete with more than four hundred exercises, each one described in detail regarding musical rhythm, bodily movement, and function through the use of stick figures, drawings, musical notations, and more abstract diagrams, charts, and tables
(Figure 33). The book also contained some wonderful photographs of exercising students, open-air games, and theatrical dance productions and even had a kind of appendix of advertisements for Prague businesses. No German publication on bodily movement was ever as systematic, comprehensive, detailed, and precise as the Zaklady; no German ideology, not even Laban’s Kinetographie, showed so clearly the extraordinary range of possible human movements.
Of course, the book suffered from the usual objection to rhythmic gymnastics: it did not explain the emotional or expressive significance of all these movements. Instructors assumed that every exercise was valuable because it led to a healthier body, regardless of whether it was aestheti-
cally interesting. But Germans (and not only Germans) strongly resisted } this sort of lucid, systematic view of bodily education, partly because the state believed it was too politically risky to identify itself decisively with a particular concept of body culture and partly because Germans tended to believe that the expressive and liberating power of the body remained enshrouded in irrationality, well beyond the control of measurable, external musical rhythms. The Germans had grasped that a healthy body was not necessarily synonymous with an ecstatic body, and that led to greater
darkness in the world of German body culture and to a far more complex dance culture than existed elsewhere. The Czechs liked formalistic analyses of aesthetic phenomena because they tended to believe that formalistic “objectivity” was the key to resolving political conflicts. This perspective favored the development in the 1930s of the great Prague structuralism school of literary and theatrical semiotics guided by such figures as Otakar Zich, Jan Mukarovsky, and Jindrich Honzl and exemplified fur-
ther in the wide-ranging critical commentaries of Karel Teige (19001951) and in Irena Lexova’s enchanting semiotics of Ancient Egyptian
SCHOOLS OF BODILY EXPRESSIVITY 125
Dances (1935).' In Germany, however, formalism emerged as a source of political conflict because of its innate power to estrange or render foreign even the most familiar significations. Yet Germany was still the chief exporter of the Dalcroze model, even after it almost ceased to exist in Germany in the 1930s, because so many foreign
students had studied there. An excellent example is the Finnish dancer Bertta Reiho, who published Rytmillinen liktinta (1948), a textbook with numerous stunning photographs, for teachers of female rhythmic gymnastics. Though not nearly as ambitious as the Zdklady, it was nevertheless a beautiful elucidation of the Dalcroze technique—though, not surprisingly, it did not mention either him or a German context. But in the 1930s Reiho was a student of the Finnish expressionist dancer Maggie Gripenberg, who had studied under Dalcroze around 1911 (Hallstrom 200). RUDOLF BODE
By the end of World War I, Dalcroze’s definition of rhythm appeared too narrow and mathematical to satisfy the German appetite for a more radical, ecstatic, and transformative definition of rhythm that yielded a distinctly “German” expression of modernity. But a German definition of rhythm was not the same thing as a German way of moving the body, nor was it to be
identified with some peculiarly German physiognomy. Germanness revealed itself in the origin and formation of the definition, not in the bodies that applied or appropriated the definition. In an interesting article for Der Leib (2/2, January 1921, 34-53), Fritz Klatt proposed general categories
of creative rhythms associated with the body rather than with music, machines, or dance. Blood pulse and heartbeat constituted the primal sources of rhythm: “Everything called love, knowledge, death, everything which reflects the individuality of the individual human, everything that creates unities and eventually demands the sacrifice of the self, has its sensually traceable basis, its reality, in the depths of the human-bonding bloodstream” (35-36). The breath pulse, however, connected bodily rhythm to the will, because the pace of breathing, the relation between inhalation and
exhalation, between magnitudes and urgencies of breath, resulted from specific conditions of emotion and consciousness. The creative rhythm of the day evolved out of the microrhythms of blood and breath insofar as it conformed to a complex pattern of alternation between movement and pause, beat and rest. The rhythm of months and years, deadlines and holidays, seasons and ages was but a macrocosmic pulse resulting from the great 1. For more information about the captivating achievements of Czech body culture and aesthetic performance in the 1920s and 30s, see Burian, O nové divadlo 1930-1940; Obst and Scher]; Teige; Kroschlova 47—g0; Vavra 17~—27; Vodicka.
126 SCHOOLS OF BODILY EXPRESSIVITY
bonding power of the blood pulse. Of course, a Dalcrozian might contend
that music itself was both the abstract and material revelation of drive rhythms ultimately originating in the heartbeat, but by detaching his argument from any discussion of music, Klatt implied that music did not make
people more aware of the great unifying yet individuating power of the blood pulse. Active in the youth movement and in public school teaching, Klatt believed that instructors could create greater rhythmic awareness, at least among the young, by restructuring the rhythm of the school day and year, Changing the durations of instructional periods, the relations between play and contemplation, the divisions between outdoor and indoor knowledge, and so forth (see Die Tat, 14/7, October 1922, 621-622). An equally grandiose concept of rhythm came from Artur Jacobs (Die Tat,
14/9, December 1922, 641-664), who proposed that the formation of a redemptive proletarian culture depended on “renewal through rhythm.” Much less precisely or concisely than Karl Bucher, Jacobs presented the conventional Marxist argument that “the great misery of the worker is not that he receives too little reward, that things go badly externally for him, but that he must live soullessly and without dignity, that he is merely a mechanical
beast of labor, that he must produce in stultifying compulsion completely mechanical things, to which he has no connection and whose meaning he does not understand”—that, in short, the worker lived utterly alienated from a despiritualized (entseelte) world: “Our bodies are as strange to us as a still undiscovered land” (655). To renew the physical dignity of the modern worker, it was necessary to perceive in eroticism the great source of love for
materials and forms, which together produced a culture that bestowed a more authentic value on labor. By eroticism, Jacobs did not mean anything connected to sexual drives; “on the contrary,” he meant more general actions of release, giving, expenditure, and self-offering (653). A new notion of bodily rhythm was essential in cultivating the primal strength (UrKraft) of Eros. Jacobs acknowledged that rhythm was an image of time but contended that its form was infinite and beyond empirical measurement, for painting, architecture, theatre, and poetry possessed as much rhythm as music or dance did: “Rhythm stands over nature the way reason stands over nature” (662). He regarded rhythm as a deeply irrational phenomenon, for it did not function according to any logic of causality: erotic rhythm was an end in itself. However, the renewal of the worker through a new concept of
bodily rhythm was not exactly synonymous with greater participation in games, sports, athletics, gymnastics, or dance, for these refined the mechanization of life without overcoming it (656). But in spite of his appeal to restore the authority of forms, Jacobs himself did not provide a concrete image of the proletarian body culture other than to echo Klatt in proposing, vaguely, a “complete transformation of the entire contemporary school life” (663). He simply announced the need for a “Copernican turn” in edu-
SCHOOLS OF BODILY EXPRESSIVITY 127
cation. With this metaphor, the implication emerged, albeit cryptically, that the rhythm of Eros remained inarticulately embedded in the form of revolution as simultaneously a physical and a historical phenomenon.
In the next issue of Die Tat (14/10, January 1923, 755-764), Wilhelm Hagen provided a much clearer image of the definitions of rhythm proposed by Klatt and Jacobs. He supposed that the answer to the question of what is the best school for gymnastics depended on the relation between rhythm and bodily education. He denied that rhythm referred to patterns of repetition, regularity, or automaticity. The study of music theory revealed that the source of rhythm was movement, not the other way around. Thus, the study of bodily movement depended not on musical rhythms but on motives for action, relations between will and object. Rhythm referred to dynamic structural relations between being and becoming. However, Hagen
contended that men and women experience different essential rhythms and therefore require different modes of bodily education. He claimed that a woman feels she bears a weight, whereas a man feels he lifts a weight; the woman treats action as a state of being, whereas the man treats it as a state of becoming. Dance could well represent the female state but not the male,
because for the male, will and object never merge to produce a state of being. For woman, “dance is always a transfiguration of being, not doing. ... Man must find the bridge to sport. As a dancer he remains a neurotic” (764).
The work of Rudolf Bode, Hagen declared, exhibited an attitude toward rhythm firmly grounded in the body and movement, not in music, although he expressed pronounced reservations about Bode’s ability or willingness to maintain the principle of sexual difference in movement education. Bode (1881-1971) was a student of Dalcroze at Hellerau in 1911-1912.
By 1913, when he established his own school in Munich, Bode opposed the methods of his teacher and embarked on a pedagogy that developed bodily rhythms independently of music. In Der Rhythmus und seine Bedeutung fur die korperliche Erziehung (1920), he introduced a “total” concept of rhythm similar to that of Klatt and Jacobs. A major influence was Klages, who asserted that excessive rationality or intellectual analysis was a source of “arhythm,” or unnatural, strained, discordant, stifled movement. “In the rationalizing of instincts in our schools, colleges included, lies the final reason for the inner and outer breakdown of Germany” (RB 21). Bode’s most popular work, Ausdrucksgymnasttk (1925), enjoyed considerable appeal
in its English translation of 1931. His school in Munich attracted many students, even though Bode had no ambition to produce dancers, athletes, performances, or anything understood as an artwork. For Hagen, Bode seemed to offer a “masculine” approach to movement education that
did not rely on dance or dancelike deployments of the body to justify itself; however, the great majority of Bode’s students were women. His antiintellectualism made him susceptible to National Socialism, and during the
128 SCHOOLS OF BODILY EXPRESSIVITY
1920s he participated in party activities. In 1933 he became director of the Korperbildung und Tanz division of the Kampfbund fur Deutsche Kultur
and director of the gymnastic and dance section of the Reichsverband Deutscher Turn-, Sport- und Gymnastiklehrer im NS-Lehrerbund. In these capacities he attempted to undermine the rival Deutscher Chorsangerverband und Tanzerbund (established in 1909), which in 1933 was under the leadership of a socialist, the Hamburg ballet mistress Olga Brandt-Knack, a former student of Rudolf Laban. Bode regarded Laban as his most pernicious rival, but Goebbels, grasping Bode’s limited understanding of dance, decided not to put the Tanzerbund under his control—instead, he changed its mission statement and replaced its administration (MS 116). By this time, though, Bode had firmly established the identity of a distinctly “German” notion of rhythm and bodily movement. According to Bode, a “principle of totality” must govern perception of the body and its expressivity. He disapproved of Mensendieck-type efforts to analyze movement in relation to isolated parts of the body, and, of course, he denounced the Dalcroze system of synchronizing movement to musical rhythms. He also expressed skepticism concerning the use of gymnastic apparati such as parallel bars and weights, for these emphasized movement as a struggle against forces external to the body, whereas expression gymnastics was always a struggle of the body against forces internal to it. Bode did not want his method associated with sport competition; rather, the aim of expression gymnastics was to develop bodily movements derived from rhythms in nature, with the view of making the body expressive in the performance of everyday actions. However, a serious defect of Bode’s theoriz-
ing lay in his failure to clarify what he meant by natural, or “organic,” rhythms. Moreover, the gymnastic body offered “no expression of definite feelings like sorrow or joy, or patternlike forms for any feeling; all this is the task of a school of dramatics” (RB 46). What the body expressed entirely was a heightened, “ethical” sense of “vitality” and a triumphant struggle against the mental and mechanical “opposing powers inimical to life” (25). Bode
built an exercise program around “natural” movements, “the simplest movements like walking, striding, swinging, pushing, or beating of the arms, bending of the body” (47). Yet nearly all the exercises in Ausdrucksgymnastik kept the body in a standing position: different parts of the body could move in swinging, flinging, beating, bending, raising, dropping, turning, rolling, pushing, or stretching motions without the body’s going anywhere. In spite of the book’s focus on single bodies—a focus reinforced by pho-
tographs depicting solitary male and female models performing all of the eighty or so exercises—Bode earned respect for his skillful management of group exercises, and he obviously believed that the individual body devel- oped its vitality more quickly through immersion in a controlled communal rhythm. But undated (ca. 1927) photographs by Gerhard Riebicke of stu-
SCHOOLS OF BODILY EXPRESSIVITY I29
dent activities in Munich deposited in the Joan Erikson Archive of the Har-
vard Theatre Collection strongly suggest that Bode did not build group exercises around inieraction between bodies. In this respect, his method dif-
fered significantly from so-called “Swedish gymnastics,” especially the method of Nils Bukh, which stressed variations in movement within an exer-
cising group and therefore required an individual body to maintain con-
stant awareness of other bodies; the movement of each contributed uniquely to an overall group design that continually changed in relation to a controlling gymnastic objective (Figure 34). Swedish gymnastics was not dance, yet it did invest group exercises and communal rhythm with a strong subsidiary aesthetic effect. But Bode presumably felt that Swedish gymnastics was too rational for a German mass audience—it was exercise for an elite, upper-class, already alert community. Six of the Riebicke photographs show groups of women exercising in a park or on some sort of beach. But whether the group consists of three, six, or seven women, the bodies make the same synchronized movement. One photo shows eighteen women in Peter Pan—type costumes advancing toward the camera with arms upraised, bearing gongs, mallets, and drums; another depicts a round dance of six
women surrounded by another round dance of twenty-four women, all being watched by a milling group of sixteen women, although it is not clear who the leader is. Thus, regardless of group size, Bode apparently did not introduce any of the polyrhythmic convolutions that delighted Laban. Although he rejected the synchronization of movement with music advocated by his teacher, Dalcroze, Bode nevertheless linked the mysterious German concept of rhythm to the phenomenon of synchronicity. Synchronicity was a supreme sign of
unity—with nature, with other bodies, with movements external to the body. But synchronicity is frequently a supreme sign of simplicity, and simplicity made Bode’s teachings very appealing to people with simple ambitions. Though many of his students found a humble place in the German educational system, few achieved distinction within the world of body culture. In the 1920s this limitation was evident to serious commentators on movement education: “This gymnastic method follows a friendly middle path between extremes, between unleashing and strictness: but for that rea-
son it can at best build a bridge to an acceptable practical art, never to a high art, which always demands something unconditional” (HFK 218). DOROTHEE GUNTHER In the early 1920s, many people realized that competing theories of bodily movement were equally persuasive, even if they contradicted each other.
Some students went from Hellerau to Laban or from Mensendieck to Hellerau or from a Wigman school to a Laban school. Dorothee Giinther
I30 SCHOOLS OF BODILY EXPRESSIVITY
(1896-1975) introduced a pedagogic approach that attempted to synthesize Mensendieck, Laban, and Hellerau. At first (1913-1916) she studied art in Dessau and Hamburg, and it was while drawing nude and “crooked” bodies in class that she felt compelled to learn about bodily movement (DG 220). She enrolled in a Mensendieck school, then studied the methods of Laban and Dalcroze. After completing her gymnastic teacher exam in 1919,
she taught in Mensendieck schools in Berlin, Breslau, Hamburg, and Munich. In 1923 she settled in Munich, where she collaborated with composer Carl Orff (1895-1982) on the production of his Monteverdi opera , adaptations, Orfeus and Tanz der Sproden (1923). The following year, the two of them established a school in Munich, with Orff as music director. It was here that Orff developed the famous “Schulwerk’” method, still used around the world for enhancing children’s receptivity to music. Gunther formed stronger creative collaborations with two of her students, Gunild Keetman (b. 1904) and Maja Lex (1906-1986). In 1930 she formed the Tanzgruppe Gunther, for which she acted as a sort of executive producer, with Keetman composing all the music for Lex’s choreography, which emerged from the joint theoretical perspective of Gunther and Orff. Keetman was a protégé of Orff and worked closely with him in editing his Schulwerk publications (see Keetman). Nearly all of Lex’s choreography before the war was produced in connection with the Tanzgruppe Gunther, but she did direct the Munich premiere of Alois Haba’s quarter-tone opera Die Mutter (1931). Meanwhile, Gunther published articles in Die Tat, Gymnastik, and Schrifttanz and wrote two books, Gymnastik Grundubungen in eigner Zeichenmethode (1925) and Einftihrung in der deutschen Mensendieckgymnastik (1928). The Gymnastik Grundubungen linked the study of bodily movement
to exercises in drawing the body; the Eznfuhrung modified the Mensendieck pedagogy to accommodate the Weimar cultural scene. All students of Dorothee Gunther were women. At the Munich Dance Congress of 1930, where Gunther students performed in Wigman’s Totenmal, the Tanzgruppe Gunther achieved instant glory for Lex’s Barbarische Suite. Until 1943 the dance group received plenty of offers to tour throughout Germany and several European countries, especially Italy, but Keetman, Lex, and Gunther (who designed all the costumes) collaborated in a slow, methodical fashion and produced a rather small repertoire of pieces. These included Minizaturen (1931), Klange und Gesichte (1934), Paukentanz (1935), and Tanze aus dem 17. Jahrhundert (1939). The Gunther school merged with the Trumpy school in Berlin in 1933, when Trimpy’s status as a Swiss citizen made her suspect as the operator of a state-subsidized business in the Third Reich. Since 1931 Gunther had completely owned her own school, though she still received state subsidies. She collaborated with Lex on the immense girls’ round dance for the 1936 Berlin Olympiad, a work that required 3,500 children and 2,500 girls. So acclaimed was this
SCHOOLS OF BODILY EXPRESSIVITY 131
piece that Gunther and Lex published a two-volume account of it the same year. In 1939 Gunther choreographed in Berlin Stadium a gigantic waltz for 350 female dancers and musicians. During these years Lex gave numerous solo concerts, which apparently provoked widespread appreciation, aided, no doubt, by her—if I may put it so bluntly—almost overpowering beauty; but the dark, “non-Aryan” quality of her features prevented her from rising to any serious prominence within the Nazi dance culture (Abraham 42). The Nazis closed down the school in 1944 to use it as a military depot, and a bomb destroyed it in 1945. In 1947 Gunther and Lex moved to Rome to live in a villa owned by a former student, and Keetman went to Salzburg in 1949 to teach the Orff theory of musical pedagogy. Wolfgang Wagner invited Lex to choreograph the 1951 Bayreuth production of Wagner's Parsifal; in 1953, Liselott Diem offered her an appointment at the new sport academy she and her husband
had founded in Cologne. (In 1933 the Nazis had shut down Diem’s Hochschule fir Leibestbungen, and she had enrolled in the Berlin Gunther school.) Lex went to Cologne with her old assistant, Rose Daiber, while
Gunther remained in Rome, running some sort of school and finishing what was perhaps the most complete statement of her theoretical perspective, Der Tanz als Bewegungsphanomen (1962). Continually prone to illness,
Lex did no new choreography until the late 1960s, when she formed the student Tanzgruppe Maja Lex, which traveled to a half-dozen countries around the world, performing several dances to American jazz. In this respect she differed from Gunther, whose complex notion of ecstatic dance was nevertheless unsympathetic to the influence of jazz or rock ‘n’ roll (DG 122). But it was clear from her final project, Der Weg zum elementaren Tanz (1986), written with her student Graziela Padilla, that Lex still remained quite faithful to the theory and method of movement education established by Gunther and Orff. From Gunther’s perspective, the synthesis of Mensendieck, Dalcroze, and Laban entailed not only a synthesis of gymnastics and dance but a peculiar synthesis of music and dance. Her ideas were not entirely unique; for
example, a Berlin teacher, Lucie Skerl, had anticipated them in her little book Anleitung fiir den Gymnastikunterncht in den Schulen (1926), which used
a crude drawing technique, along with photos, to describe procedures for uniting hygienic and aesthetic movement. But certainly Gunther linked the notion of synthesis to a stronger sense of discipline than most other teachers; under Lex, dance instruction was pretty strict and demanding. (After working with Wigman in Totenmal, Lex believed that her improvisational method was much too chaotic.) Orff’s ideas about music education clarified Gunther’s ideas about movement education and vice versa. With Gunther, dancing and music-making became interchangeable, if not entirely synonymous. The unique identity of dance depended not on detaching
132 SCHOOLS OF BODILY EXPRESSIVITY
dance from music but on allowing bodily movement to structure the content of music. Keetman and Orff therefore produced music that was specific
to the dance and the dancers and that permitted the dancers to create music while dancing or to exchange places with musicians. A musical work for dance always was a response to a specific problem of bodily movement. Keetman even designed all the musical instruments used to accompany the Gunther dancers. The orchestra consisted of wooden flutes (soprano, alto,
tenor, bass), various sizes of drums, tambourines, gongs, cymbals, bells, noisemakers, and special xylophones. One dance, Zweiklang (1938), apparently involved the unusual accompaniment of only three xylophones. The first, “cheerful” part of Kldnge und Gesichte contained a dance with cymbals,
a dance with flutes, and a dance with bells, with dancers performing on these instruments. Even when the music remained more explicitly confined to the orchestra, Lex and Keetman treated the playing of the music as a visible part of the choreography, as was spectacularly evident in several “kettledrum dances.” This peculiar orchestra even provided the music for the gigantic stadium dances of 1936, 1938, and 1939. In a 1931 article for Schrifttanz, Hans Redlich described the music of the Gunther orchestra as “Asiatic,” because it belonged “conceptually to another planet than say the music of German polyphony,” the world of the Burmese gamelan ensemble (VP 75-77). However, Gunther and Orffactually reached
deep into the premodern European past for their models, medieval and ancient modes of music and movement. Orff stressed the notion of “elementary” musical structures or tropes in forming musical-kinetic consciousness. He built exercises and compositions around a single, elementary musi-
cal idea, such as ostinato, recitative, melisma, accentuation, crescendo, accelerando, psalmody, and intensive repetitions ofa phrase at different tempos. Melodic material unfolded monophonically or homophonically rather than polyphonically or contrapuntally, even in relation to rhythm; although
Keetman did like to experiment (as did Orff) with unusual rhythms for dance, such as 7/8 time, she completely avoided polyrhythmic configurations that appear, for example, in ancient African drumming. The Mensendieck method of analyzing isolated movements in relation to specific body parts converged comfortably with the Orffian analysis of elementary musical structures. Gunther proposed elementary units of bodily movement, including bending, stretching, raising, sitting, standing, falling, rolling, snaking, creeping, crawling, inclining, turning, grasping, holding, gripping, squeezing, lounging, walking, running, hopping, jumping, swinging, rotating, pressing, pushing, pulling, hanging, catching, carrying, bearing, lifting, juggling, tossing, striking, throwing, braking, climbing, balanc-
ing, plunging, arcing, gliding, striding, and leaning (DG 31-32). The human body could localize each of these movement elements within a particular body part, or bodily “element.” Moreover, these movement elements
SCHOOLS OF BODILY EXPRESSIVITY 133
operated in relation to other, more abstract elements, including the movement’s direction, repetition, magnitude, tempo, accentuation, acceleration or deceleration, and crescendo or decrescendo (71-76). When groups of
bodies performed, another series of elements came into play: rows, columns, branches, circles, chains, spirals, clusters, pairings, exchanges, reversals, and so forth (66-69). But all these dynamic elements of movement functioned in relation to musical, costume, and scenic elements such as the ostinato, the mask, and the spotlight. Thus, improvisation pedagogy followed Dalcroze’s rational model of almost infinite variation on ever new combinations of elements. However, Gunther identified all elements as premodern, universal cate-
gories of signification identifiable in children, primitive cultures, and advanced civilizations. Modernity pervaded the physiognomy of dance only
through peculiar combinations of elements, but Gunther provided little guidance on how to identify such combinations. She realized that the problem with the rational approach was its failure to link elements or element combinations to specific emotional values or meanings: elements in them-
selves possessed no inherent semantic resonance, and a single element might carry contradictory significations in different narrative orderings of elements. Gunther therefore tentatively referred, dualistically, to what we might call “emotional elements” such as affirmation and negation, having and losing, wanting and leaving, here and there; yet these elements nevertheless existed because of spatial relations between movement elements (27, 577). For Gunther, movement was always a struggle with space, not (as for Bode) with the body or (as for Wigman) with death. But space was historical as well as physical. Like Orff, Ginther and Lex treated archaic or medieval dance forms as elements of a modern dance, so they set pavannes, gavottes, gigues, minuettes, and contra dances against Keetman’s strange (archaic) instrumentation to produce an unmistakably modern image of the body. The drawing of bodily movement enhanced one’s capacity to identify movement elements, as Lex explained in a letter to Der Tanz (10, 1937, 2-3). But it must be said that the process of identifying movement
elements depends as much on naming them as on seeing them and that movement forms emanate as much from linguistic as from visual structures. In any case, Gunther admitted that categories of elements were not fixed and that even the difference between a gymnastic and a dance element was not always clear, in spite of a functional distinction between a utilitarian
movement (gymnastic) and a movement that is an end in itself (dance). All the principles of the Ginther-Orff method manifested themselves in Lex’s Barbarische Suite (1930). Here, as in other works, Lex adopted Wigman’s “cycle” structure. But in this case, each dance in the cycle represented a crystallization, so to speak, of uniquely synthesized musical, movement,
and scenic elements. In “Ireibende Rhythmen,” the emphasis was on the
I34 SCHOOLS OF BODILY EXPRESSIVITY
-phenomenon of accentuation: six dancers engaged in a “dialogue of movement” driven by continually shifting accents, interruptions, and pauses, with “variation answer[ing] variation.” In “Tanz mit Stabe,” three dancers accompanied a soloist with hand-clapping and beating of bamboo shoots while the soloist manipulated a staff. The “Paukentanz” began with two dancers beating on kettledrums, and their rhythm called into dialogue the orchestra, other dancers, and then other rhythms, as the beat moved from 4/4 to 3/4 time and the dancers became more violent in their movements. This dance led to the “Kanon,” in which the 3/4 rhythm coincided, “quietly,” with triangular formations of the dance group and sound complexes built out of instrumentation in threes: three different flutes, three timpani, three chrome xylophones, and so forth. In the final section, “Sprungtanz,” an orgiastic explosion of ever higher leaps was pitted against ever more rapid accelerandos before suddenly being punctuated by a silence from the orchestra; then came a tapping of feet, a tapping of drums, and a resumption of leaps, crescendos, and accelerandos (Selden; Losch 328-331). In both bodily and group movements, Lex continually favored crisscross, X-
shaped, and A-shaped (triangular) movements; in costumes, Gunther inclined toward quasi-Roman or Visigothic-Viking-type tunics or dresses with metal belts or collars.
For Gunther, the meaning of dance derived from the revelation of recessed or repressed elements of expression. Dance was a struggle with
space because it was a struggle with the past—or rather, a struggle to recover from the past a buried notion of freedom (love and control of space). This perspective inspired her to devote many words to the discussion of dance in so-called primitive cultures (DG 139-219), even though she recognized that differing attitudes toward sexual identity and eroticism made a reconciliation between primitive and civilized cultures impossible. Her fascination with primitive dance was not original; Jaap Kool had anticipated her quite perceptively in Tdnze der Naturvolker (1921). Primitive dance was compelling because it presented undisguised musical-kinetic elements. For Gunther, the experience of ecstasy depended on the revela-
tion of elemental forces (95-122): “Rapture and ecstasy arise im and through dance. ... With the child as with the primitive the drive toward rapture and ecstasy always attaches itself to movement, to dance” (97). But she did not think elemental-ecstatic forces revealed themselves through recovery of the superstitions and myths defining primitive cultures. On the con-
trary, in the civilized world the only way to expose elemental signs was
through rigorous, complex analysis or deconstruction of bodies and spaces. Analytic capacities, however, separated strong dancers from commonplace dancers and prevented ecstatic dance from being a total, unifying, cultic-tribal experience. In a 1930 article for Schnfttanz, Gunther subtly declared that dance education lacked rigor and remained intolerably
SCHOOLS OF BODILY EXPRESSIVITY 135
permeated with teachers and students of Dionysian desires and mediocre abilities who did not recognize their own limitations (VP 50-53). In other words, an elementary discourse on dance did not make dance simple or more accessible. Indeed, the disciplined effort to disclose the repressed elements of musical-kinetic energy ultimately implied that the experience of ecstasy, especially through dance, was the privilege of a gifted elite, not of a culture in a large, inclusive sense. THE BAUHAUS EXPERIMENTS The demand, especially among the young, for knowledge about bodily performance and expressivity was very strong during the Weimar era, and even quite provincial cities could boast not one but two or three schools for gymnastic/dance instruction. As early as 1920, the Mensendieck-Bund alone claimed to have 122 academy-trained instructors managing classes in 63
German cities (FGW 219-223). Through the proliferation of media publicity about body culture, students became more worldly and demanding as the decade progressed, and the competition of schools for students became keener. Strong schools tended to attract government subsidies, but by 1927 they could not receive them unless they met accreditation standards established jointly by the various professional organizations representing statesalaried teachers and educational administrators. The effect of accreditation procedures was to make the curricula of many schools look, on paper at least, alike, with so many hours devoted to anatomy, gymnastics, dance, music, theory, group exercise, and so forth. The Bauhaus school (1919-1932) in Weimar and then Dessau has provoked intense curiosity because of its supposedly extravagant avant-garde attitude toward theatre and dance performance. However, the Bauhaus was a design and fine arts school and, as such, did not have to conform to the
pedagogic expectations imposed upon schools more overtly focused on
educating the dancing body. This exception allowed the Bauhaus to explore startling possibilities that the dance schools lacked the resources or
even inclination to consider. Of course, the Bauhaus had to conform to other expectations—dance objectives always had to remain subordinate to design objectives—and while architect Walter Gropius headed the institution, the Bauhaus theatre program, to the continual frustration of theatre director Oskar Schlemmer and students alike, constantly retained a peripheral status. Nevertheless, the eccentric Bauhaus dance aesthetic has provoked abundant fascination and commentary, most of which Dirk Scheper documented exhaustively, lavishly, and beautifully in Oskar Schlemmer: Das Triadtsche Ballett und die Bauhausbihne (1988). But the complexities of the Bauhaus culture are too complex for any single account and continue to remain more documented than explained.
136 SCHOOLS OF BODILY EXPRESSIVITY
In Weimar, Gropius planned for the Bauhaus to incorporate theatrical performances into its public activities, although he did not make clear how, if at all, the curriculum should accommodate the study of theatrical art. The Bauhaus, he proposed, would bring to the public the results of research in the form of dances, dance plays, marionette plays, shadow plays, and stage
works under the assumption that “the conscious application of laws of mechanics, optics, and acoustics is decisive for our form of theatre” (DS 65). Gropius brought in Lothar Schreyer (1886-1966) to coordinate the Bauhaus theatre program from 1921 to 1923. Schreyer was a hard-core expressionist with a highly idiosyncratic sense of abstraction. In 1915 he began collaborating with Herwarth Walden on the publication of the Berlin radical expressionist journal Der Sturm, and in 1918 he formed the SturmBuhne for the production of his own strange plays and those of Walden and August Stramm. But Schreyer found Berlin hostile to his experiments and
moved to Hamburg, where from 1919 to 1920 he organized the KampfBuhne and collaborated with the bizarre dance couple of Lavinia Schulz and Walter Holdt. In Hamburg and Dresden, his hometown, he attracted a small but enthusiastic audience. Gropius found Schreyer’s radical deployment of technology and formal
abstraction seductive; indeed, one can regard Schreyer as a kind of prophet of performance art, for he announced that expressionistic performance had “nothing to do with theatre” but was a completely different “stage artwork” (DS 66; Schreyer, Zwischen, 7-10). Schreyer, however, was a
mystic, deeply fascinated with archaic Christianity, the moment of conversion from paganism in northern Europe. He saw the stage as a mysterious,
dynamic beacon, the components of which produced a performance resembling a great, cinematic stained-glass window. Paul Scheerbart’s fantastic ideas for comet and astral dances, published in 1903, also stirred his imagination (LS 39-45). Light and color possessed an inherent performative interest and were sources of action in themselves; thus, the “sacral” performance space, closer to an ancient shrine than a theatre, might contain a violet tapestry, black and gold costumes, red masks, and white feathers, all bathed in a deep blue, deep orange, deep yellow, or dazzling silver glow or set against cathedral-like glass reflectors from which emanated
powerful rainbow or prismatic transformations of light. Basic colors (“Grundfarben”) functioned in relation to basic sounds, forms, and movements. The human figure appeared as a remote idol, moving, in a mecha-
nized, marionette fashion, toward ecstatic transfiguration (Kersting 155-160) (Figure 35). The revelation of the inner, metaphysical condition of being depended on exposing the core of forms, as Brian Keith-Smith has put it (Schreyer, Zwischen, 156). But Schreyer’s idea of core movements derived from a perception of rhythm rooted in language, not music: “Through the rhythmic resounding
SCHOOLS OF BODILY EXPRESSIVITY 137
word, the human form of the expressionistic stage artwork materializes as a sound form, a movement form, anda color form,” for “in the beginning was the word” (LS 152). Words were the basic source of all movement, but only when their sound values took precedence over grammatical logic. In his little dramas, Schreyer foregrounded the sound value of words by abandoning sentence structure and employing curious repetitions of words, alliterations, verbless phrases, nounless phrases, illogical word clusters, internal rhymes, and words isolated or suspended in space. Choral voices did not sing but spoke according to rhythmic-melodic values ascribed to the words.
Music entered the performance through unusual instruments, such as a West African xylophone, a five-foot-wide drum, a glass harmonica, a violin, or glass chimes (“spherical music”). These notions Schreyer introduced in
Sturm/Kampfbuhne productions of Nacht (1916), Meer (1916), Sehnte (1917), and Mann (1917). However, it is not at all clear how bodies moved in relation to the words of the texts. In Kreuzigung (1920), Schreyer “scored” all components of the performance as if it were a piece of music, using his own symbol code to indicate the dynamics. The action unfolded in “measures,” and within each measure
he designated the appropriate words, movements, intonations, sounds, pauses, and color effects. The words appeared in different typefaces to indicate different intonations (Gordon 89-103). The little play had only three characters, Man, Mother, and Mistress, speaking in an abbreviated, expressionistic manner: “Mother:lin lightlmy sonlis silentl(Noise tones) |Mistress: Men scream! Men go intolbattlell dancelll.” During this exchange Mother moved her right hand on her right breast and Mistress moved her right arm “sideways horizontally.” The performers never moved from their initial positions on the red and yellow—draped performance space until the very end, when, after saying, “Awake. World. Awake,” they stepped forward and down
some stairs. The scoring of the performance created a haunting, glyphic, abstract design on the page, a bold embodiment of the “word artwork” that made up the core of the dynamic performance. With this mysterium, Schreyer drifted toward a kind of serial organization of performance dynamics such as Schoenberg initiated with the twelve-
tone technique in music. In Skirnismol (1920) he resurrected a primeval image from the Edda to include, in addition to the exploded, fractured language, riding, sword, and scissor dances. At the Bauhaus, Schreyer gathered
about him a small cult, including Hans Haffenrichter, Hermann Miller, Gertrud Grunow, and Franz Singer; he also worked with Eva Weidemann, a dancer not officially connected with the Bauhaus. With them he produced Mondspiel (1923), which featured a large, highly abstract, idol-like effigy of Mary in the Moon standing on a mysterious shell moved from behind by an invisible speaker. The shell projected a “moon eye,” before which moved a masked male dancer. In other words, the male danced with a petrified idol
138 SCHOOLS OF BODILY EXPRESSIVITY
that actually moved through the dance of the invisible speaker, played by Weidemann. A man spoke the part of Mary, and a woman spoke the part of the dancer. Again, Schreyer “scored” all performance components in great
detail (Waserka 127). But Gropius and many other members of the Bauhaus found Schreyer’s thinking too cultish and esoteric, lacking in the rationalism they wished to define the Bauhaus ideology. The dogmatic, fanatical cult surrounding the mystical painter Johannes Itten had already
caused enough tension in the school, so in 1923 Gropius dismissed Schreyer, who then pursued a career combining art history with an archaic, visionary Christianity.
On 30 September 1922, the Stuttgart premiere of Oskar Schlemmer’s Das Triadische Ballett attracted considerable attention throughout Germany and inspired Gropius to appoint Schlemmer to manage the theatrical activities of the school. Schlemmer (1888~—1943) studied art in Stuttgart, his hometown and produced artworks in a range of forms: paintings, wood and metal sculpture, watercolors, graphics, and murals. He had no formal train-
ing in either theatre or dance but nevertheless designed stage sets and cos- | tumes for several prominent theatres in Germany, beginning with 1921 pro-
ductions of Hindemith’s short operas Morder Hoffnung der Frauen and Nusch-Nuschi in Stuttgart. Until 1930 Schlemmer designed sets for theatri-
cal productions in Berlin, Weimar, Magdeburg, and Breslau, but none of these attracted as much attention as his Bauhaus designs, even though he sought to provide emphatically modern (abstract) images for both classical dramas (Shakespeare, Grabbe) and modernist texts (Stravinsky, Bartok, Schoenberg). In his artworks, Schlemmer had dedicated himself since 1915 almost entirely to the representation of the human form, exploring the limits of the tension between abstractness and humanness—‘“the human as a mathematically, geometrically defined type and representative of a higher order” (DS 8). In 1919 he helped found the strange Uecht circle of Stuttgart artists who pursued a kind of cubo-expressionism to suffuse images of modernity with mysticism, a vision that coincided in no small degree with that of Lothar Schreyer (Muck). But Schlemmer was a stronger theorist than Schreyer, and he cultivated a much more congenial attitude toward academic environments. He began working for the Bauhaus in 1921 in the sculpture and metal
workshops, where he produced Das Figural Kabarett (1922), a sort of mechanical cabaret using abstract dolls and doll parts. As head of the theatre workshop, Schlemmer was a popular teacher, partly because of his aggressively experimental attitude toward performance and partly because of his determination to build performance out of design concepts rather than out of texts. Performance at the Bauhaus was inseparable from the production of independently interesting artworks that had strong exhibition value: models of experimental stages and mechanical theatres, fig-
SCHOOLS OF BODILY EXPRESSIVITY 139
urines, watercolors, drawings, sculptures, and photographs. Many famous examples of this work appeared in Schlemmer’s widely disseminated futuristic promotional brochure, Die Buhne des Bauhaus (1925). Performances functioned as showcases for student design work and always took place in
a workshop environment, as the school never had the resources to construct anything resembling the utopian theatres imagined by Schlemmer, Andreas Weininger, Gropius, or Ferenc Molnar. The arrival of Xanti Scha-
winsky (1904-1979) in 1924 brought a touch of circus, music hall, and carnival to Bauhaus theatre projects; other students, such as Molnar, Gyula Pap (1899-1984), Laszl6 Moholy-Nagy (1895-1946), Lou Scheper (1901-1976), Kurt Schmidt, Joost Schmidt, Georg Teltscher, Karla Grosch, Lux Feininger, and Werner Siedhoff brought an extraordinary range of specialization in different areas of the fine arts. Music for Bauhaus productions was often the work of the Bauhauskapelle, a student orchestra employing the usual gongs and drums but also saxophones, wood flutes, banjos, a trombone, a clarinet, a trumpet, an accordion, a piano, and even a revolver.
Though he had a lifelong preoccupation with dance, Schlemmer maintained only very marginal contact with dance culture outside the Bauhaus, and his thinking about bodily movement was neither precise, deep, nor
even innovative. He assumed that the interest of a bodily movement depended almost entirely on the visual context, the scenic design. Schlemmer worked with Ellen Petz on an adaptation of The Nutcracker in Dresden (1928) but was not at all happy with the result. Gret Palucca visited the
Bauhaus for a concert and demonstration in 1928, but this event led to nothing significant. Otherwise, Schlemmer seemed content to work (1927-1928) with Manda van Kreibig (1901-1990), ballet mistress at Darmstadt and student of Duncan, Bode, Laban, and Wigman, on devising movements for dance pieces. In 1928 Gropius left the Bauhaus, and his successor, Hannes Meyer, sought to move the school toward a more overtly leftwing political position. Schlemmer’s politically ambiguous “formalism” brought him into intensifying tension with Meyer and many other teachers at the school, so in 1929 he accepted a teaching position in Breslau. When the Nazis came to power, Schlemmer’s art faced severe reproach, and he spent the last decade of his life in painful isolation in Stuttgart. The work most strongly associated with the Bauhaus theatre program, and Schlemmer’s most important theatrical project, was The Triadic Ballet. The piece underwent several transformations over a period of twenty years (1912-1932), with major revisions or revivals in 1923, 1926, 1929, and 1932, and it was the impetus for numerous subsidiary projects and experiments by Schlemmer and other Bauhaus artists. Yet the piece transcended the Bauhaus, for Schlemmer’s work on it preceded his involvement with the Bauhaus by ten years, and when he premiered The Triadic Ballet in Paris in
I4O SCHOOLS OF BODILY EXPRESSIVITY
1932, he had been gone from the Bauhaus for four years. However, Schlem-
mer’s association with the Bauhaus was decisive in shaping the identity of the piece; Scheper has expertly described the not always congenial tension between Schlemmer’s modernism and that favored by the Bauhaus administration. The Tnadic Ballet began life in 1912 as an experimental collaboration between Schlemmer and a pair of dancers with the Stuttgart Court Theatre,
Albert Burger and Elsa Hotzel, who had studied under Dalcroze at Hellerau. It hardly developed independently of established theatre institutions, although developments in modern dance culture apparently had little impact on Schlemmer, judging by the pervasive lack of reference to them
in his letters and diaries. But the premiere, in Stuttgart, did not occur for another ten years, with the original pair of dancers as the stars. During the Bauhaus years, the piece mutated under the pressure of new collaborations.
Paul Hindemith wrote “mechanical” music for the 1926 production at Donauschingen, and after that the piece appeared in a popular revue format in Frankfurt and Berlin. By then the dance was famous enough to spawn a gallery exhibit in Central European cities. As the piece grew older, it became shorter; once an evening-long event, it wound up featured on a program of modernist works. Finally, in 1932 the piece went to Paris as part
of an international dance competition promoting the restoration of elite, high cultural glory to ballet. In spite of its title, Schlemmer never considered the piece ballet in any conventional sense—it was always for him a modern kind of pantomime. It
was modern perhaps because of the mutability of its aesthetic identity; it could migrate from a radical-experimental to a popular to a high cultural institutional context, and this capacity depended on the generic ambiguity of the work. On the one hand, according to a diary entry of 30 September 1922, the ballet “flirted with lightness without falling into grotesquerie” and strove to “dematerialize the body without destroying it through occultism”; on the other hand, it revived the Dionysian ecstatic origin of dance but did so under the terms of a “final form” of “Apollonian strictness” (OSI 96-97). But this vaguely defined generic ambiguity entailed rather specific, abstract formal relations between aesthetic components. And although The Tnadic Ballet attracted attention throughout Europe, its impact on theatrical practice was very small, confined almost entirely to the tiny Bauhaus program for theatre, although graduates of the school certainly found opportunities in mainstream institutions. Perhaps Schlemmer’s greatest contribution lay
not in producing any particular piece but in rethinking the process by which dance does its work. With The Triadic Ballet, Schlemmer introduced an unprecedented degree
of abstraction into performance aesthetics. More precisely, he sought to invest dance with the same power of abstraction that modernism had dis-
SCHOOLS OF BODILY EXPRESSIVITY 141
covered was possible for the painted image. For Schlemmer, the meaning of
performance depended on an appreciation of formal relations between abstract categories of aesthetic experience, such as color, shape, and pattern; it was not a matter of constructing characters or correspondences between imaginary actions and real conditions outside the theatre. Schlemmer composed “texts” for theatre from lists of formal elements that, when recombined, were the basis of performed action. This aesthetic entailed a perception of the performance space as a grid that could unitize formal elements according to a unique, mysterious system of geometry, a “symphonicarchitectonic” ideology, in that the value or meaning of theatrical action derived from “the pleasure in the play of forms, colors, and materials” (DS 35).In The Tradic Ballet, for example, a triangular principle of organization dominated: the piece contained three sections, or “series” (“Yellow,” “Rose,” and “Black”), each requiring three dancers (two men and a woman), whose movements operated in relation to a dynamically structured trinity of costume, dance, and music; this trinity, in turn, functioned dynamically in relation to the spatial trinity of height, depth, and width, which embraced the trinity of basic forms (triangle, circle, quadrangle) and basic colors (red, blue, yellow)—all these relations accommodated by eighteen costumes and twelve dances.
This “geometrization” of performance was an initial step toward a total mechanization of theatre; indeed, Schlemmer, in collaboration with other Bauhaus artists, contemplated plans for large-scale machine theatres and robotized “plays of forms,” none of which, unfortunately, ever came to
fruition. Diary entry, April 1926: “No whining about mechanization, instead, joy over precision!” (OSI 183). Indeed, the three transformative “emblems of our time” were abstraction, mechanization, and technological innovation (OS 17). For Schlemmer, this optimism in regard to the salvational potential of abstraction and technology was always suffused with mysticism. No matter how abstract the performance became, the human figure (though not the body) remained the central, dominating image in the play of forms, for it was the most powerful and artistic signifier of immediacy (DS
25). Schlemmer consistently treated the human figure as a geometrical phenomenon, not as the site of a “character” or, as he put it, “psychologicalliterary” values. In a 1915 diary entry, he noted various geometrical properties of the body: The quadrangle of the breast cavity, The circle of the belly, Cylinder of the throat, Ball of the elbow joint, knee, shoulder, bones, Ball of the head, the eyes, Triangle of the nose,
The line connecting heart and brain, ... (DS 24)
I42 SCHOOLS OF BODILY EXPRESSIVITY
In 1930 he explained that human figural art lies “in the realm of the dolllike. For the abstraction of the human form . . . creates an image in a higher
sense; it creates, not a natural human being, but an artistic being; it creates ...asymbol of human form—lIn all early high cultures . . . the human form is remote from the naturalistic image, but close to the lapidary symbol form: the idol, the totem, the doll” (OSI 231). This geometry of the body was exposed above all by mask and costume, not by any system of movement. Whereas Dalcroze strove toward a costumeless, naked identity for modern humanity, Schlemmer perceived that “costume is everything” in modern theatre (DS 27). Many commentators on The Tradic Ballet felt that
the extraordinary costumes—by turns mysterious, bizarre, and enchanting—were the only significant feature of the piece (Figure 36). Some dance critics believed the costumes merely disguised very conventional choreog-
raphy. Indeed, in spite of Scheper’s meticulous efforts to reconstruct the dance from abundant visual and written documentation, it is still quite difficult to see how the piece works as a kinetic event (33-58). Even Gerhard Bohner’s 19777 reconstruction seemed to lack a convincing organization of
movement. Schlemmer himself thought the greatest problem with the piece was its failure to inspire any music appropriate for it; before Hindemith composed a mechanical organ score for it, Schlemmer had used an
eccentric mix of music by several modern and unmodern composers (Mozart, Haydn, Bossi, Debussy), and he even considered circus marches and popular tunes (235). Not even Scheper can explain why Schlemmer’s radical image of the human form could not awaken an equally radical complement of music or movement. Perhaps the designs seemed to mock any complementation with music or movement; the human figure made fun of the human body, and dance became a deprecation of the body.
Schlemmer’s notion of costume was total insofar as he regarded all aspects of scenography as categories of mask. He strongly resisted the estab-
lished theatrical practice of treating costume, scenery, and lighting as the work of separate designers. This idea led to an even more modern one: that a designer could initiate theatrical works and become their author. Schlemmer designed many productions of literary works and established ballets, but he was never happier than when he was fashioning his own “text” out of the principles defining his mysterious geometric system, and for this reason he was utterly unique among modern dance creators. To this day, designers everywhere seem to require a text or scenario created by
someone else to justify their contribution to performance. Schlemmer, however, saw scenery, lighting, movement, and sound as extensions of costume and the human figure—that is, he saw all forms as masks (although, unlike Schreyer, he did not see masks in terms of core forms). It was a tendency of Teutonic mysticism to perceive being itself as something perpetually masked, veiled, enshrouded, without form. No matter how naked the
SCHOOLS OF BODILY EXPRESSIVITY I 43
body appeared, it was always a mask, hiding something within it that had no form: an emotion, an experience of the world, a mood. Expressionism sought to objectify this inner world of emotion. Schreyer
attempted to create a modern dance theatre oriented toward a superabstract mysticism, with an utterly strange human form as its core. His image
of humanity was no less radical and abstract than Schlemmer’s, but the cultic-ritual obscurity into which he and his adepts retreated violently estranged him from the rest of the Bauhaus. Schreyer simply did not believe that technology was the basis for connecting art and spiritual renewal or for
establishing an emancipatory condition of modernity. The Tradic Ballet indicated to Gropius that Schlemmer understood how technology imposed a classical restraint or sobriety of form on the construction of emotion and abstraction. But Schlemmer was never really happy in the Bauhaus. A theatre curriculum was expensive, and Bauhaus theatre productions invariably stirred up political controversies that made it difficult for Gropius to raise funds and subsidies for the academy. Today one constantly encounters the inclination to regard formalist abstraction as a strategy for transcending politics, but in the Bauhaus era the reduction of theatre to a play of forms and a geometric abstraction of the body awakened extreme intensities of political feeling. Formalist performance may have constructed highly ambiguous, uncertain, “mystical-fantastic” emotions, but it did not fail to produce an impassioned attitude toward its ambiguities. For this reason, theatre education within the Bauhaus never possessed much more than a marginalized,
workshop status. In a letter to his lifelong friend Otto Meyer-Amden in December 1925, Schlemmer described his estrangement from the dominant atmosphere of the Bauhaus and his awareness of the limitations of abstractionism: The artistic atmosphere here is so cosmically remote from everything that is not actual, not immediate, not trendy... Dadaism, circus, variety, jazzband, tempo, cinema, America, airplane, auto. That is the real situation here. In
painting: no subjects. “Abstract” = no subjects, quite demanded by the extreme power bloc of Kandinsky and Moholy. Here I am someone from yesterday, or perhaps a dissident, because I paint “classically.” The general course of art is “reactionary.” ... The amusing, the dadaistic, the mechanical, cinema, etc. are the reality. One sneers at every feeling, sentiment, indeed at anything really serious (OSI 157-158).
One can now even suggest that the abstractionism pursued not only by The Triadic Ballet but by the Bauhaus generally disclosed a profound anxiety toward the body and the irrational, emotional dynamics emanating from deep inside it. Bauhaus abstractionism transcended the body rather than
revealing it or developing perception of it. When abstract eccentricity replaces expressivity as the dominant sign of modernity, the resulting image
I44 SCHOOLS OF BODILY EXPRESSIVITY
produces many handsome art books but not performances that bear up to repeated viewing. Nevertheless, within these constraints Schlemmer made a further major contribution to modernist theatre: he proposed a revision of formal theatre
education no less radical than his notion of the designer as author of theatrical performances. Schlemmer’s Bauhaus curriculum detached the study of theatre from the study of literary drama, theatrical productions, or theatrical artists. It developed within an experimental, laboratory milieu in which abstract, formal elements of theatrical performance were presumed to have a powerful value independent of any specific literary or historical context and thus became the object of systematic investigation. Schlemmer divided theatre curriculum into three general areas of study: 1) scenic composition; 2) scenic technology; and 3) linguistic, musical, and gymnasticdance studies. Each of these categories contained within it the study of aesthetic devices deemed particular to theatre, and study itself was considered virtually synonymous with experimental performance on specially designed “research stages” ( Versuchsbiihne). For example, the curtain as a visual device
peculiar to theatre could become the subject of various experimental performances exposing the variations in meaning signified when the curtain acted in certain ways in relation to particular qualities of light, material, color, sound, or bodily movement before and behind it. Schlemmer and a brilliant group of students and collaborators performed all sorts of experiments to isolate the signifying power of specific theatrical devices—such as costume, gesture, mask, choric movement, shadows, projections, puppets, footlights, props, and ramps—always in relation to the signifying power of a more abstract category of form—material, shape, color, geometric configuration, sound, size. The experimental group did not seek a context (a literary text) to justify this mode of performance; rather, the modern theatre artist constructed a context around a specific device or element of interest. These experiments culminated in an astonishing series of performances in 1929 of a twelve-piece program that revealed the intrinsic dramatic interest of tensions between forms and materials: Glass Dance (solo female), Metal Dance (solo female), Staff Dance (solo female or male), Gestural Dance
(three men), Mask Chorus (seven men and women), Screen Dance (three men), Box Dance (three men), Space Dance (three men), Ring Dance (two women and one man), Form Dance (three men), Sketch (one women, three men), and Women’s Dance (three men) (Figures 4 and 37-38). Piano and percussion instruments accompanied the dancers. Schlemmer attempted to “score” the brief dances in the manner of Schreyer, but in their weird mask-costumes, all the dancers had to do was move to stimulate curiosity— a point that did not go unnoticed by critics of the time (DS 206-207). Most interesting in this regard are rehearsal photographs taken of the Women’s Dance by a Bauhaus student, Naftali Avnon (1910-1977). These give an
SCHOOLS OF BODILY EXPRESSIVITY I45
idea of the eerie, somewhat stilted movement the doll-like “women” (actually men) made in their extravagant masks and costumes, which look like Oriental parodies of nineteenth-century fashions. Even more interesting, the snapshots reveal the power of the dancers to make the photographer move, to make him get closer to and farther from the strange creatures, look at them from odd angles or in different configurations of light. However, Schlemmer did not want the pictures published because they did not
give an adequate sense of the space in which the dancers appeared and because they looked spontaneous or amateurish, not like genuine artworks.
He preferred the posed photographs of the piece taken by Umbo (Otto Umbehr), which, although quite interesting in themselves, do not convey the idea of a dance (Faber, Tanzfoto, 79-83).
For Schlemmer, theatre education was inseparable from the experimental knowledge derived from performance itself rather than from history or dramatic literature. A modern, emancipatory theatre must derive from a new system of theatre education, a system that saw no great value in
preparing students to preserve theatrical traditions dominated by reverence for the enduring authority of texts and by humility over the transitory authority of performance. Moreover, Schlemmer’s experiments and the documentation on them indicated that modern study of performance did
not mean the study of particular productions; it meant the study of the devices and codes that constitute the context for any specific performance (text). From this perspective, dance became a play of forms, an activation of space that ultimately needed no bodies, no dancers. It was the image of a machine-idol. LILI GREEN
In spite of pervasive complaints after 1925 about the increasing American-
ization of German culture, American ideas about bodily movement, so influential before the war (especially in relation to female physical culture),
did not receive particularly serious attention in Germany. Of course, the Mensendieck theory had many disciples, but by 1920 her work was more of an inspiration than a rigorously applied system; in any case, Mensendieck
seemed much more European than American. The influence of Isadora Duncan (1878-1927) was far weaker than that of Mensendieck, though commentators on dance continued to evoke her name reverently. She opened a school in Berlin-Grunewald in 1904; in 1911, at the invitation of the Duke of Hesse, the school moved to Darmstadt under the direction of Isadora’s sister Elisabeth (1874-1948). Throughout her restless, vagabond life, Isadora Duncan opened schools in Germany, France, the United States, Greece, and Russia, but she was a very poor teacher, with no patience for
pedagogic detail, systematic organization of experience, or theoretical
146 SCHOOLS OF BODILY EXPRESSIVITY
rigor. She left most teaching duties to faithful (rather than competent) disciples, and in the classroom she favored a tribe of completely worshipful female children eager to follow her every whim and path (Jowitt
96-97). Elisabeth Duncan wanted a school that was independent of her sister’s chaotic personality. With the help of Max Merz (1874-1964), whom she married, she sought to infuse some discipline into Isadora’s improvisatory, Grecian approach to bodily movement by incorporating into the curriculum ideas from German body culture (including Merz’s enthusiasm for race hygiene). The war compelled her to return to New York in 1915, but by 1920 she was back in Germany; she revived her school in Potsdam, maintaining a branch office in New York. The school operated out of the castle at Klessheim in Salzburg from 1925 until 1933, when she closed her school in New York and moved to Prague (1933-1935) (Stefan 97-98; Heun). Then she lived in Munich before returning to America. Afflicted
with lameness, Elisabeth herself never danced, and her school, unlike Isadora’s, did not strive to develop bodies for public performance: she wanted to produce imaginative teachers. Nevertheless, the school operated very much in the shadow of Isadora’s looming personality. The pseudoGrecian image of nature and art prevailed. Liberated movement was always a “natural” response to great pieces of classical music. (Merz published a pamphlet condemning jazz as a subversive, antisocial force.) Movement was an evocation of fantasies inspired by the music. Dance created a pic-
ture of the emotion inspired by the music; if neither the music nor the emotion stirred within the body, one should not force movement. A unique feature of the curriculum was a set of exercises in which students sang archaic German folksongs while moving (Rochowanski, Tanzende, 3). This approach succeeded with (female) children, but students over the age of thirteen or so required a much more powerful notion of bodily expressivity to sustain their interest (HB 76-81; RLM 38). Indeed, by 1920 a historical perspective had set in that made Isadora’s and American attitudes toward bodily freedom seem childlike, unhelpfully naive. Sull, it was obvious that in Isadora Duncan dance (more than her dances themselves) had
produced a spectacular, tempestuous personality that provoked awe in almost anyone excited by the new currents in dance culture. The whole idea of Ausdruckstanz, of the body as a powerful instrument of expressivity,
seemed to emanate from her. Duncan’s idea of expressivity, of painting emotion in movement, owed much to the semiotic system of Francois Delsarte, and it is therefore worthwhile to relate the curious fate of Delsartian theory in Germany. Delsarte devised a code, for use primarily in the theatre, that assigned particular gestures to signify particular emotions. Giraudet explained this elaborate system of categories and subcategories of signification in Mimique: Physiognomie
SCHOOLS OF BODILY EXPRESSIVITY —_147
et gestes (1895). The body moved according to the rhythm of emotions it experienced or desired to represent. But the Delsarte system assumed that both gestures and emotions were clearly and immediately readable, as joy or anger or despair or delight, because emotions derived from universally common phenomena external to the body that experienced them. For Dalcroze or Gunther, by contrast, a movement element had no inherent signification; one might even suggest that Ausdruckstanz as a whole represented an effort to free the body from imprisonment within a kind of semantic grid that sought to make the body “meaningful,” to make it “say” things that were
easily, clearly, and unambiguously understandable under conventions of “appropriate expression.” American theatrical genius Steele MacKaye
(1842-1894) studied the Delsarte system in Paris and around 1873 imported it to the United States, where it became enormously popular in theatre training. Its influence on the development of American modern dance was so considerable, even oppressive, that the greatly respected dancer Ted Shawn (1891-1972) felt disposed to publish a textbook on the system as late as 1954. Genevieve Stebbins (1857-1915) studied under MacKaye in New York. In books published in the 1890s, she modified the Delsarte system by incor-
porating theories of breathing and rhythmic movement to produce what she called “harmonic gymnastics” for female students. Stebbins’s emphasis was not on developing a large vocabulary of expressions for use on the stage but on cultivating an ideal convergence of female hygiene and beauty. It was she who first associated the “natural” female body with the wearing of Grecian tunics and chitons. A student of Stebbins, Hedwig Kallmeyer (1881-?), opened a school for girls in Berlin around 1905, and her students included Dora Menzler and Gertrud Leistikow. In Kiunstlerische Gymnastik (1910), Kallmeyer modified the Stebbins method to accommodate some ideas of Bess Mensendieck, herself a student of Stebbins; flexibility was apparently a feature of her thinking. By this time, however, the connection to Delsarte began to get lost in the more immediate effort to construct a modern—and “correct”—identity for the female body. Kallmeyer’s influence was probably greater than the paltry information about her would indicate. After the war,
she seems to have moved to Hannover. Several photographs in the Joan Erikson Archive of the Harvard Theatre Collection depict activities at her school in Hannover around 1925. These show groups of children between five and sixteen years old playing outdoor body games. Some of the children are nude. One photograph shows a group of twelve boys with two women instructors; in other images, groups containing both sexes play games, and one photo shows a group of six women sculpting clay animals. Taken together, these photos imply that Kallmeyer had moved some distance both from Delsarte and from the all-female, Stebbins-Mensendieck cult of idealized physical comportment. But why? Perhaps the answer lies in
148 SCHOOLS OF BODILY EXPRESSIVITY
a 1924 statement by Fritz Giese. Discussing Delsarte, Stebbins, Mensendieck, Kallmeyer, and Duncan as representatives of a single system in which
gymnastics worked to produce beautiful rather than strong bodies, Giese remarked: Mensendieck’s thinking leads to a perhaps all too ice-cold aesthetic in the sense of an impartial, sober perspective. Here, where only women fit into the system, we find the hygienic-aesthetic gymnastic purposeful, useful, and at the same time clear in form, comprehensive, physically appropriate, and therefore beautiful. But one can also deprecate this attitude. The feminine, the womanly, moves into the foreground. The spectator is the man, the performer the woman. At least in general: grace and dignity in their old polarity. That is how one learns to understand the methods of Kallmeyer-Stebbins as well as those of the veil-wrapped Duncan school. (FGK 112-113)
The ideals of the Delsarte-Kallmeyer trajectory were “renown[ed] models of Nacktkultur: the unclothed, beautiful human,” which led one to “a culture of the pose like an antique bronze or marble.” “Body spirit here means the soul expressed in the body—but as if it were crystallized, petrified within it,
set up for observation rather than experienced” (FGK 112-113). In other words, although a gesture still signified a distinct emotion, as Delsarte intended, the emotion signified was not grounded in experience nor even in the body; rather, it was imposed upon the body by an “objective” spectatorial gaze that actually looked backward, into an idealized, mythical, eternal past, for guidance—not on how to feel but on how to display feelings that gained the approval of a society (America) that feared the expressive body’s power to undermine a fragile sense of social unity and shared capacity to read signs. The Germans, however, were not so worried about crypticity or darkness of expression. But the Delsarte system was not entirely dead in Germany. In 1929, Lili Green published Einfuhrung in das Wesen unserer Gesten und Bewegungen, per-
haps the best and most ambitious treatise ever to emerge from Delsarte’s notion of correspondences between gestures and emotions. Green so overhauled the notion that she produced an elaborate semiotic analysis of bodily signifying practices, permeated with a transfigurative Germanic aura. Born and raised in Surinam, where her father owned a coffee plantation, Green (1885-1977) began to study piano in The Hague after the death of her father in 1905, but she derived no happiness from it. Then she saw Isadora Duncan perform in Scheveningen and talked with her. Duncan told
her that “you cannot learn dance, you have to make dances.” In 1907, Green produced her own dance-song fairy tale in The Hague, apparently with considerable success. She tried to advance her career in the London theatre, but when told she needed more training she returned to Holland, where she appeared as Ophelia in Eduard Verkade’s popular 1908 produc-
SCHOOLS OF BODILY EXPRESSIVITY 149
tion of Hamlet. The following year she was back in England to study ballet (ESG 15-18). She assumed the “Russian” name Vallya Lodowska for a few years and began dancing with Andreas Pavley (Henryk van Dorp de Weyer [1892-1931]), who had studied under Dalcroze and in 1909 had staged in Amsterdam a production of Beethoven’s Prometheus with more than a hundred performers. With Pavley, Green produced a series of enormously successful dance
concerts in London and The Netherlands (1910-1911). These presented Oriental and classical-mythological themes in a decoratively theatrical man-
ner, for the Java-born Pavley strongly typified the prewar perception of dance as a rapturous submission to glamorous exoticism. But Green had her own ideas, especially in regard to the concert program, which always fol-
lowed the example of her 1907 debut show: she supplemented dance pieces with solo performances by the pianist, a violist, and a singer (her English friend Margaret Walker). In all her dances, she impersonated a character in a little story inspired by the music: The Murderer’s Dance, Death and the Maiden, Anitra’s Dance. For Tchaikovsky’s Songs without Words, she and
Paviey devised a Pierrot and Columbine tale. Newspaper reviews of concerts given in Leiden, Haarlem, and Amsterdam in 19193 consistently and enthusiastically remarked on the pantomimic quality of her dances, and all suggested that she was a much stronger dancer than Pavley. The decorative elegance of her movements, produced by a body of exquisite slenderness and
suppleness (“like the ripples of a harp”), established her enduring appeal for critics and large audiences alike, although “The Murderer’s Dance doesn’t suit her” (“Lili Green,” G5-G7, G11). Into the 1930s she continued to perform, in cities across Europe, dances she had created before 1913, provok-
ing virtually the same enchanted critical response she had originally inspired (see Wiener Gesellschaftsblatt, 3 March 1930).
In 1913, Pavley met Sergey Oukrainsky (1885-1972), a dancer with Anna Paviova’s ensemble. Oukrainsky persuaded Pavley to join the Pavlova group, and when that tour of duty ended, in 1915, Pavley and Oukrainsky
stayed in the United States, where in 1916 they founded the PavleyOukrainsky Ballet. They subsequently became quite prominent for their promotion of a flamboyantly decorative ballet culture in Chicago (19161927) and then in Los Angeles (1927 ff.) (Prevots, Dancing, 133-151; Het
Tooneel, 3/10, March 1918).
Meanwhile, Green opened a school in The Hague and began working
with Margaret Walker as her dance partner. In 1918 she produced Carnaval,
with Schumann’s piano cycle as accompaniment and a group of her students in fantasy Biedermeyer costumes. Here she revised the Pierrot and Columbine story to put Walker in the role of Pierrot and a male dancer in the role of Pantalon; the piece enchanted audiences, despite Green’s somewhat perverse approach to the material (Lapidoth). In the 1920s she
I50 SCHOOLS OF BODILY EXPRESSIVITY
initiated several ambitious projects, including ballets of Dukas’ La Peri, Ravel’s Daphnis et Chloe, and Roussel’s Le Festin de l’araignee. Debussy’s music
apparently unlocked a recessed inclination toward perversity in her solo dances, judging by several photos of her in the Nederlands Dans Instituut. Wearing an extravagant wig, she did a witch dance that probably represented the limit of her willingness to depart from the decorative, but in several other Debussy pieces she seems to have enjoyed baring her breasts or appearing nude under a diaphanous cloak, even though she was over forty years old. An article in Spel en dans (September 1925, 15-16) ranked her with Tamara Karsavina, Anna Pavlova, and Jenny Hasselquist as a world-class
dancer. While on tour in Czechoslovakia, Green, “unhindered by labor laws,” collected some slum children and brought them back to Amsterdam to perform in her fairy-tale ballet, Die Verliebten (ESG 16). Then she was busy with opera and civic spectacles. In 1933, she appeared in a powerful open-air production at Zandvoort of Wilde’s Salome. Besides playing the title role, she choreographed two bal-
lets not designated in the text. These, according to one reviewer, were “absolutely justified” and produced a very dramatic effect, but he felt that, as Salome, Green, though “very beautiful,” lacked morbid passion and sensuality, her response to the head of Jokanaan being “more the whim of a spoiled princess than of wild lust.” However, she performed expertly and with great delicacy, especially at the end, and the Dance of the Seven Veils, with
Strauss’s music, was perhaps “the great moment of the production” (“Lili Green,” A11). Green was forty-eight years old when she played Salome. But just as surprising was the publication of her Verzen (1934), which contained turbulent erotic poems: “My love is like a burning wound” (36); “Iam lonely,
beautiful and pale. My body longeth for thine arms to enfold me, my lips are parted with desire” (63). In 1935 she formed around her students Het Nederlandsche Ballet (“Lili Green,” A12), and in 1936 she worked on dances for the Berlin Olympics. But she was not sympathetic to the fascist elements within Dutch dance culture that sought to develop nationalist feeling through ballet, and during the war years she led a cautious existence. In 1948, at age sixty-three, she gave her last solo concert, then went to Washington D.C. to create another school, which lasted until 1959. She then returned to The Hague to receive various honors and gave lessons well into her eighties.
Lili Green had a long career as a performer/choreographer in solo dances and stage plays, in opera and mass spectacle, in modern dance and ballet. Though the curriculum in her schools adapted to new trends, the dances she created did not change in their approach to bodily movement
from around 1912 until her retirement from the stage in 1948. Yet her dances constantly seemed dramatic and exciting to audiences in Amster-
SCHOOLS OF BODILY EXPRESSIVITY 151
dam, Paris, Vienna, and Berlin. The reason is that she cultivated an attitude toward bodily expressivity that enabled her to interest audiences regardless
of differences in media, cultural context, or historical era. This attitude derived from a Delsartian faith in a correspondence between specific gestures and specific emotions and manifested itself through the phenomenon of pantomime, or “plastic dancing,” as Green called it. The Einftthrung was an impressively erudite treatise on pantomimic art. Missing from her book was any discussion of rhythm, music, or group movement. Nor did she introduce any reference to hygienic or therapeutic effect. The focus remained strictly on what particular gestures signified. In pursuit of this aim, Green used photography in an imaginative way. She herself was the model for all the examples. A sequence of photographs could show how a series of gestures produced “concentration moments” that culminated in large emotional complexes; for example, an eighteen-photo sequence depicted a girl awakened, puzzled, and drawn by the fragrance of flowers, then conveyed her desire to possess the flowers and weave them into a rapturous bouquet (67~73). The photos posited a difference between the body’s reading of a stimulus (“emotion station”) and the body’s response to the stimulus (“will station”). “Concentration moments” referred to dynamic tensions between qualities of energy and qualities of will. Subsequent chapters explained these relations. Seven “primary impulses” encompassed all relations between emotion and will: joy, fear, pain, struggle, inclination, disinclination, and sex drive. Each primary impulse subsumed distinct categories of emotional signification. Thus, for example, fear entailed terror, suffocating anxiety, helplessness, or horror, whereas disinclination (not the same as disgust) included repulsion, hostility, or aversion. Accompanying the text for each category was a photo of Green performing the appropriate gesture. To signify attraction, a category of inclination, the body stood with one foot forward, arms hanging away from the body with suspended effect, the head tilted and turned in the same direction as the forward foot, with the eyes fixed level to the object of attraction. To signify friendship under the same category, the head should remained turned (in the same direction as the forward foot) but now should be slightly uplifted, with both arms reaching forward and the hands together. To signify erotic desire, the body stood with feet slightly apart and arms hanging close against the body (thighs) while the head cast a level gaze at the object of desire with eyes half-closed and lips pressed into a slight smile. (However, for me, Green’s signs of erotic desire might just as well signify “haughtiness.”) To signify erotic enticement, the body stepped forward and approached the object of desire at an angle, with arms behind the back, the head sharply tilted, the eyes open, and the lips pressed into a full smile. To signify erotic excitement, the arms moved
152 SCHOOLS OF BODILY EXPRESSIVITY
away from the body, which curved, arc-like, with the torso and groin pushed
forward, the head pushed back, the eyes half-closed or closed, and the mouth open. Of course, the total range of emotions the body may signify far exceeded Green’s capacity to represent them or even to clarify distinctions between emotions she discussed and those she did not (such as the relation between erotic desire and haughtiness). Nor did she suppose that men differed from women in their signification of emotions. Furthermore, she did not clarify how the signification of emotions differed, in expressive value, from the performance of abstract categories of action, such as stabbing, kissing, praying, cradling, marching, or kneeling. Green’s aim, however, was to demon-
strate the decorative signification of emotion, so she left out all kinds of significations that convoluted the reading of bodily expressions. Decorativeness was synonymous with clear, refined readability of signs, but such readability was also synonymous with a filtering out of significations that transgressed anonymous conventions of appropriate expression and complicated the spectator’s perception of the body. In Germany, by contrast, the general mission of modern dance was to challenge the conventions of appropriate bodily expression. Indeed, German dance equated the liberated body not with an enhanced power to signify a wide range of emotions but with the power to signify and/or experience a single, great, supreme emotion: ecstasy. The basis for a free and modern identity lay in that most difficult to feel of all emotions. Green apparently sensed this problem with her approach, for she devoted a special section of her book to that “exceptional emotional condition,” ecstasy (38-41). But her discussion of it was excessively conventional. For one thing, she asserted that the Greek meaning of ekstasis, “standing outside oneself,” was the same as “an absence of the self,” by which she seems to have meant an absence of bodily self-control. She associated ecstasy with dream states, with involuntary bodily movements such as those caused by epilepsy and hysteria, and with mystical visions of an archaic and frequently heretical nature. It was obvious that she was not at all sure how the body should signify ecstasy. “It happens with a cry,” she remarked vaguely (38).
She offered only one photograph of ecstatic signification, and this appeared at the end ofa nine-photo sequence, “Amor Dei,” that showed her in a medieval dress and cowl demonstrating the signification of revelation, awe, reverence, humility, service, prayer, sacrifice, embrace, and ecstasy (48-49). Ecstasy was manifest when the body thrust the arms upward and
outward, with the head thrown way back so that it looked straight up. Ecstasy was a sculpted pose, a panel in an “appropriate” frieze rather than a peculiar condition of movement. Related to this limitation was her failure to trust her own photographic imagination. She came up with a worthwhile
innovation: attaching tiny reflectors or battery lights to parts of the body
SCHOOLS OF BODILY EXPRESSIVITY 153
and then photographing movement at slow shutter speeds so that the image
recorded the traces left by the lights (63-64). But she failed to apply this interesting device to the analysis of emotional signification. Yet it was exactly
this sort of technology that might have proved effective in resolving the problem of signifying ecstasy.
It is easy to assume that Green’s theory of pantomime—and the whole Delasartian legacy she sought to preserve—was as marginal to German body culture as Green herself. But the assumption is misleading. Her analysis of conventions for signifying particular emotions was sound. Though her representation of emotions seems somewhat extravagant (melodramatic) by today’s standards, the difference is primarily one of degree, not kind. Conventions of signification rigidly control communication with large audiences. To reach the large audiences vital to its economic security, the German film industry relied on performers who followed fairly closely the conventions of signification described by Green. Acting in silent films especially entailed a mastery of pantomimic expression. The music that invariably accompanied silent films was created independently of the screen performances, which meant that actors could not depend on external rhythms or harmonies to shape their bodily expressivity, nor could they rely on the stilted-looking declamatory style appropriate
for classical theatre or make elaborate, time-consuming Stanislavskian efforts to build a completely realistic character. They had to employ conventions of physical-emotional “plasticity.” Oskar Diehl’s Mimztk im Film
(1922) purported to explain the pantomimic conventions of film acting, which he claimed derived directly from dance. But this little book, containing no pictures and no analysis of any particular signifying practice, was worthless as a contribition to pantomimic semiotics. Diehl focused almost entirely on movements available to the face, then merely listed various dramatic situations that required facial expression. However, the book did not signify so much the bankruptcy of pantomimic art as the failure of film culture to grasp the theoretical foundations of bodily expressions appropriate for the screen, for moving images rather than three- dimensional spaces. As pantomime became an art of containing bodily expres-
sion within an image, dance became an art of opening space through movement and therefore freeing the body from conventional images of it, which was why dance critics continually displayed skepticism toward performances that were “merely” pantomimes. Yet the distinction between dance and pantomime was not always altogether precise, considering the complex career of Green herself and con-
sidering that several prominent modern dancers became skillful film actors and even stars, including Valeska Gert, Grit Hegesa, Lil Dagover, Leni Riefenstahl, Jenny Hasselquist, Harald Kreutzberg, Anita Berber, Rita Sacchetto. Conrad Veidt (1893-1943), a wonderful actor with no dance
154 SCHOOLS OF BODILY EXPRESSIVITY
training, developed a highly expressive and idiosyncratic pantomimic style that sometimes seemed dancelike in its precision. According to a 7 April 1920 letter in the Leipzig Tanzarchiv, even Laban himself negotiated with the UFA film studio to produce a ten-part fairy-tale dance-pantomime, Der
Komet, about a dance temple, a dance god, a dance cult, and a female dancer curious to see the invisible dance god. However, an inability to deter-
mine the relation between dance and pantomime prevented the film from being made.
Solo Dancing
Germany produced more systems of dance and bodily expressivity during the Weimar era than I am prepared to describe. Little information is avail-
able about many schools, but most seem to have subscribed to one or another or a combination of the systems already explained.’ To survive, schools had to find a place in society for their graduates, which generally meant creating more schools and raising body consciousness on a national scale, making it part of the education of all modern citizens. Finding a place
1. Lammel mentions several schools affiliated with Laban or Mensendieck without appar-
ently having any official connection to either teacher: Helmi Nurk (Bremen), Margarete Schmidts (Essen), Edith Bielefeld (Karlsruhe), the Lucian School (Erfurt), Olga Suschitzky (Vienna), Karin Schneider (Graz), Gertrud Volkersen (Hamburg), Senta Maria (Munich), Marion Hermann (Oldenburg), Anne Grinert (Duisburg), Trude Hammer (Berlin), Frances Metz (Munich). Freund discusses a few of the more than 150 dance-gymnastic schools in Berlin about which information is otherwise very scant, including Lotte Wedekind, Ruth Allerhand, and Berthold Schmidt. The Internationales Tanz Adressbuch, published in 1922, listed approximately 720 persons in Germany who claimed to be solo dancers. Dancers affiliated with theatres and opera houses totaled nearly 600, including 560 females and 35, males. Approximately 250 persons worked as dance instructors, 4’7 of whom specialized in ballet. Most instruc-
tion applied to careers in cabarets and revues. The address book listed nearly 500 German cabaret dance acts, including 325 pair dance acts. In 1922, Germany apparently had 57 dance schools that prepared students for concert performances; these included 12 in Berlin, 5 in Hamburg and Frankfurt, 4 in Munich, and 3 each in Leipzig, Stuttgart, and Dresden. These figures compare with other European nations as follows:
England 58 (11 outside London) Austria 13 (all in Vienna)
France 55 (26 outside Paris) Rumania 1
Holland 43 (11 in Amsterdam) Russia: 1 (the Duncan school) Italy 5 Switzerland Latvia 1 Belgium193 3 T55
156 SOLO DANCING for students who wished to become artists was considerably more difficult, especially when the demand to see dance did not expand nearly as dramatically as the desire to dance. But many dancers, especially before 1925, had
little or no desire to teach. Such dancers depended on performances to establish and sustain their careers. Very few, however, had the resources to create dances that impressed audiences by their scale or their power to
supersede ballet in terms of production values. No one in Germany—or anywhere, for that matter, except France and Russia—could assemble the resources that Sergey Diaghilev was able to muster to support the Ballet Russes, and he was successful in part because no one else was able to set up a competitive company on a comparable scale, although Rolf de Mare and
the Swedish Ballet (1920-1924) certainly tried. Many small ensembles emerged, especially out of the schools, but the great majority of these formed around a strong dance personality whose power to lead had been established through solo performances. An amazing number of dancers gave solo concerts between 1910 and 1935. Today it is almost impossible to find anyone giving a solo dance con-
cert, not because audiences are less indulgent and more demanding of dancers but because so few dancers have the intensity of message, the need
to say something on their own, that possessed the solo dancers of the Weimar era. The challenge of sustaining the interest of an audience for an entire concert was an extraordinary test of artistic self-confidence and credibility for a dancer. In Berlin and Halle, Leni Riefenstahl (b. 1902) gave a
two-hour solo concert that included a dance to Schubert’s Eighth Symphony (1825), a feat that smacks of heroic ambition (Schab, in Hallesche Zeitung, 12 May 1923). In a video interview, Hanya Holm conveyed some
impatience with contemporary (1980s) dancers who live by the motto, “Don’t exhaust yourself”: “You have to dare, otherwise you never find your
approach” (Hauser). Because no European city contained a dance audience large enough to sustain more than a few performances of the same concert, touring was essential in developing an artistic career. Touring pres-
sured a dancer to cultivate a national and international identity, which opened up a continental rather than merely a local market. Indeed, few solo dancers, unaffiliated with a school, could enjoy enduring careers without an international reputation. Apparently the Austrian dancer Gisa Geert and the German dancer Sonja Markus, representatives of a Wigman-Laban tendency toward “aesthetic brutalism” in modern German dance, were bet-
ter known in Italy (1932-1933) than at home (Bragaglia). One can even suggest that the authority of German dance depended on its exportability, its power to attract foreign interest, for even’the schools, especially the 2. On Diaghilev and the Ballets Russes, see, among a vast number of publications, Buckle, Percival, Nijinsky, Shead, and Krasovskaya. On de Mare and the Swedish Ballet, see Hager.
SOLO DANCING 157 Laban institutes and Hellerau-Laxenburg, depended heavily on foreign students. Linguistic and cultural borders did not hem in dance as they did the-
atre, even though dancers and audiences alike expected dance to expose cultural differences. SEMIOTICS OF SOLO DANCE
The credibility of German dance ideology depended heavily on solo dance performances, whereas the credibility of ballet and revue dancing rested on techniques and production values associated with ensemble performance. Of course, Ausdruckstanz was by no means indifferent to ensemble performance, and most expressionist dance concerts, especially after 1925, integrated solo dances into a program featuring ensemble dances as well. Yet the power of bodily movement to signify a unique, commanding personality seemed most convincingly affirmed when a single dancer demonstrated skills that could sustain the interest of an audience for an entire concert. But Germans were hardly responsible for the authority of the solo concert. Isadora Duncan established an unsurpassed threshold of glory as a solo dancer, inspiring the world of the arts on a scale that still seems amazing and that explains why so many young people wished to emulate her. In 1908 she collaborated with the eighty-member New York Symphony Orchestra in dancing to the whole of Beethoven’s Seventh Symphony as well as five
pieces by Chopin (the orchestra also played three other pieces). She repeated the feat, to great acclaim, in Paris as late as 1920, although by that time twenty-year-old dancer Elsie Altmann was scarcely impressed, nor was
Mary Wigman (Duncan 199-201; Van Vechten 307-309; Altmann-Loos 155-156; Mueller, “Lebenslauf,” 23). But other dancers of international stature soon followed in Isadora’s wake to reinforce the prestige of the solo concert format.
Probably no dancer was more beloved around the world than Anna Pavlova (1881-1931). An astonishingly photogenic woman, she more than anyone else conveyed the impression of a beautiful creature who literally could not live without dancing. Although not much of an innovator in relation to bodily movement and not even a great virtuoso of ballet technique, Pavlova always seemed to bring great pathos and poignancy to every ges-
ture. It was as if every time she danced she tried to recreate that everreceding, enchanting moment when, as a child of six, she had first seen the
magical splendor of ballet at the Marinsky Theatre with her mother (Pavlova 1-2). Her major achievement was in bringing dance and its image
to an immense global audience, in showing that dance could move them with intensities of emotion to which ballet did not even aspire. Pavlova’s pathos derived in large part from the haunting aura she projected of fragile beauty moving alone throughout the world.
158 SOLO DANCING Exotic dancers fascinated European audiences in a way that, after 1918,
made European dancers who attempted to imitate them appear increasingly inauthentic. This trend pressured the Germans to look at bodily movement from genuinely modern perspectives. The Spanish flamenco dancer La Argentina (Antonia Merce [18g0—1936]) acquired, from 1908, a huge international audience and, like Pavlova, danced herself to death through excessive touring (Levinson). Other exotic dancers appearing in Germany included the Indian Nyota Inyoka (1896-1971) and the Javanese
Rodan Mas Jodjan (1870-1959), who participated in the 1928 Essen Dance Congress. Yet the taste for exotic dance emerged primarily through the prewar work of Westerners such as Mata Hari, Adorée Villany, Cleo de Merode, Maud Allen, Ruth St. Denis, all the Salome dancers, Ida Rubinstein, and, of course, the Ballets Russes. Exotic dance, in its European manifestations, aligned a libidinously uninhibited and somewhat “dangerous” body with decorative affluence, “excessive” materialism.’ It was hardly a message that died in the war, but its perpetuation required dancers who
shaped archetypes around, rather than merely exposed, their personalities. Even American dancers appeared exotic to Germans. Ruth St. Denis (1879-1968), with her repertoire of “Oriental” dances, enjoyed such success in Germany and Austria that her tour of those countries lasted from 1906 to 1908 (Shelton 67-87). In 1925 Paul Swan (1883-1972), “the most beautiful man in the world,” appeared in Germany with “Oriental” dances that, if his attempts to “reconstruct” them in Andy Warhol’s bizarre 1965 film about him are even vaguely accurate, must have seemed as fantastically campy then as now (Cluzel 1-31). Ted Shawn attracted much
attention in 1929 when he presented in Berlin his he-man versions of North and Central American Indian dances; he then worked with Margarethe Wallmann, appearing more like Adonis than Orpheus in her Orfeus Dionysos (1930), although Shawn himself was apparently disdainful of German dance culture (Dreier; Shawn 225). At any rate, particularly in the years 1919 to 1925, solo dance concerts proliferated abundantly, and a great many of them were performed by peo-
ple about whom hardly anything is known. The pages of the short-lived (1920-1921) journal Konzert, Tanz und Presse contained reviews of solo 3. Perhaps the most comprehensive survey of exotic, “ethnic” dancers in the 1920s appears in Divoire (142-171); most of these dancers were Spanish. But an examination of the magazines La Esfera and Illustracdo, published, respectively, in Madrid and Lisbon during these years,
indicates that Iberian dancers (entirely female) were just as popular in Spain and Portugal as elsewhere. “Oriental” dancers, by contrast, projected a more complex identity, for some of them were not even Oriental but European, and even those who were Oriental modified their “original” dances to accommodate a Western image of Oriental movement. But often dances were “Oriental” simply because the dancers wore Oriental costumes or used music in an Oriental mode. See Buonaventura.
SOLO DANCING 159 concerts given around Germany by dancers whose names rarely appear elsewhere: Suse Elsler, Lisa Abt, Ruth Schwarzkopf, Annie Lieser, Ilse Freude, Chari Lindis. Paul Nikolaus, in Taénzerinnen (1919), briefly described several dancers whose careers apparently did not progress deeply into the 1920s: Solveig Oderwald, Gusi Viola, Lucie Hertel, Erna Bertini, Macka Nordberg,
Hannelore Ziegler. He explained that, although most of these dancers exuded plenty of charm, they lacked sufficiently liberating intensity of feeling because they remained too immersed in ballet technique, too devoted to decorative effects of the variety stage, or too restrained in their exploration of bodily rhythms. Other prominent fashioners of dance culture in the underresearched period of 1917-1923 included Hilde Schewior, Beat-
rice Mariagraete, Hilde Sinoniew, Hedwig Nottebohm, Vera Waldheim, Edith Bielefeld, Nina Schelemskaja (with Ellen Tels), Olga Samsylova, Hilda
Hager, Stella Kramrisch, Maria Ley, and the Bulgarian Radeja Vinarova. The significance of most of these dancers lay in the attractive images of dance they projected in widely published photographs. In Munich and Berlin, beautiful (and apparently blonde) Lisa Kresse darkened her skin to perform whole programs of “Hindu” dances and dances related to “mysteries of the cabala” in the years 1918 to 1921, but information about her work remains difficult to find (Elegante Welt, 8/24, 19 November 19109, 10). Solo dance concerts were definitely economical opportunities to estab-
lish precedents. In 1920 a local newspaper reported on a “stormily applauded” concert in Kiel given by an eight-year-old girl, Maryla Gremo, “which offered all manner of character dances with a gracefulness never before seen,” although “such dances as the nigger dance, even when presented in all possible decency, are not suited for any child” (KTP 4, 121).
During these years many “modern” dancers seem to have derived their sense of aesthetic movement from folk dances, from harlequinade/fairytale pantomime, or from romanticized forms of dance, such as the waltz or
habanera. Suse Elsler received both praise and condemnation for performing old peasant dances rather erotically in a skimpy costume, portraying “a
psychosis, the girlishly floral fantasies of a confused generation.” Ruth Schwarzkopf received both praise and condemnation for getting “too deep”
into the peasant dances, revealing in them something no one had seen before. Hedwig Nottebohm apparently inspired doubt and curiosity with her gymnastic, “masculine” mode of movement, as in her dance following the theme of a marathon runner. In 1907 the Danish dancer Gertrud Barrison, formerly of the five Barri-
son Sisters of the music hall world, began performing folk dances and waltzes at cabarets and at recitals in Vienna before moving on to somewhat
more complex pieces in which she obscured the genre of the piece by introducing more and more decorative and narrative (pantomimic) details.
She was perhaps the first European to establish (in 1920) a school that
160 SOLO DANCING offered courses in dance for film performance (Weissenbock 74). Another Viennese dancer, Grete Wiesenthal (1885-1972), was, from 1907 to about 1920, the great incarnation of the waltz spirit so closely identified with the city. Wiesenthal’s training was in ballet, but she freed the waltz from the remote formality into which ballet had imprisoned it. The waltz provoked in her an unprecedented lyricism in bodily movement; Aurel von Milloss explained that she did not merely excavate or reconstruct some lost, original form of the waltz but “breathed the spirit of the waltz and danced her waltz-like feelings” (Endler 188). Whether in a swirling skirt or a loose tunic, she seemed driven by the 3/4 beat into a state of ecstatic abandon-
ment. And she made very expressive use of her hair, as Rudolf HuberWiesenthal remarked: “Grete’s delicate body bent over the ground, covered by her flowing mass of gold-brown hair. And then, slowly, timidly at first, she raised her closed hand into a bouquet, opened them, and with this release of the hands, her body rose also, her hair sinking back. Gradually the flow of tones strengthened the slender body until eventually she became entirely overpowered by frenzy, hurling herself, nearly flying, with her arms outspread, the gold rush of hair always a part of the movement, a part of the dance” (189). She also seems to have danced often with her eyes closed and her mouth parted in a smile; the beauty of her face was exquisitely haunt-
ing, and she conveyed that elegiac quality that, as Endler observes, is so often missing from choreographed waltzes (200). Early in her career, Grete danced with her sisters, Else and Bertha. According to Brandenburg, Else’s talent was too pantomimic and Bertha’s too undeveloped to compete with Grete’s, so Grete moved away on her own.
Else and Bertha formed a duo (then a trio with Marta, another sister), but it did not last long, as Else moved in a manner that appeared “half puppet, half schoolgirl” (HB 44-47). In 1908, in Vienna, Rudolf Jobst (1872-1952) took a famous series of photographs of Grete, all outdoors and all showing her in motion. These showed dramatically how she had linked the waltz to an expansive, unbridled experience of space. Wiesenthal commanded deep
respect from the Viennese cultural-literary elite, especially the circle around Hugo von Hofmannsthal, who collaborated with her on pantomine dramas, as did Max Reinhardt. Her extremely photogenic beauty brought her into motion pictures, with Die Stumme von Portici (1913) becoming an enormous success (Fiedler). By 1919, however, Nikolaus complained (with echoes from Suhr and Fischer) that her dancing lacked expressive power and “in no way triumphed over any limits” imposed by the genre (20). Around 1915 another Viennese, Lucy Kieselhausen (1897-1927), began specializing in performing waltzes. She, too, had evolved out of ballet culture, but her embodiment of the waltz was virtually opposite that of Wiesenthal. She favored luxuriously decorative hothouse costumes and the utmost refinement of movement. For her the waltz was not a lyrical expansion of
SOLO DANCING 161 space into the freedom of nature but an almost perfumed distillation of the stirrings within an opulent boudoir, with its scenography of exquisite privileges and voluptuous secrets. An adroit sense of irony shaded her movements with abruptly “bizarre and jerky” rhythms; “her joyfully flashing temperament did not hover on a smooth surface but over a shadowy abyss from which issued her fool’s dance with its slumbering, half-animal rapture” (HFT 47-48). Her curious appropriation of the waltz ended suddenly when she died in a benzine explosion. Laura Oesterreich, a Hamburg native. began her career specializing in the performance of the polka, a genre of quite limited movement potential
to which she brought a strange ambiguity. Brandenburg felt her polkas incarnated a slithery, darting spirit, “motherly,” from the depths of the North Sea, “full of the little fear that one’s foot, so capable of hovering, will stumble on a stone and glide away at each step, a small, lowering fear, which merely conceals the greater fear, not to have grown beyond a humble objective” (210). She was at her best, as in Mazurka melancolique (19177), combin-
ing this “little fear” in her steps with a face of ecstatic intoxication, eyes closed and lips parted, so that the dance seemed to reveal a puzzling internal tension. The tension intensified when she tried to appropriate the waltz, but in this endeavor she apparently failed because her body was “painfully” incapable of breathing the rhythms and tonality of this “southern” genre of music (209). Oesterreich had studied with Laban at Ascona in 1914, and in 1920 she worked, always as a soloist, with the Falke sisters on projects for the Munchener Tanzgruppe. In 1925 she gave a concert in Hamburg featuring six dances with nonmusical accompaniments—gongs, bells, horse clopping, hammer blows, buzzers, rattles—but it was not a success. It is not known
what happened to her after this time (St6ckemann, “Pionierie,” 40-41). Oesterreich obviously sensed the severe limitations on the capacity of a
dance genre to deepen the identity of either the dance or the dancer. Although dancers continued to explore the expressive potential of inherited genres—waltz, polka, sarabande, gavotte, minuet, czardas, tango, pavanne, fox trot, and so forth—after 1920 it was clear that the evolution of
modernity in dance depended on freeing the dancer from too close an identification with generically structured responses; these subordinated dance to music, in the now passé manner of Duncan, and prevented dance
from constructing personalities stronger than the genres and, indeed, stronger than music itself. Thus, in Hamburg, Gertrud Zimmermann received praise for her “nearly tragic” dance to a prelude by Rachmaninov because in this piece she seemed to get beyond the conventional, affable “sweet femininity” imposed upon her by the genre dances that made up the rest of her program (ATP 13, 1921, 214). Even within the realm of genre dancing, dancers strove to differentiate themselves, to compete with other dancers for the attention of audiences,
162 SOLO DANCING by imposing a personal attitude onto the genre. As a result, the aesthetics of
the solo concert grew more complex. Programs began to include dances with unusual musical sounds for accompaniment—zithers and harmoniums, bass drum and woodblocks, harps and gongs. They contained mixtures of genre dances—a mazurka followed by a tango, a waltz before a polonnaise. But musical genres did not determine the identity of all the dances. Some dances carried progammatic titles that subordinated the composer's intention to that of the dancer: Sea Clouds, The Pied Piper, The Amazon, Heart Flame, The Captured Bird, Astarte. Others signified “genres”
established entirely by dancers: sword dance, barbaric dance, marionette dance, demon dance, machine dance, wolf dance, temple dance, celestial dance, death dance. Variety of costume further displayed the complexity of the dancer’s personality. A simple, elegant tunic exposed the beauty of the dancer’s legs and arms, but romantic moods went best with long skirts, capes, mantels, hoods, or period garments (quite often from 1830-1845); a dance or two might feature an exotic look, appropriated perhaps from the Orient, ancient Egypt, or imperial Rome. And it could not hurt to perform a dance in sleek, decorative pants, although few dancers performed in leotards unless they sought to convey a harlequinesque effect. Performers perfected the expressive authority of their dances with accessories: strange hats, gloves, scarves, sashes, gilded belts, bizarre necklaces and bracelets, ribbons, garlands, veils, masks, fans, stockings, helmets, and feathers. Ausdruckstanz was not synonymous with barefoot dancing, and the use of sandals or high-heeled shoes was not at all rare, with Kreutzberg going so far as
to employ knee-length boots in a couple of dances. But a dance concert should never turn into a fashion show; Nikolaus, Thiess, and Suhr warned that costumes could distract from perception of movement, although only Nikolaus supposed that nudity did not help to create an expressionist dance
(70). Finally, dance concerts offered a range of moods: a solemn, heroic dance, then a melancholy dance, then a grotesque dance, then an exuberant dance, then a “Korean” or “Javanese” dance, then a romantic dance in bluish tones. Nearly every dance was only as long as the corresponding musical composition; very rarely did a single dance involve the stitching together of several pieces of music. The vast majority of music came from composers who were already long dead or who had written their music without the dancer in mind. Only when the accompaniment included drums and gongs did the
dance determine the length of the music. Most dances lasted about four minutes, but one or two in a given concert usually exceeded ten minutes in length; the entire program typically contained about twelve pieces, with various musical interludes to allow for costume changes. Solo dance concerts were never devoted to the performance of a single, ambitious work, such as a sonata, that explored a theme in depth, although Wigman seemed to move
SOLO DANCING 163 toward this goal with her concept of dance cycles. The dance concert followed the model of the musical recital rather than the epic poetry recital, the dramatic lecture, or the Ciceronian political oration. A successful concert should include at least one experimental dance that violated performance conventions: a “silent” dance, a dance with mirror floors and walls, a dance performed entirely while sitting in an armchair, a dance created by shadow projections, a dance with two masks, a dance involving march movement against waltz music, a dance with sword and shield, a dance performed behind a curtain, a dance depicting murder or sexual rapture (bacchanale), a dance in which the body moved faster and faster or slower and slower, a
dance allegorizing revolution or the body of the marionette/machine or the Idol of Death. The Danish film melodrama Afgrunden (1910), probably the most profitable motion picture released in Europe that year, contained a fascinating scene in a music hall in which the great actress Asta Nielsen (1881~1971) performed a kind of polka-mazurka while smoking a cigarette and wearing a Wild West costume (Seydel 41). By using different combinations of all these aesthetic variables, dancers could pursue a montage mode
of performance that allowed for considerable flexibility as long as the dancer maintained an expanding repertoire of pieces. Yet by 1920 Mary Wigman had presented concerts that challenged the semiotic conventions described here. She dared to present concerts almost entirely governed by a somber mood and indifferent to variety of decorative effect or charm. As always, she displayed a deep awareness of the dramatic potential of bodily movement—every step, every gesture, every glance laden with tension, conflict between the body and space, the body and time, the body and death, the body and itself. The solo dance concert revealed above all a unique, compelling personality, not the values associated with a complex of conventions. One did not attend a solo dance concert to see this or that dance but to observe, across a repertoire, the terms under which the movement of a body expressed an utterly unique personality. This ambition was reserved for all but a few dancers and in any case became less imperative after 1925, when dance had become sufficiently institutionalized to allow dancers to shape their identi-
ties through teaching or even through a dance company rather than through solo performance. EDITH VON SCHRENCK
Edith von Schrenck (ca. 1894-?) projected a cool, aristocratic persona. She consistently garnered much praise for the seriousness of her dances, and critics often compared her with Mary Wigman. Of all dancers in the early 1920s, Edith von Schrenck probably came the closest to rivaling Wigman
in cultivating seriousness of expression as manifested in complexity of
164 SOLO DANCING
response. She was never as wild or as innovative as Wigman, but she conveyed a disturbing sense of passion, a dark power to stir deep feelings in audiences. This power depended on an intensity of boldness and vulnerability achieved by hardly anyone else (other than Wigman). Schrenck was unusual in that she started as a teacher, then became a performer. Once she took to the stage, she showed great reluctance to perpet-
uate her identity through disciples. She was born in Riga of a Russian mother and a German-Latvian father who was a distinguished gynecologist
in St. Petersburg, where she took lessons in piano and singing. But after attending a lecture by Dalcroze she decided to study rhythmic gymnastics at Hellerau. She spent two years there (1912-1914), received a diploma, then
returned to St. Petersburg to teach at the Dalcroze institute run by Count Volkonsky. Through teaching she met an actress who had left Konstantin Stanisklavsky’s company to develop a purely physical approach to dramatic performance. From Claudia Issachenko, Schrenck learned Delsartian semiotics and the Stebbins-Kallmeyer theory of “artistic gymnastics,” but it is not clear if she danced with Issachenko’s ballet company. She did, however, study ballet during the war years, without any intention of pursuing a career in dance (Buning, “Gesprek,” 49). She also became friends with Estonian dancer Ella Ilbak, who described Schrenck’s studiousness in her memoirs (Ilbak 71-72, 79-80). Then the revolution struck, pushing her out of Russia and, in 1918, out of Latvia.
Landing in Munich in difficult financial circumstances, Schrenck decided to establish herself professionally as a dancer. She was slow to do so,
perhaps because the Dalcroze method as taught to her did not orient students toward professional performance. At any rate, she was always cautious
about deciding anything, and her dances made extensive use of slow, “weighted” rhythms. The success of her solo debut concert in Munich led to
a tour of German cities (Berlin, Hamburg, Dusseldorf), then to performances in Holland, Riga, Vienna. She worked briefly (1921) with the Ham-
burg-based Miinchener Tanzgruppe and with Valeria Kratina, but group dances did not allow her talent to blossom, and from then on she performed only in the solo concert format (HB 229). Around 1925 Schrenck married Waldemar Bonsels (1881-1952), an enormously successful writer of children’s stories and folk tales who had published praise of her since 1921. According to IIbak, he opposed her collaboration with “strangers,” even though he traveled widely and achieved distinction for his vagabond literary identity (Ilbak 172-174). She opened a school in Berlin (1929) and continued dancing until about 1930, but by this time she had completely detached herself from the mainstream of modern dance in Germany (as well as from Bonsels); she did not attend the dance congresses of 1927, 1928, or 1930, nor did she maintain contact with significant dance person-
SOLO DANCING 165 alities of the time, and her school does not seem to have flourished beyond
1932 (Freund 49-52). Perhaps by then she had nothing more to say through dance. Edith von Schrenck was extremely beautiful, but it is very difficult to find
an image in which one sees her full face. She consistently and selfconsciously withheld a part of herself from the spectator, always projecting a dark aura of aloofness and loneliness—which, indeed, became the subject
of her dances. Brandenburg (203) observed that she tended to avoid the corners and sides of the performance space, conveying a sense of “dense closure” to the totality of her presence. This characteristic was represented perhaps most dramatically in Gefesselt (1919). In this piece, with music by
Chopin, she danced the condition of being fettered, not moving from an initial position within the performance space. In only a tunic, she lunged and lurched with a violent swinging of her arms and turning away of her head; then, in profile, she curved her body into a bowing stance and crossed her arms over head as if her own body were the source of her bondage; she
twisted with her back to the audience, pivoted and leaped high with outstretched arm, as if suddenly suspended by a chain, then immediately sank
into the scrunched profile position before lunging out again toward the spectator with clasped, swinging hands, as if preparing to hurl a heavy, destructive weight (Schrenck 16~20). She gave an impression of great strength trapped in a body, not knowing where to go. Delsartian semiotics allowed her to build a “dance architecture” out of dramatic tensions and ironic details. In Kriegertanz, later called Amazone
(1919-1921), using music by Rachmaninov, she appeared in a pleated miniskirt with helmet, shield, and dagger. She constantly moved on tiptoes,
first in a high march step with head tilted straight up, shield held level before her, and dagger clenched with straight arm down her side; then, in profile, she thrust shield and dagger behind her and pushed her belly forward, her head level; suddenly she swung around, shield at her belly, dagger raised high, her whole body a sinewy, muscled curve; she stabbed the space not before her but directly at her feet, then arched back ecstatically, dagger and shield raised over her uplifted head. Wounded, she sank to the
ground, danced, pulsated on her knees, on her elbows; finally, some strength returned, and she began moving stealthily on her knees, face behind the shield, then surged up on tiptoes again and made a final, fatal plunge with the dagger before sinking to death (Schrenck 1-8). Brandenburg marveled at her skill in combining movements of “attack and flight, triumph and defeat, pounce and rest, kneeling, sinking, reclining, stretching” to produce a dance that was “no imitation of a sculpture” but the “primeval image” ( Urbild) of the warrior. Buning saw in her a pagan, heroic spirit, and
her Schmerz (1922) reminded him of a verse by Hdlderlin: “[B]ut where
166 SOLO DANCING danger is the salvational wakes, too.” In this piece, Schrenck employed slow,
hunched, rocking movements that became increasingly more delicate, slower, and smaller, continuing after the music had stopped (WBT 153). To Buning it always seemed as if she danced with an invisible partner, and this curious sense of presence and absence of body made all her movements dramatic (WBD 36). Commentators consistently spoke of the “strict-
ness” of her movements, as if she constantly sought to keep in check a great power or pressure within her, even in pieces such as Wellen (1922), in
which she blended the motion of combing with the movement of sea waves. In Polichinelle (1919), with music by Rachmaninov, she began to dance joyfully, with extravagant lunges, leg stretches, leaps, and sways on one leg until, suddenly conscious of a dark, invisible energy surrounding her, she turned her dance into a melancholy image of pathetic loneliness. Her early dances sometimes displayed a serious sense of humor or irony, as when she did a temple dance dressed as a “piquant Jacobin” or presented her goblin dance with Grieg’s music (KTP 13, 212-214). But in the ensuing years she completely favored dances of a tragic, melancholy, or elegiac character: Polonaise, Page, Gothisches Lied, Last, Bestegt, Einsamkeit, Abseits, Marsch, Chaconne, Ziguenerin, Kampf. Even in Kindheit (1923), she made the
joy of being a child seem tinged with consciousness of a diminishing innocence. Her summer dance, from a 1924 cycle of the four seasons, began
radiantly and luxuriously but suddenly turned somber; she performed again all the movements that had begun the dance but now slowly, heavily, as if under a withering heat. Schrenck liked music in a minor mode (Bach, Rachmaninov, Scriabin).
In 1929 she presented a concert in which all the music was serious: five pieces by Scriabin, two by Mussorgsky, one each by Brahms, Bach, and Handel. She was fond of dancing before and on tapestries, and she chose deco-
rative costumes that displayed the great beauty of her arms and legs. Suhr thought she was perhaps too decorative in her approach: she held back
some violence, something deep and great in her that she intimated but never really released (WS 46). Very few dancers could make such expressive use of the arms, yet she never seems to have danced fully erect-—she loved
displaying her capacity to bend, to twist, to hunch, to fold herself up, and remain beautiful all the same. This ability is quite evident in the twenty stark, expressionistic lithographs Ottheinrich Strohmeyer made in 1919 of three of Schrenck’s dances: Kriegertanz, Polichinelle, Gefesselt (Schrenck) (Fig-
ures 39-41). Hans Fischer saw in her art a “visionary enclosure” of power (KTP 13, 1921, 213); Schikowski had “the feeling that through unprecedented exertions of strength [Schrenck] subjugates the depths of a boiling
volcano. And one expects at any moment a sundering of the cool surface ... “(Geschichte, 152). But one may also see in this aesthetic a woman's
tragic awareness of music as a great force pressing in upon the body—a
SOLO DANCING 167 sense conflicting sternly with the doctrine of her decisive teacher, Dalcroze, who insisted that, for anyone as sensitive to music as she obviously was, music could only bring the body to a state of supreme liberation. GRIT HEGESA
Grit Hegesa (ca. 1896-?) remains a mystery. She came from Cologne, but her debut concert occurred in Berlin in 1917, at which time she apparently associated with expressionist artists affiliated with the Secession (“Exp. im Tanz’). In 1917-1919 she was active in Holland, giving concerts in Amsterdam and in Rotterdam, where she associated with a circle of modern artists, mostly expressionists, calling itself De Branding (Brinkman 107-109). At this time she worked with the Dutch composer Jaap Kool (1890-1959), but it is not clear if this collaboration brought her to Holland or began after she had arrived. Hegesa was unique in exclusively using music composed by a modern composer for her dances. Educated in Paris, Kool contended that dance could not seriously develop a modern identity as long as one danced to old pieces of classical music, even those written for dance. Music for dance, he argued, emphasized rhythm at the expense of harmony, which Western classical music did not but which jazz, some forms of popular music, and exotic music from the Orient did (Kool, Tanzszene, 1-4). Old classical music lacked a modern sense of rhythm, by which Kool meant not only a complex, dominating sense of pulse but also strange sounds. He therefore employed in his music for Hegesa drums, bells, and gongs from his collection of Javanese gamelan instruments and different kinds of glasstimbred instruments. But Kool had eclectic tastes that allowed him to travel comfortably in the realm of commercial popular music. In addition to his Labor Symphony (1924) and concert piece for twenty-eight drums, he composed arrangements for the Erik Charrell Revues in Berlin, operettas such as Miss Fu (1924), film music, jazz pieces, and dance tunes. Perhaps his most widely known works were composed for the eccentric ballets Die Elixir des Teufels (1925), staged by Ellen Petz in Dresden, and Der Leierkasten (1925),
choreographed by Max Terpis in Berlin, then by Claire Eckstein in Wurzburg (1927) and Anne Grutnert in Duisburg (1927). In 1919, Kool wrote an article about Hegesa for the Dutch art journal Wendingen (2/3, 15-21) in which he described her art as “visible music” and “pathbreaking in expressive possibilities” of the body, especially the arms, because of her excavation of archaic, erotic modes of bodily movement. He quoted Hegesa as saying that when she choreographed herself she kept in mind the image of ancient Greek movement choirs such as appear on vases, not the ladylike Grecian dances of Duncan but those “which in our highly developed culture come into conflict with the censor; I think moreover of the splendid nude dances of the youths and girls of the gymnasium. I think
168 SOLO DANCING of the stylized erotic dances from the island of Lesbos and the satyr plays and faun dances of the Phrygian Dionysian festivals.” However, the Hegesa Tango (1922), which Kool also scored for full symphony orchestra, was a dark (E minor), lilting, haunting piece, never loud for a single measure, with a melodic theme built out of the letters of her last name. In 1919, while collaborating with Hegesa in Berlin, Kool also worked with Anita Berber,
composing for her the music for her Pritzel Doll dance and the piano arabesque Profane (1920), which Hegesa actually danced. In other words, collaboration with Kool implied pursuit of an aesthetic that blurred distinctions between high cultural seriousness, exoticism, and the mondaine salon.
But Hegesa had her own ideas about blurring the distinctions. She delighted in cultivating a complex, unstable image of dance, which she reinforced through her affiliations with visual artists. She may have been the first modern dancer to wear the Bubikopf, or pageboy haircut, adopting it as early as 1917. In Rotterdam the artist Herman Bieling (1887-1964) did a series of etchings of her dancing, one of which now resides at the Nederlands Theater Instituut (Figure 42). This image from 1917 depicts Hegesa performing her Groteske and suggests a sort of manic extravagance in her movements, as if the dance had twisted her body into a fantastic, muscled plant with weird blossoms and sprouts, her foot almost violently rooted into the ground. The picture also contains six tiny human figures—homunculi images of different movements of the same dance. The following year Bieling painted a large portrait of the dancer (also deposited at the Instituut), an astonishingly beautiful piece of expressionism, full of powerful colors (Figure 43). However, it shows her on pointe (in ballet slippers), holding a pose, with eyes closed and head turned away, crowned by a large wig. She
wears an enormous skirt decorated with a hieroglyphic expressionist design. Deep in the background, which is traversed by abstract geometric
shapes and intersecting layers of planes, stand three women in bathing , suits, two with their backs turned, the third gazing not at the dancer before her but at something concealed from both the dancer and the spectator. It is a most fascinating portrait because it dramatizes the perception of dance as a highly artificial construction of identity that moves both the body and space toward abstraction: the dancing body transforms space into a kalei-
doscopic skewering of geometric order.
But Hegesa did not confine her image to these visions. For photographer
Nicola Perscheid she appeared in luxuriously decorative and sometimes exotic-Oriental costumes; for Berlin photographer Ani Riess she posed ina low-cut, expressionist minidress with an extravagant collar, often before backdrops of swirling expressionist arabesques (Elegante Welt, 8/11, 1919; Kool, Tanzszene, frontispiece). Then she posed for the fashion page: in lush kimono, with legs exposed, reclining voluptuously on a divan before a luminous Oriental screen; modeling a suave afternoon cloak and dress (Elegante
SOLO DANCING 169 Welt, 9/14, 1921, 20). Despite her considerable beauty and her peculiarly large, captivating eyes, one hardly recognizes Hegesa as the subject of these images, so preoccupied was she in disclosing new aspects of her identity. Suhr reproached her (as well as Kieselhausen and Berber) for her eagerness to produce such worldly, hedonistic images of herself, but he did not think they concealed a weak dance aesthetic (WS 37). In 1920, Hegesa began starring in movies, including at least two tragic melodramas directed by E. A. Dupont, Der weisse Pfau (1920) and the twopart Kinder der Finsternis (1921), in which she played an American heiress in
Italy. She received strong praise for the sophistication of her acting (Paul Leni, 266-267, 279-281). Der weisse Pfau, an adaptation of a play by Dupont
and Paul Leni, described the doomed effort of an English aristocrat to transform a child gypsy cabaret dancer, Maryla, into a lady. Class prejudices prevent the romance from succeeding, so the dancer goes her own way as
Marylova and becomes famous, especially for her dying white peacock dance (modeled, obviously, on Pavlova’s dying swan). Years later, the aristo-
crat cannot forget her, but it is too late: she performs the dying peacock dance, then dies herself when the theatre catches fire. Hegesa later incorporated a white peacock dance into her concert programs, with music by Kool, and this dance, using a feather costume, contrasted significantly with the film version. The concert dance began with the peacock strutting proudly and narcissistically, then confronting a motionless demonic idol. At first the bird expressed belligerence and fury at the
idol for its lack of response, then displayed intense fear of a monstrous doom. Seeking to avoid this fate, the bird bestowed affection and worship upon the idol, but when these failed to produce any response the peacock resumed its proud, haughty strut (Kool, Tanzszene, 5). The dance appeared on a program Hegesa and Kool brought with them to Holland in 1921, but this time they performed in a theatre entirely associated with cabaret. One __ reviewer felt her art was too serious for such a context; her dancing, which made the theatre “as silent as a temple,” required too much concentration
and lacked the casual informality the cabaret patron expected (“Grit Hegesa”). In 1924 or 1925, Hegesa married the painter Emil van Hauth (1899-?), from Cologne but resident in Berlin. In him, she inspired a fascinating, mysterious portrait of “a type of female youth unknown until lately” (The Studio, 92/401, 14 August 1926, 134) (Figure 44). But after this point, one loses trace of her. The final piece of evidence for the dance aesthetic of Grit Hegesa comes from a program for a concert of her expressionist dances sponsored by De
Branding in Rotterdam on 1 February 1919. Kool preceded the dances themselves by giving “ideas on modern dance art,” and the program itself announced that dance, which did “not provoke sexual stimulation,” could offer “the most beautiful expression of all human feelings” and that the
170 SOLO DANCING dances of Grit Hegesa would “evoke the dark spheres of the tragic.” Florrie Rodrigo assisted Hegesa in two of the dances. In all but the last two pieces, Hegesa wore pants of one sort or another. She began with a waltz, then per-
formed a coolie dance in baggy silk pants, silk shirt, and conical hat, employing symmetrical movements in accordance with the symmetrical rhythms Kool associated with Oriental music. Next came the grotesque dance already discussed and the Leisure Hour of a Page, an example, apparently, of what Suhr identified as “psychic perversities” in her aesthetic (WS 35). Then, with Rodrigo, she performed a pantomimic Pierrot and Pierette
dance: Pierette (Rodrigo), having returned from a ball, danced a tired, happy, “harmless” waltz until she sank into sleep. Pierrot (Hegesa) then entered, pirouetting exuberantly, but abruptly became delicate upon noticing the smiling slumber of Pierette. He took the flower that had dropped from her hand and danced with it tenderly, joyfully, reverently, then sank down to kiss Pierette on the neck. In her sleep, Pierette extended her arms to embrace the lover of her dream, but when Pierrot awoke her to her feet, her disappointment and fear drove her immediately from the scene, leaving Pierrot to sink back into the pillows. After the intermission, Hegesa performed a “melodrama,” Der Held, based on a story by Rabindrath Tagore. She followed this with a “Japanese scene,” assisted by Rodrigo: a servant (Rodrigo) entered, lighting lamps and arranging flowers and pillows. Then an elegant Japanese woman (Hegesa) appeared, wearing a “splendid headdress” and the red obie of mourning. She sank to the pillows, and immedi-
ately an ominous mood pervaded the scene; the face of her dead lover glowed briefly in the lamplight, calling to her. The image filled her with great longing. She called for the poisoned flower petals, which she kissed; then, in silence, she sank to her death on the pillows (Kool, Tanzszene, 5). A
samurai dance followed the Japanese scene, and it, like the grotesque dance, had “nothing to do with feminine beauty or charming gracefulness”; then a scherzo, in which she wore the strange, expressionist minidress, and
a Slavic dance, about which I know nothing other than that it was in a melancholy vein. A reviewer expressed dissatisfaction with the Pierrot and Tagore pieces because Hegesa play-acted too much at impersonating a male and therefore looked liked a “childish young woman,” in sharp contrast to the “powerful
expressiveness” of the other pieces. The reviewer also noted that Hegesa moved often on tiptoes, which suggests that she had ballet training (“Grit Hegesa”). Nikolaus thought she was too intellectual to embody expressionist dance: her will to dance, her intensity of concentration, was stronger than the feeling she constructed (46). And Suhr felt she danced elegantly, especially with her arms and hands, but “without the trace of a soul” (WS 35). However, these writers were consistently skeptical of dancers who relied on pantomimic-decorative effects, an aura of luxurious and even per-
SOLO DANCING 171 verse refinement; they did not deny that Hegesa presented a strong, serious personality and a smooth technique. The perversity of her aesthetic was perhaps most evident in a dance not performed at the Rotterdam concert. She impersonated a Javanese prince, who sat in the lotus position on pillows and decorated himself with jewels and paint in preparation for his wedding. He rose only in anticipation of meeting his bride, and when she did not appear, he returned to the lotus position and sat, motionless, waiting for her, having become, so to speak, the idol that had appeared in the peacock dance. What made Hegesa unique was the extent to which dance mutated her personality. She seems to have relied on the symmetrical technique of move-
ment, whereby one part of the body mirrors another, for almost all her dances. She displayed a distinct style of movement and a distinct taste in costume, yet she delighted in not being “recognizable,” of being someone else every time she appeared, a stranger to her own image. CHARLOTTE BARA
Charlotte Bara (b. 1901) was perhaps an even stronger inspiration for artists than Hegesa, but the image and the aesthetic she projected were also
far more stable. She was born in Brussels of German parents and began dance studies there under a woman who had been a student of Isadora Duncan. She took lessons from Alexander Sacharoff in Lausanne in 1915 and gave her first concert in Brussels in 1917, at which time she presented her Egyptian mummy dance, the prototype for her entire dance aesthetic. The war finally compelled her family to leave Belgium for Holland, where Bara
studied Javanese religious dance and became fascinated by the mystical dances of Rodan Mas Jodjan. Soon thereafter she and her mother resided briefly at the utopian art colony of Worpswede, near Bremen, where the maverick communist artist Heinrich Vogeler painted two famous portraits of her, “Die Frau im Krieg” (1918) and “Die Tanzerin Charlotte Bara” (1918). As Vogeler himself put it, she projected a memorable expression of the “trust, imploration, and despair” defining the female victim of war—or, more precisely, the sanctification of the feminine by war (Kuster 112) (Figure 45). In 1919 she moved to Ascona, where her father had purchased a huge estate with the plan of creating a large park for the performing arts. During the renovation of the estate, however, the family resided for several years in Berlin, where Bara became a celebrated symbol of salvational mystery within the arts community. She appeared (1919) at Max Reinhardt’s Kammerspiel; Moissy Kogan produced woodcut images of her; and Christ-
ian Rolfs painted her dancing (Meyer). Georg Kolbe published a set of drawings depicting her Egyptian dances, and Ani Riess photographed her (1920) using an expressionist backdrop (as she had with Hegesa) as Bara presented her Gothic dance Hymnis, in which she wore nothing but a dark
172 SOLO DANCING veil. This quite erotic religious image did not appear in the journal Roland (23/33) until 1925. Soon Rochus Gliese filmed Die gotischen Tanze der Charlotte Bara (1923),
which apparently has not survived, and the artist Hugo Windisch began designing medieval and Renaissance costumes for her dances. She cultivated a friendly association with the new Wigman-oriented school opened in Berlin by Berthe Trumpy and Vera Skoronel in 1924. In 1925 she produced her first group work, Totentanz, which provoked much acclaim, although it was actually a revision of a death dance she had performed solo since 1920. Afterward she performed in Paris, where Fernand Divoire spoke warmly of her art (94-95), and in Florence, where she attracted the enthusiasm of Gabriele d’Annunzio and Anton Bragaglia, whose book, Scultura vivente (1928), explicated the principles of her dance aesthetic. With Bragaglia, she staged (1925) dances in ancient Roman ruins. But Bara was also busy with productions in Locarno and Ascona for various festive occasions in parks and plazas as well as the Kursaal Theater. In 1925 the great villa Castello San Materno finally became the family home, and there she and her husband, the psychiatrist Carl Rutters, operated a school for dance, the-
atre, and singing (1927), with a special curriculum in therapeutic dance. Her father built for her a most unusual theatre, seating 180, that could accommodate different modes of performance: dance, cabaret, theatre, lectures, and experimental or classroom activity. The design, by Bremen architect Carl Weidemeyer, allowed structural units to be moved in relation to the objectives of a particular performance; moreover, large glass windows provided spectacular views of the Swiss landscape, and it was even possible to give open-air performances on the rooftop amphitheatre (Wels). From the late 1920s until around 1940, Bara produced most of her many works in this theatre, which also attracted many distinguished guest artists, such as Rosalia Chladek, Valeska Gert, Lisa Czobel, Rodan Mas Jodjan, and Trudy Schoop, as well as numerous cabaret acts, including Erika Mann’s Pfeffermuhle, Dela Lipinskaya, and Rudolf Nelson. However, financial difficulties plagued the Teatro San Materno in the 1940s, and it was not until 1952 that Bara resumed her dance productions for it. Her final dance concert was in 1958, after which it became increasingly used as a site for experimental or chamber theatre productions (Stadler, “Theater,” 130-132).
But despite her exposure to so many diverse artistic currents, Bara’s dance aesthetic remained stable throughout her life and almost unchanged from the time of her first concert, Tanz der Mumie (1917), presented in Brussels. She produced a huge number of dances, yet such prolific creativity depended on a certainty of purpose and, indeed, upon a facile treatment of bodily expressivity that never encountered any dramatic measure of doubt. Perhaps her dance aesthetic was even less complex than that of the Bode, but it was definitely more grandiose and much more expressive of a unique
SOLO DANCING 173 personality. Bara suffused all her dances with an aura of religious mystery. At first the image of religious idolatry came to her from archaic Oriental or Egyptian iconography, but in Worpswede and Berlin she started adopting Gothic and then Renaissance models of holiness and beatification. Dance commentators consistently referred to her “Gothic dances”; however, after making her film with Gliese (1923) she called them “sacral dances.” These were numerous and completely detached from any church or proselytizing objective: Trauermarsch (1919), Aegyptisches Mysterium (1919), Madonna (1920), Die Bisserin (1920), Die Aegypterin (1921), Antike Grabschrift (1921), Aegyptischen Tanz (1922), Muzierende Engel (1924), Kreuzzitter (1924), Anbetung der Engel (1926), Gottertanz (1927), Die Vistonen der Jeanne d ‘Arc (1932), Das verlorene Paradies (1934), Die Versuchung in der Wiiste (1934), Bilder aus der Passion (1935), Mittelalterliche Legende und Visionen aus dem Orient (1939),
Danza dei Beati (1952), Indische Gottheit (1953), Judith (1955), and Flucht nach Aegypten (1955).
This hardly complete list suggests that Bara regarded dance as the way to
reconcile a basic, lifelong tension in her between archaic Eastern and medieval Christian images of mystery. She identified mystery with an atmos-
phere of salvational transfiguration, not with a moral doctrine nor with meditations on the existential structures of good and evil. That is to say, her
dances derived from images of religious feeling, not from gospel, even when, during the 1930s, she began structuring her dances according to narratives in the Bible. Egyptian and Oriental dances always remained a part of
her repertoire, for in spite of its Near Eastern origin, Christianity could never synthesize Western and Eastern modes of mystery—only dance could do that. Seldom did she even use religious music to accompany her dances, preferring instead secular romantic and modern music by composers such as Scarlatti, Franck, Debussy, Grieg, Bartok, and Malipiero. In the 1950s she
started dancing to Renaissance music played on authentic Renaissance instruments, whereas in 1920 she performed several dances in holy silence, without any accompaniment at all. Her dance aesthetic changed little in the intervening three decades. For Bara, dance was ecstatic to the extent that it was peaceful, an expression of luminous serenity, exalted tranquility, shadowy resignation. The ecstatic body in her mind transcended violence and struggle; dance was a release from destructive impulses and perhaps even from awareness of danger. Her dances were not naive or harmless, however—they were mysterious; they signified a cosmic remoteness from the modern world and identified innocence with a gentle, graceful movement into an eternal, idealized, crepuscular past. Visual artists admired her because she modeled her dances after paintings and sculptures; spectators saw the body rather than the movement. She never moved with urgency, nor did she move, as Schrenck did, with a plodding sense of burden. When she swung her arms, she conveyed
174 SOLO DANCING
the lilting, pendulumlike motion of a priestess dispensing incense. She moved through a sequence of obviously “pious” categories of bodily signification—prayer, invocation, supplication, meditation, imploration, annun-
ciation, baptism, annointment, sacrificial offering, reverie, lamentation, adoration, resignation, and ascension. Such were the bodily dynamics designating mystery, all performed with the same eternal rhythm signifying transcendence of temporal discontinuity. Humility pervaded every move-
ment; she neither smiled nor frowned but projected a visionary gaze of serene concentration fixed upon the image of God. Fear rarely entered into the aesthetic, neither fear of God nor fear of Satan—most peculiar in work of a religious nature, which usually depicts harrowing sacrifice as a prerequisite to redemption. Even in her grotesque religious dances, she avoided the iconography of devils or demons and focused on strange incarnations of idolic femininity: art deco Isis. Yet seldom did she employ recognizably religious costumes such as cowls, monastic habits, or ecclesiastical robes. Instead she danced in long, flowing smocks, diaphanous veils, and elegant nightgowns, often appearing less like an austere holy woman, or sibyl, than
a good princess prepared for a good night’s rest. On only one occasion (1932) did she ever employ masks. Many images from the 1920s show her in headbands and long silky hair, looking startlingly like a hippie flower child of the late 1960s. In 1921 Blass noted that her sense of movement seemed dominated by the image of procession (38), and the dance critic for the Deutsche Allgemeine
Zeitung, Fritz Bohme, complained in 1922 (7/2) and again in 1923 (10/2) that Bara displayed a painterly style, derived from images by Grunewald and
Breughel, but no dance technique; in her Madonna she danced the image of a “world without sin, a world without the burdens of human weakness or stumbling into misery or torture over earthly things.” Schikowski, in 1926, was more benign: “The Gothic style she pursues has little of the elementary, ecstatic weight of the old Gothic—it is a mild, gentle, bourgeois, modernized Gothic and stands nearer to the English Pre-Raphaelites than to the spirit of the Middle Ages. And yet it has its moments which reach deep into the soul to produce a stirring sense of beholding. A convulsive, whirling leap, a powerful uprightness of her figure, a sinking of the head with a fold-
ing of all lines, an unresisting, surrendering plunge create images of entirely new and unusually strong expressive power” (151). But he observed that this “abstract style” was not an “expression of bodily form but of the pure language of line and shape. A fist lifts high and spreads the fin-
gers; yet one no longer sees the arm and the hand—one sees a shooting white line and something balled up unravels and transmits an ignited radiance.” Ultimately, however, such an aesthetic of the body and movement did
“not penetrate the heart”: “[T]he eye enjoys the strict linear rhythms of
SOLO DANCING ~— 175
well-patterned attitudes and movements, but our feeling for the body does not resonate with it” (152). The exception to these judgments, according to Blass, was her solo Totentanz (1920), in which she expressed the strength of desire rather than the bliss of contentment: “Here [dance] hunts, drums, rides, hacks, struggles, sprouts, sprouts so powerfully, so irresistibly that the future of Charlotte Bara seems to lie in the expression of unrest, movement, and questioning of the soul” (40). But Bara returned to the death dance theme only twice. The Totentanz of 1924 was her first group work and derived its imagery from the famous woodcut series of Hans Holbein. The 1943 Totentanz, done at San Marteno, was also a group work and again followed the medieval model of Holbein: with the original sin of Eve, Death, in processional fashion, takes everyone—king and queen, knight and fool, farmer and courtesan, young girl and money lender, physician, beggar, monk, innocent child. Bara herself danced the role of Death, in the stiff manner of a woodcut, moving in a circle around a medieval bell clock (Stadler, “Theater,” 131). But the death dances were clearly not typical of her aesthetic. The compulsion to transcend death was the reason for the absence of fear or desire in her other works and for the need to create a religious body dynamic that was too mysterious for Christian morality alone to explain: the image of the mummy
loomed over her entire aesthetic, the frozen, eternalized image of the human body. Thus, in almost direct contradiction to Wigman, Bara treated movement as a sign of rest rather than restlessness and thus, too, as an antidote to the convulsive destruction inflicted by the shadow of death upon a body too eager to submit to the rhythms of its desires. SENT M’AHESA
Bara obviously constructed a unique significance for Egyptian dances within her sacral dance aesthetic as a whole, even though audiences persisted in associating her with Gothic dances. Such confusion of identity did
not apply in the case of Sent M’ahesa (Elsa von Carlberg [1893-1970]), whom audiences persisted in identifying with Egyptian dances (though her dance aesthetic included images from other ancient or exotic cultures). She performed all her dances solo. Born in Latvia, she went to Berlin in 1907 with her sister to study Egyptology but became so enchanted with ancient Egyptian art and artifacts that she decided to pursue her interest through dance rather than scholarship. It is not clear whether she saw Ruth St. Denis perform her Egyptian dances in Berlin in 1908. At any rate, under the name of Sent M’ahesa she presented a program of Egyptian dances in Munich in December 1909 (Ettlinger). From then until the mid-1920s, she achieved fame for her exceptionally dramatic dances dominated by motifs
176 SOLO DANCING from ancient Egyptian iconography. She was apparently an aristocrat who felt no need to establish a school in which to perpetuate her aesthetic. In the mid-1930s she moved to Sweden, settling in Stockholm in 1938 and becoming a Swedish citizen in 1946. There she did some journalism and worked at the Stockholm dance museum. It is not clear that Sent M’ahesa ever visited the cultures she appropriated; many of her ideas likely came from images she encountered in Germany. Sent M’ahesa took ballet lessons in Berlin, but she was a barefoot dancer whose debt to ballet rested primarily on her cultivation of an elegant bodily aura. She applied a very scholarly sensibility to her dances, yet she was no pedant and did not subordinate aesthetic power to academic authenticity. Moreover, in constructing her Egyptian dances, she extended her sense of detail almost exclusively to ancient Egyptian images. She did not reconstruct ancient Egyptian dances, unlike Irene Lexova in Prague, whose father was a famous Egyptologist and whose versions of Egyptian dances, in the late 1920s, deliberately contrasted with the common perception of formal stiffness associated with the Egyptian image of the body (EST 100-103; Lexova). But, as Brandenburg observed, Sent M’ahesa did “not want to show Egyptian art, but rather the relation of a modern, European person to this art.” In this respect she was significant, not because of her scholarly objectivity but because of her complex subjectivity, her “entirely personal interpretations of [archaic] creations” (56). This point seemed reinforced by her determination not to create an elaborate “illusion” of Egyptian culture,
for she performed most of her dances, not all of which were Egyptian, before a tapestry (HB 57). In other words, she consciously strove to present an image of the body that was out of context. Her dances always functioned in relation to intricate, highly decorative costumes of her own design, so that it appeared as if she chose movements for their effect upon her costume. In her moon goddess (or Isis) dance, she attached large, diaphanous cloth wings to her black-sleeved arms. Around 1915 she wore a large, Pharaonic helmet when she danced this piece, but
around 1920, with the choreography unchanged, she wore a short white skirt and a small, tight, cloth tiara, large earrings, and heavily bejeweled top.
The 1915 costume produced greater ambiguity of sexual identity, but the 1920 image produced a greater impression of purely feminine power (HB plate 26; Ettlinger 33). Sent M’ahesa often exposed her flesh below the navel, but I have yet to find a picture of her in which she exposed her hair, so keen was she on the use of wigs, helmets, caps, scarves, kerchiefs, tiaras, masks, and crowns. In her peacock dance, she attached a large fan of white feather plumes to her spine. In other dances, she draped herself with tassels, decorative aprons, double sashes, layers of jeweled necklaces, and arm, wrist, and ankle bracelets. Only in her Indian dances did she wear anything resembling pants. In one, her legs simply appeared to move within two
SOLO DANCING 177 large, voluptuous veils; in another, she wore what look like highly ornamental pantyhose complemented by shoulder-length gloves (Nikolaus 37; HB plate 21). Her costume for Salambo (1919) was especially complicated: she covered her left arm and left leg in matching decorative sleeves, leaving the right arm and leg exposed. An ornamental chain was attached to each
ankle—she danced in shackles. She further emphasized the sense of her body’s being reined in by applying a jeweled neckband, a tightly bound kerchief, and layers of swirling sashes around her waist. Yet she did not convey an impression of being oppressed; on the contrary, she appeared to surge with ecstatic energy, as if her body gave her great pleasure in spite of her own desire to restrain it. Photographs indicate she may have “bronzed” her skin to exoticize her body even further. In 1924 Fritz Giese, though quite enthusiastic about her dances, said that
Sent M’ahesa was “neither beautiful nor young” and that her dance aesthetic was “antierotic” (FGK 174). Such a statement might explain her focus
on decorative costume effects. But I find Giese’s comment obscure: her body was wonderfully svelte, and her face displayed a cool, chiseled beauty. I think, rather, that she sought to decontextualize female beauty and erotic
feeling from archetypal images of them originating in cultures other than her own or her audience’s; she sought to dramatize a tension between a modern female body and old images of female desire and desireability. Ettlinger, in 1910, was perhaps more accurate when he remarked that Sent M’ahesa’s dance has nothing to do with what one commonly understands as dance. She does not produce “beautiful,” “sensually titillating” effects. She does not represent feelings, “fear,” “horror,” “lust,” “despair,” as “lovely.” Her art requires its own style. Her movements are angular, geometrically uncircular, just as we find them in old Egyptian paintings and reliefs. Neither softness of line nor playful grace are the weapons with which she puts us under her spell. On the contrary: her body constructs hard, quite unnaturally broken lines. Arms and legs take on nearly doll-like attitudes. But precisely
this deliberate limiting of gestures gives her the possibility of until now unknown, utterly minute intensities, the most exquisite refinements of bodily expression. With a sinking of the arm of only a few millimeters, she calls forth effects which all the tricks of the ballet school cannot teach (33-34).
What is especially peculiar about Ettlinger’s description is the perception that Sent M’ahesa put the representation of feelings in quotation marks, so to speak, by using a style of movement that was incongruous with expected significations. Brandenburg felt she subordinated movement to a pictorial effect and therefore unnecessarily reduced the powerful expressiveness of her body (57-58; WS 48). She moved primarily in two dimensions and displayed little inclination to develop a sense of depth within the performance space. Her body consistently moved in profile and often within a very narrow zone close to the tapestry backdrop (Figure 46). Within this restricted
178 SOLO DANCING space, her body stirred with tension-laden movements. She carefully coordinated the sinking or lifting of her head, for example, with the precise raising of one arm above her head and the other arm above her waist; the fin-
gers of each hand, pressed tightly together, trembled delicately and somehow caused a leg to rise and bend at the knee, the foot dangling elegantly in a pendulum motion. Sometimes she performed such complicated movements very rapidly, giving rise to the perception that she had a “very well-trained body” (KTP 4, 1920, 119-120). Yet she never gave an impression of fragility. In her Isis dance, she knelt down with her great wings outspread, head back, eyes shut, and conveyed a most provocative effect of femininity opening up to a yearned-for power that it will soon enclose; on her feet, she marched, erectly, then in a lunge, with the wings wrapped around her like a mysterious armor, her eyes still closed, as if the wings, driven by a
force deep inside her, propelled rather than uplifted her.
Ettlinger mentioned that Georg Capellen composed all the (piano) music for Sent M’ahesa’s 1910 concert, and from then on she apparently used only music written specifically for her dances, although it is not clear how long her collaboration with Capellen lasted. In 1920 a reviewer of a Hamburg concert complained that Walter Zaun was not an appropriate accompanist for her, but a year later he praised the sensitivity of a “Director Frisch” at a concert in Nordhausen. In Berlin in 1922 she appeared as the first, “tragic” half of a program on “the tragic and the gay dance” with Ronny Johansson and Ernst Blass, who gave an introductory lecture. Margrit Goetz
accompanied both dancers, but although the program (deposited at the Cologne Tanzarchiv) listed composers for all the pieces danced by Johansson, it did not identify the music for any of Sent M’ahesa’s five dances or a costume intermezzo. It is possible, then, that she used music so severely
modified through various collaborations and adjustments to her bodily movements that its authorship was no longer clear. The music became convoluted because the bodily movement, to achieve dramatic effect in such a
confined space, became convoluted, tending toward ever more precise refinements.
Sent M’ahesa was similar to Schrenck in one respect, even though Schrenck never performed exotic dances: both projected an intensely | erotic aura while moving within a very confined space. They showed persuasively that convincing signification of erotic desire or pleasure did not depend on a feeling of freedom in space, as exemplified in the conventions of ballet and modern dance, with their cliched use of runs, leaps, pirouettes, and aerial acrobatics. These dancers revealed that erotic aura intensifies in relation to an acute sense of bodily confinement, of the body imploding, turning in on itself, riddled with tensions and contradictory pressures. They adopted movements to portray the body being squeezed and twisted, drifting into a repertoire of squirms, spasms, angular thrusts, muscular sus-
SOLO DANCING 179 pensions. Contortionist dancing is perhaps the most extreme expression of this aesthetic. But Sent M’ahesa complicated the matter by doing exotic dances—that is, she confined her body within a remote cultural-historical context, as if to suggest that the ecstatic body imploded metaphorical as well as physical space. Perhaps this point appeared most evident in her coral tree
dance, given at the 1922 Berlin concert, which contained only Asian dances. She signified the slow, gorgeous blossoming of a coral tree without moving from an initial position in the performance space, employing considerable inventiveness in the ornamentation of her movements. This aesthetic, even when she appropriated Indian, Bedouin, Siamese, or Javanese cultures, derived from her love of Egyptian art, which was the complete distillation of it. But, unlike Bara, Sent M’ahesa did not associate Egyptian art
with a sublime aesthetic of death; rather, she saw in it the revelation that images that strongly confined or “froze” the body were ultimately the source of the ecstatic desire to make the body move. The body did not need more space beyond the image for movement: it needed to become itself the space containing movement.
ELLEN TELS AND MILA CIRUL
Perhaps even more than Sent M’ahesa, Mila Cirul (1901-1977) demonstrated the degree to which German dance ideology could suffuse with ambiguity not only its own cultural identity but also that of the dancer. Like Sent M’ahesa, Cirul was born in Latvia. The example of Isadora Duncan inspired her to become a dancer, but she began with the study of classical
ballet technique in Moscow under the famous dancer Mikael Mordkin (1880-1944). At the same time, she studied Delsartian semiotics and the early “biomechanics” of theatre director Vsevolod Meyerhold (18741940), whose “intention-realization-reaction” theory of physical action incorporated ideas from gymnastics, acrobatics, fencing, sports, circus acts, and commedia dell’arte (Braun 197-206; Robinson 133). In 1918 she entered the then influential school and company of Ellen Tels (aka Ellen Rabanek [1885-1944]), the daughter of a German baker in Moscow. Tels pursued a
kind of pantomimic dance derived from Delsartian principles, although she, too, had studied with Mordkin. Her “dance idylls” attracted audiences in Germany, Austria, and even England between 1911 and 1914, partly because she aligned pantomimic movement with literary scenarios, as in her Chrisis (1912), coordinated with music by Reinhold Gliére, which evoked erotic texts by Pierre Louys (Suritz 407). Tels and Cirul began dancing as a pair, but in 1919 Tels saw no future
for her company in Russia and moved to Vienna, taking Cirul and three other women with her. Soon her school-company, which briefly included Ellinor Tordis, was producing dance pantomimes of great refinement and
150 SOLO DANCING very subtle, delicate bodily rhythms, free of metricality. In 1921, Brandenburg described one of these dance pantomimes, Mozart’s Les petits riens, as being the “nerve” of rococo without being an academic imitation of it: “It is a series of dainty solo dances, tender gavottes, flirtatious war, erotic cun-
ning, snatching and concealing, carnivalistic processions, masquerade interludes and a pantomime in which the jealousy of a masked girl, stuck in a cage of green silk, enacts her suffering acrobatically and everyone executes their actions stiffly, convulsively, like dancing marionettes—yvet it all remains a single flow of movement, in which costume and mask are nothing but a play of light and color that only make the waves livelier. That is no ballet in an antiquated sense of dance craftsmanship.” (126). Brandenburg did not think much of Tels herself as a solo performer (“too rational”) but hailed her as a rare “symphonic creator” of elegantly pliant group move-
ment (although, he complained, the pantomime approach tended to end every dance in a tableaux vivants pose). Tels apparently had a strong gift for what I would call “theatricalized rhythm,” a skill of seeing the movement potential of theatrical devices: purple and white—clad dancers bearing baskets set in tension with gold-clad dancers tapping gold cymbals with mallets; an entire ensemble moving while wrapped in a great veil (Rochowanski, Tanzende 37-38). A girl might swirl like the wind while other dancers undulated like flowers, but with Tels this sort of narrative premise always led to dances in which “movement became visible” rather than a mere imitation
of nature (HB 127). In Vienna, Tels produced nearly fifty dance pantomimes, many for opera productions, and in 1924 she collaborated, as scenarist, with composer Egon Wellesz on the Persisches Ballett, which Kurt Jooss
actually choreographed and presented at Donaueschingen (Amort 394). In 1927, however, for reasons that are obscure, Tels moved to Paris, where Janine Solane (b. 1912), among others, became her student. Meanwhile, Cirul’s star began to rise. In 1926 she and Tels gave a concert in Frankfurt attended by Mary Wigman. Ensuing conversations with Wigman urged Cirul to rethink her dance aesthetic in relation to submission to unconscious forces, and for awhile she worked in complete solitude (AI 21). Then her career suddenly began to blossom: she became a soloist at the operas in Vienna, Hanover, and Berlin, and in 1930 she performed with Margarethe Wallmann’s Tanzgruppe 1930 in Berlin and at the big Munich Dance Congress. Unlike Tels, Cirul liked to dance violent, passionate modes of feeling, often with music (Bach, Handel) seldom associated with violence or passion—as in her Barbarischer Tanz (1930), using Bach’s music, or Niobe
(1931), wherein pride, terror, and sorrow struggled within her, or in Wallmann’s Orfeus Dionysos (1930), set to Gluck’s music, in which she impersonated the Priestess of Death. In Russischer Tanz (1929), “she symbolized the sufferings of revolutionary Russia” through the figure (judging from the heavily buttoned dress she wears in a photo) of an austere middle-class
SOLO DANCING 181 woman, not a peasant. The photo is quite interesting: one foot (wearing high heels) firmly planted, the trailing foot on tiptoe in peculiarly Wigmanesque fashion, the body arcing backward, head tilted back, eyes closed, arms spread wide and flinging a dark mantel. At first glance it looks like a surge of ecstasy, but the face, with its dark eyes and mouth shut, conveys a beautiful tinge of melancholy, reserve, or uncertainty: it is a dark ecstasy, a great pulsation of movement, learned from Wigman, complicated by attention to the delicate detail—the “exact expression,” as Cirul put it—learned from Tels.
In spite of her success in Germany, Cirul was seeking something she could not find there, for in 1932 she, too, migrated to Paris. However, she did not resume collaboration with Tels; instead she worked for several years in partnership with the French critic Fernand Divoire, who was immediately captivated by her smoldering temperament and her ability to enlarge every space with her intensity of feeling. She received great acclaim for her version of Strauss’s music for Salome, presented at the Comédie Champs Elysees in 1934. Then her sister Elia began dancing with her in complex duets, of which Tentation (1935), with scenario by Divoire, was an example. This piece dramatized the struggle between consciousness, performed by Mila,
and the unconscious, performed by Elia—thus, two bodies dramatized aspects of a single persona. Accompanying the dance were two voices, both male, in dialogue not only with each other but with the dancers as well. A
stunning photograph suggests the sleek image of the modern psyche she sought to create (Figure 47). But this provocative “association of literature, philosophy, and movement did not make a strong impression on the audience” (AI 21; Divoire 287). Cirul continued dancing until the early 1940s and taught many signifi- . cant French dancers until 1962, when she retired to Nice. Though critics tended to consider her an avant-garde dancer, her Wigmanesque submis-
sion to bold, “instinctual” movement always remained subordinate to a strong sense of dramatic structure and detail gained from the pantomimic aesthetic of Ellen Tels. Cirul did not embody the unconscious force, as Wigman did; rather, she dramatized, through movement, a struggle within herself between consciousness and the unconscious. Indeed, one might even say that the relation between pantomime and the Wigman aesthetic constituted a major tension between self-consciously and unconsciously driven
forms of dance. But the synthesis of the two forms in Cirul produced an identity that was neither German nor French nor Russian but always alluringly foreign, always the restless movements of an exquisite body seeking something more or other than that yielded by the space it occupied. Her image of movement toward death was at once less abstract than Wigman’s and more clearly identified with the abstract dramatic structure of the dance, rather than with bodily movements, as in her ironically entitled Le
182 SOLO DANCING Chemin de la Vie (1947), a collaboration with Divoire, using music by Liszt.
In scene after scene, death arrived at the ball, the war, the revolution, the modern city of lovers, and led all the dead in a final, grand procession of death . . . into darkness, somewhere else. No frozen pose to end the scene. NIDDY IMPEKOVEN
“She would be a great dancer even if she had been born a cripple”: such was
the judgment in 1920 of theatre critic and producer Felix Hollaender regarding Niddy Impekoven (L. Impekoven 15). Probably no other dancer of the era more strongly evoked an aura of feminine innocence and genial-
ity than Niddy Impekoven, yet she spent much of her career struggling against efforts to mold her body according to an image that conflicted with her desires. She was born in Berlin in 1904; her father was a prominent
actor, and her family contained many members involved in one way or another with the arts. She began dancing at the age of three to phonograph records played by her father: “Papa was always entirely absent when he sat at the phonograph; his upper body throbbed up and down to the rhythm of the music, and his gaze was directed toward the waltz which one saw coursing somewhere beyond the glass window. So I did not feel I inconvenienced him at all by what I wanted to do: to dance, in which I had quite a model in his surrender to the music. I always danced what he played” (N. Impekoven, Geschichte, 22). Throughout her career, music remained for her the chief motive for dance movement. Her charm and precociousness hardly went unnoticed, and, unlike so many other dancers, she did not have to battle family prejudices to establish her identity as a dancer. On the contrary, she had to battle pressures to meet the demanding expectations imposed upon an artistic prodigy. She was constantly an object of inspection. At the age of six she posed nude for a sculptor’s photographs, a circumstance that struck her as excru-
ciatingly boring because she could not move for long periods of time ( Geschichte, 23). In 1910 she began ballet lessons with the first soloist of the
Berlin Municipal Opera, and the same year she danced publicly for the first time, at which time the press acclaimed her as a prodigy. At the outbreak of the war, her family moved to Munich, where her parents compelled her to continue ballet studies, but these she regarded as painfully constricting and deadening: a collection of postcard photos depicting Anna Pavlova inspired her more than the bankrupt rhetoric of ballet did. During the war she danced for patriotic occasions and suddenly acquired a startling number of fans, not all of whom were children. The great moment in her education came when her father permitted her to study for six weeks at the Loheland school in summer of 1918; there she experienced a freedom and awareness of bodily expression that decisively con-
SOLO DANCING 183 firmed her desire to dance (72-75). Her father, however, felt the Loheland approach lacked rigor, so she took some lessons from perhaps the most prominent ballet master in Germany, Heinrich Kroller (1880-1930), who appreciated the uniqueness of her talent.
But her health was always delicate; the arduous ballet training had turned her into a dispirited “skeleton,” and at the age of fourteen she decided it was time to test the authority of her painful education. She gave her first solo concert in Frankfurt late in 1918. From then until 1923 she created a new program of dances every year, and these made her an object of enormous adulation throughout Germany. Her exquisite, nubile embodiment of fairy-tale feminine innocence often provoked dark, possessive impulses in her male worshippers, and she became eerily conscious of the
power of her seemingly harmless art to produce pathological consequences—or rather, to reveal secret conditions of illness, remoteness from innocence, in others (102-105). Most curious in this respect was a book about her, Briefe an eine Tanzerin (1922), written by Fred Hildenbrandt, feuilleton editor for the Berliner Tageblatt. The dances of Niddy Impekoven awakened in Hildenbrandt a rapturous, unbridled, incoherent, even fanatical language of glorification: She dances the breath of rapid-breathing anticipation, the play of a thousand things gleaming in the daylight, she dances the storm of tenderness, the weariness of all meanings, the blessed languor of the heart, she dances the sun, which creeps through the morning window, and [she dances] the early footsteps on the street which press in on her in her sleep. So she spreads in her arms, her hands, her lips and eyes the shimmering mosaic of love and no one is there who can destroy it with naked eyes. Her body is the chosen instrument of dance, the chosen instrument of love (41).
The book was actually an extravagant, obsessive, and often hysterical love
letter, but it obviously indicated the wild convolution of feeling that Impekoven’s pretty dances could stir up in male spectators. Hildenbrandt advised her not to find a partner for her dances, for “the man who dances should only dance grotesquely” (85). The very looniness of the book did much to clarify the appeal of Impekoven’s dances for a particular kind of spectator, “grey with gloom” and living in a “world of rain”: “I cannot love people, Ny, because I do not love myself, and I cannot hate them because I do not hate myself, and because I am bound to this [male] sex as I am bound to myself, the result is a desolate condition of foolish hours” (83). As biographer Hans Frentz put it, “She dances what we have all lost”—namely, a mythical sense of childhood purity of being (Niddy Impekoven, 35).
In 1923 she married an immensely wealthy physician, Hans Killian, whom she had known for several years. This event marked a dramatic change in her aesthetic. With gentle seriousness, Killian provided her with
184 SOLO DANCING a deep appreciation of the music of Bach, and through her love of Bach’s music she evolved toward a more “womanly” dance aesthetic, attempting to reach an audience looking for more than a girlish affirmation of innocence. But she was never a tragic dancer nor even an especially innovative or daring one. What she offered was an acute aura of fragility. Her fragile body displayed superb mastery of fragile movements, and yet in this fragile negotiation with time and space there evidently lay a superior strength of will that
has allowed Impekoven to live a very long life indeed. It was the aura of fragility (more than the aura of innocence) that allowed her dances to open
up the emotional responses of audiences to a greater degree than could many dances with more aggressively modern ambitions. As she herself said as early as 1922: “My aim is constantly to distance myself from ‘intellectual’
dance. ... The purest, most natural dance is for me the unreflective surrender to music” (N. Impekoven, Werdegang, 31). But the music for her dances was now rarely modern, limited to a couple of pieces by Milhaud and Bartok; otherwise her love for Schumann, Mozart, and Bach prevailed.
In 1928 she embarked on an amazing world tour in which she visited numerous European cities before going on to exuberantly acclaimed concerts in Port Said, Bombay, Bangkok, Singapore, Jakarta, Shanghai, Tokyo, Honolulu, San Francisco, New York, and many, many other cities. The tour
made her quite wealthy, and she decided to accept further invitations to tour the Dutch East Indies and Southeast Asia in 1930. In 1933-1934 she presented her last program, which contained the Drei Engel cycle of dances to Bach preludes and Das Fest, a cycle of sixteenth-century German court and folk dances, and these pieces seemed to appeal to the conservative sensibilities that quite suddenly dominated German dance culture. Impekoven, however, felt no invigorating enthusiasm for the emerging cultural scene, so she retired to Switzerland, which she had regarded as her home since 1923. The great majority of her life still lay before her, but she lived quietly, apparently secure in the belief that she had already accomplished what she was born to do. In 1955 she published her brief and poignant autobiography, Die Geschichte eines Wunderkinds, which examined her life only up to the
age of fourteen and suggested that the image of childhood innocence pervasively defining public perception of her concealed a measure of suffering, self-sacrifice, and anxiety that one could never really transcend and that in any case hardly affirmed the innocence of her audience. In 1926, John Schikowski observed that, despite their evolution toward an “adult” phase, Impekoven’s dances were “still always the dances of a child” and disclosed “a world of naive feelings”: “This world is small, but it is full of beauty and fairy-tale radiance. This child gazes with large, teary, strangely shiny eyes, an aching smile on the lips. A sick child. Even over manic exuberance a little, melancholy cloud hovers. Poignant the droll exaltation, the grimacing gestures. Touching the little desires which strive
SOLO DANCING 185 toward heaven, without soaring, but rather helplessly seek their chains. Tensions and releases of a gentle, sweet softness which appears vacuous when it does not assume a child-like style. A perfectly polished body” (153-154). What made Impekoven’s dances childlike was her tendency to equate the signification of innocence and fragility with the performance of delicate, precise, highly nimble movements; it appeared as if she moved in a hostile, treacherous space in which the slightest false gesture could lead to a mishap, a fall, a desecration. She was capable of bold, swinging movements, but these always remained subordinated to a small sense of scale, to a doll-sized world. Even in her “adult” phase, she simply transformed the doll image into the image of a lithe angel. Photographs of her dances suggest that while performing she liked suddenly to gaze directly at the spectator, her large eyes leveling in a haunting and almost questioning way, as if to say, “Are you sure what I’m doing makes you happy?” She often danced on the balls of her feet and occasionally on pointe, with numerous delicate, lilting kicks, hops, and skips, and she liked having outspread arms
in motion; she apparently did not favor movements that brought her hands close to her body. She definitely preferred curvaceousness to angularity in shaping bodily expressivity. Her costumes avoided elaborate ornamentation, yet she loved dancing in a great variety of costumes. In Schalk (1918) she wore a kind of trapeze artist blouse that displayed all of her arms and legs, but in Pavanne (1918) she appeared in an eighteenth-century aristocratic boy’s shirt and
breeches. For Pizzicato (1918) she donned an elegant white ballet tutu, whereas in the Beethoven Bagatelles (1920) she wore a gypsy-style shirt dress with long fringes (Holdt). For her dance concerning “the life of a flower” (1918), she wore a simple, sleeveless dress with an abstract floral design. In later dances, she put on a thirteenth-century gown with mantilla or a buffoonish jacket and pants that, when performed with all sorts of quirky movements, made her look like an intoxicated imp. Her costume for Dernier cri (1924) was quite odd: she danced in heels, with a little boa around her neck and a small, feathered hat at a tilt; her dark blouse had very short sleeves, yet she wore gloves extending above her elbows. Her skirt was long, extending to her ankles, quite tight around the waist and thighs but shredded just below the thighs into a long, dense fringe. Toward the end of her career, with her Bach pieces, she went in for long, dark, completely undecorated gowns with thigh-length slits that allowed for freedom of movement and flashing glimpses of her legs. But she exuded an austere, vaguely haloed aura. One of her most memorable costumes was for Der gefangene Vogel (1918 [music: Bruno Hartl]). Here she wore a dark caftan that entirely concealed all the hair on her head; her minidress generously exposed her legs, but its sleeves covered her arms and even her hands. Attached to the sleeves and
186 SOLO DANCING to the sides of the dress were wings, upon which she had painted brightly colored feathers. Unlike Sent M’ahesa’s use of wings in her Isis dance, Impekoven made the wings of “the captured bird” an intimate, indistinguishable part of the dress itself, so that it appeared as if the costume was what allowed the body to soar. Yet Impekoven performed this dance in a completely neutral context, pure space, as though in the sky. Thus, she conveyed the sense of the bird imprisoned by its own wings and the dancer’s body imprisoned not so much by its costume as by a peculiar sense of many things tightly attached to it: wings, feathers, cloth. The piece implied that the poignant fragility of creatures was most evident when they moved in a State of captivity; yet it also suggested that a creature’s fragility was a motive for capturing it, and no amount of space or freedom could protect the body from its fragility. A cage did not amplify the body’s fragility; mere consciousness of space and gravity did that (Figure 48).
In 1918 Impekoven created her curious series of doll dances, which in , addition to the “rococo” doll and the Munchener Kaffeewarmer included miniatures inspired by the wax or porcelain figurines created by Lotte
Pritzel, Erna Pinner, and Kathe Kruse. The Erna Pinner doll dance appeared in the film Wege zu Kraft und Schonheit (1925), with Impekoven
wearing a delightful polka-dot clown costume with black stockings and gloves. She slumbered in an armchair until the twitching of her sleep and dreams propelled her into whirling, jerky, puppetlike movements that quickly exhausted her and caused her to fling herself back into slumber on the chair. Here she signaled that feminine innocence was but a toy of the unconscious, a windup doll with no discernible motive for its sputtering movement other than to exhaust itself with pleasure in its own absurdity. GRET PALUCCA
Very few dancers received the pervasive acclaim and prestigious respect bestowed upon Gret Palucca (1902-1993), yet today her work seems perhaps less interesting than that of others of her generation. After spending a couple of years in San Francisco, she grew up largely in Dresden, where between 1914 and 1918 she studied ballet intermittently under Heinrich Kroller. In 1919, Palucca saw Mary Wigman perform in Dresden, and as a result she became a student in the new school Wigman opened in that city. Palucca was a member of the famous “first Mary Wigman group,” which included Hanya Holm, Vera Skoronel, Berthe Trumpy, and Yvonne Georgi; with this group Palucca created her first pieces, a drum dance and Golliwog’s Cakewalk (1922). By 1924, however, she, along with Trumpy, Skoronel, and Georgi, decided it was time to chart her own course. She followed an aes-
thetic path that gained her many admirers yet prevented her from becoming a complex, influential artist. The same year she married Fritz Bienert,
SOLO DANCING 187
the son of wealthy art collector Ida Bienert, and through the marriage (which lasted until 1930) she came into contact with many prominent modernist artists, including members of the Bauhaus, such as Kandinsky and Klee. In 1925 she opened her own school in Dresden, much to Wigman’s
annoyance; as it turned out, Palucca lasted much longer in Dresden than Wigman did. She then formed a dance group in 1927 whose members for the most part merely accompanied her on percussion instruments. Palucca was above all a solo dancer, giving up to a hundred solo concerts a year throughout Germany and Switzerland; unlike many German dancers,
she found numerous admirers in Poland (1928-1929). She showed little imagination for group choreography, for she was unsure how to create complex, expressive relations between bodies without succumbing to the mech-
anized drill formations of the revue dance modes, which she disliked intensely (Palucca). She apparently found the process of collaboration on group pieces oppressively tedious and complicated by the necessity of managing so many unexpectedly significant details. Instead she produced new collections of solo dances every year, year after year, until she retired from performance in 1950. In spite of her friendly connection with the Bauhaus and in spite of her completely “abstract” image of modernity, Palucca gained the favor of the Nazis, with Goebbels an especially enthusiastic admirer. Purged of Jewish
students and teachers, including codirector Irma Steinberg, the Palucca school received strong state subsidies, and Palucca herself enjoyed presti- , gious appointments. In 1935 she turned down the leadership of the newly formed modern dance section of the German master workshops for dance, not for ideological reasons but because she felt that accepting the appointment would make her complicit in government efforts to discredit her teacher, Mary Wigman. The next year she participated in organization of the gigantic dances for the Berlin Olympics, but because these entailed group choreography on an unprecedented scale she found the experience nerve-wrackingly exhausting (“Palucca,” 22-23). When at last, in 1939, it became obvious that her method of teaching paid little attention, if any, to matters of ideological indoctrination, the Nazis removed her from the leadership of her school and then from any position within it. But she continued to present solo concerts in cities throughout Germany and Switzerland during the war years.
The catastrophic firebombing of Dresden in February 1945 destroyed nearly all her possessions. She was, however, as resilient as ever: by June she
had started teaching classes again, and these became the basis for a new school, which began receiving state subsidies in 1949. In 1952, during the construction of a new building for the school, she ran into disagreements with Communist authorities, and she declined to teach there until 1954, when Minister of Culture Johannes R. Becher intervened on her behalf.
188 SOLO DANCING
From then on she and her school prospered. The Communist regime heaped upon her numerous medals, honors, privileges, appointments, foreign invitations, commemorations, and documentary tributes, although the government actually promoted a skeptical, unencouraging attitude toward the whole Ausdruckstanz legacy. East German publications on Palucca were
almost entirely uncritical testimonials (Krull; Schumann). Even in West Germany she attracted a fairly strong measure of veneration, simply because she seemed a living link to the thwarted, suppressed modernist potential in German culture generated by the ill-fated Weimar Republic (“Palucca”). But during the cold war years, Palucca’s notion of “the new artistic dance” hardly represented a new direction anywhere, even when compared with the dance scene of 1920.
Palucca may have been the most abstract of all expressionist dance artists, including Schlemmer, despite his obsession with robotic dancing bodies. She produced a huge repertoire of solo dances, but she was so prolific because she did not complicate her aesthetic with narrative or thematic ambitions. She was a superb technician who regarded the mastery of technique as the subject of virtually every dance. As she herself explained in 1935: My dances have no other content and meaning than just dance, natural movement, formed in congruity with the music. It is my wish in my dances to be just so free and so bound [by music] as a musician is. Free of themes and symbols” (Losch 104). Palucca viewed the body as a pliant structure, which movement shaped into endlessly varied arabesque forms. Movement was an end in itself, and as such it did not “express” anything except a “natural” state of freedom and a superior command of space. Her dances projected hardly any of the erotic aura found in the work of so many other modern dancers. Palucca was famous for her extraordinarily high and long leaps; when she was a student at the Wigman school, Wigman, who favored
strong contact with the performance surface, had to restrain her from incorporating ever greater leaps into the group dances (HM 89). Hardly any other dancer produced such a variety of leaps as Palucca, but she was also fond of bold strides, high kicking steps, exaggerated stretches, sweeping arm movements, torso-twisting pivots, gliding surges, and precisely balanced turns on one foot (Figure 49). Her body seemed to cut across the performance space in diagonal patterns while constantly striving to spiral upward. Her dances were primarily about the beauty of these devices. She kept adding so many new dances to her repertoire because in themselves none of her pieces left a strong emotional impact; in most cases a new dance was simply a reconfiguration of her favorite devices set to different music and given a different title. Her dance titles were often quite abstract and merely descriptive of the movement she performed, such as “lively” (1925), “light” (1925), “colored” (1928), “distant” (1928), “intense” (1925), “furi-
ous” (1931), “sad” (1934), “graceful” (1941), “only so” (1945). Other
SOLO DANCING 189 pieces carried purely musical appellations: Largo (1943), Rondo (1933), Lento (1924), Capriccio (1932), Waltz (1922, 1927, 1933, 1943, 1948), Tango (1923, 1929, 1941). She consistently chose neutral costumes that might fit any number of dances, and her taste in music was quite eclectic, though not particularly adventurous. Throughout her career she tried to succeed at the performance of dark, somber, or tragic moods, but she could not achieve anything memorable in these dimensions, for at bottom she regarded dance entirely as an expres-
sion of joy, an exuberant release of energy. The most appealing photographs of her always showed her smiling radiantly, completely delighted by the sheer sensation of her own movement and unconcerned with its significance. In a sense she was a barefoot ballerina, putting ballet techniques and devices at the service of improvisation. She freed ballet technique from elaborate narrative contexts, and the result was dance that meant nothing other than that freedom and ecstasy depended entirely on the perfect exposure, the unclothing, of technical devices. Palucca’s aesthetic transcended the political-historical contexts in which she lived and protected the freedom of the body from competing ideological perspectives about its meaning. However, detaching the display of technical devices from narrative motivations required Palucca to detach herself from any strong emotional response to the world around her; she created a perfectly closed universe that was never any greater than the space in which she could leap. Yet it was her ability to detach technique from intention that made her an excellent teacher, for she knew how to correct movements without disrupting the
message the student wanted to convey. Her method of improvisational instruction enabled students to achieve superior technical mastery in relation to desires that were uniquely their own, as is evident from the abundant testimonials compiled by Schumann. Some of her students, such as Lotte
Goslar, Marianne Vogelsang, and Dore Hoyer, demonstrated far greater emotional expressivity and depth than their teacher but probably could not have achieved such confidence in their expressive power by studying entirely under a teacher like Wigman, someone devoted to the realization of visions and urgent meanings. Modernists such as Bertolt Brecht, Laszl6 Moholy Nagy, Ruth Berghaus,
and Wassily Kandinsky liked Palucca’s dances because they seemed to deconstruct the vocabulary of abstraction that supposedly invested the body with modernity. In 1925, Kandinsky published his famous Tanzkurven zu den Tanze der Palucca (Figure 50), in which he went about as far as anyone could
go in constructing an abstract image of a still recognizably human form. The artist reduced the movement of the body to a minimal set of converging or intersecting arcs and lines of varying thickness. The images created a
strong impression of purely formal dynamism, as if dance were nothing more than a vigorous conflict between curved and straight lines. What
190 SOLO DANCING Kandinsky saw in Palucca’s dances were devices of movement, expressions of nothing more than a desire to achieve a completely generic identity as a dancer. The images showed “dance” with geometric simplicity and authority, but one needs a caption to know that the dancer who inspired the artist was Palucca; the device discloses the unique identity of a form (dance), not the unique identity of its user, the dancer. GERTRUD KRAUS
Virtually opposite Palucca in aesthetic temperament was Gertrud Kraus (1901-1977), who lacked a clear idea of technique and for whom “technical ability grew out of emotion” (Manor, “Weg,” 11). Kraus possessed an impulsive personality driven by strong emotional responses to the immediate, peculiar moment. Born in Vienna, she first studied piano at the State Academy of Music. Upon graduation she worked as an accompanist for silent movies and for the dancer Ellinor Tordis (1896-1976), a dark figure whose ambitions included dancing to the music of Anton Bruckner. Initially, Kraus was ambivalent about the possibility of dance as an art: “My suspicion was that dance was only for cabarets” (Ingber, “Conversations,” 45). But as she accompanied Tordis, she became aware of dance’s great expres-
sive potential. Her impulsive personality registered clearly in the story she told of how she decided to become a dancer. One day Tordis asked if any students were prepared to present a piece for the class. After a brief pause, Kraus jumped from the piano, tossed off her shoes, and improvised a piece, completely unpremeditated, unrehearsed, and, indeed, untrained except for what she had learned from watching the classes given by Tordis. Her performance was followed by a long silence, which Kraus found so excruciating that she grabbed her shoes and belongings and headed for the door. Tordis called after her: “Wait! We must talk about this,” but Kraus responded, “The pause was too long,” and kept going (Manor, “Weg,” 9). With this action, Kraus decided she was a dancer. She studied for awhile with Gertrud Bodenwieser and even joined her dance company for several months. But Bodenwieser’s aesthetic soon struck Kraus as too full of theatrical cleverness and sentimentality, and at the end of 1925 she rented one of the largest theatrical spaces in Vienna and presented her own concert of
solo dances. The success of her solo concerts encouraged her to form a school and dance company in 1927. The company toured extensively in Germany, giving many performances for socialist and Zionist organizations. In 1929 she assisted Laban in the creation of festival processions in Vienna, and at the 1930 Munich Dance Congress she and her group attracted much
attention by performing a cycle of dances evoking “songs of the ghetto.” The following year she gave concerts in Palestine, where she became intoxicated by the sounds, colors, and rhythms of the Middle East. Because she
SOLO DANCING 1gI was Jewish, the advent of the Nazi regime completely destroyed all artistic
opportunities for her in Germany. However, her decision to migrate to Palestine actually resulted from her impulsive response to communism. While performing in Prague in 1934, a clandestine cell of communists approached her and urged her to become an agent of the party and to make her dances an instrument of party propaganda. Though she adopted vaguely left-humanitarian political values, Kraus sensed that in Central Europe she could not do anything anymore without turning her art into a “placard.” “I felt 1 had no flag and I wanted only to leave Europe behind,” she said, although she claimed her life in Vienna was “the most glorious time anyone could ever have had” (Ingber, “Conversations,” 48). In 1935
she emigrated to Palestine, where she spent the rest of her life choreographing, teaching, researching Jewish folk dance, and sculpting. In her later years, she produced elaborate sketchbooks in which she continued ecstatically to “dance on paper.” Unlike many modern dancers, Kraus relied heavily on literary sources to shape the identity of her dances and suffuse them with narrative logic. She
also grounded her dances in socialist and Zionist political theory. Her dances signified heavy emotions because they were intensely dramatic, but the source of dramatic conflict always lay in her strange, almost alien image of feminine beauty. In her dances, female bodies moved as if they came
from a secret, unmapped corner of European culture. An eerieness pervaded all her European dances, which consistently favored a convergence of the bizarre and the melancholy. A wispy, diminutive woman with ravenblack hair and large, almond-shaped eyes, she delighted in exaggerating the strangeness of her beauty. Unlike Impekoven, however, she did not make the fragility of the body the basis for the emotional intensity of her dances. Photographs of her European dances depict a phantasmal woman,
a Lilith, a creature moving in a dusky glow. Expressionist chiaroscura suited her temperament exquisitely, even though that style, so strong in the visual and performing arts in the years 1919 to 1923, was largely out of
fashion by the time she started making dances. Kraus loved rocking or swaying movements that curved the body, the arms often moving more freely than the legs. She seldom danced on tiptoes, and she liked having bodies close to the floor, especially in kneeling positions, which compelled them to make inventive use of head, hand, and torso movements; in 1935 she created a piece in which dancers moved while drumming their hands on the floor (Manor, Life, 32). Kraus also borrowed curving, serpentine,
and undulant movements from Near Eastern and Indonesian dance cultures. In Fire Dance (1930, music: De Falla) she stood with legs spread and performed much of the dance using shaking, trembling, throbbing, gyrat-
ing movements of her arms, torso, and head. In Air on a G-string (1931, music: Bach), she wore a long, flowing lamé gown with long sleeves and
I92 SOLO DANCING began the dance (as photographed at the D’Ora studio) in a profile kneeling position, eyes closed, while her arms made spiraling movements over her breasts and head until her body seemed coiled up; then she spiraled upward onto her feet and began rocking sideways, back and forth, twisting her whole body so that the tilting of her head appeared to control the balance of her entire body. The movement of her head dominated the body and the dance, yet she never opened her eyes. A footlight effect emphasized the trancelike eerieness of the dance. Few dancers could make the head so expressive because few dancers treated dance as a submission to the elevating power of intellectuality. Guignol (1929) was even stranger. Here Kraus impersonated a bizarre puppet. She sat on a pedestal in a long black dress with a white stripe from hip to hem and a sort of large white claw stamped onto her chest. Around her neck she wore a large bow; her face was painted white, and she attached to her fingers long brass fingernails of the type used by Javanese dancers. In this case her large dark eyes stayed constantly open’and gazing at the spectator. She never left the pedestal; she sat on it, knelt on it, peered from behind it, and stood against it while the rocking of her body and tilting of her head inspired uncanny arabesque swirls of her arms and clawlike brass fingernails. She never smiled. Yet one did not see a body trapped in space; rather, it was as if the freedom of her body depended on its achieving a beautiful alienness through its power to concentrate perception within a highly confined space. Kraus created a haunting image of robotized femininity suffused with a vaguely supernatural aura, as if the key to comprehending the mystery of sexual identity lay in the puppetization of the body. Equally spooky was her incarnation of The Tired Death (1930), in which she
moved in a long, satiny, purple gown and a great purple cape; her head, however, was covered with a white skullcap, so that she looked bald, while her eyes remained heavily mascared and her lips starkly painted. She moved slowly, stealthily, as if in a predatory trance, sweeping into death all humanity in her path. In The Beast (1931), however, she wore a kind of jumpsuit and combined powerful striding, lunging, pouncing movements with the “feminine” curvaturing of rocking and swaying motions. Decorative exoticism appeared in Oriental Girl (1929), and in Russian Folk Song (1932) she introduced a wild, ecstatic swirling movement seldom associated with “colorful” peasant costumes. With The Jewish Boy (1929), she experimented with
a mysterious, seductive image of androgyny. Manor claims that Kraus’s dances contained no eroticism, perhaps because she consistently covered her legs with longs skirts or dresses and did not seem interested in narrative themes of sexual desire (Life, 36). But from my perspective, her preoccupation with producing an alien, melancholy image of her body is evidence of a desire to estrange the spectator from normative, narratively contextualized significations of erotic feeling.
SOLO DANCING 193 Information about her group dances in Europe is so scanty that it is difficult to say anything about them. Apparently she attracted only Jewish women into her group. She had as many as eight women in the group, but in some dances the women impersonated men. In 1928, Kraus tried to persuade Baruch Agadati (1895-1976), a Russian-Palestinian who performed
Jewish folk dances in an expressionist style, to join her group, but he insisted that he was exclusively a solo dancer (Manor, “Weg,” 9). Old Jewish
narrative ballads and Hassidic tales inspired Ghettolieder (1930, music: Joseph Achron), which offered tragic images of the hermetic world of East-
ern European Jewry; the dancers wore long, dark, expressionist gowns somewhat similar to the Guignol puppet costume, with shawls attached to their heads for some pieces. Rocking and swaying movements dominated the choreographic design, but Kraus developed ingenious variations on this motif: for example, a trio of women deep in the space swayed in a horizontal line, backs to the audience, while a quartet of women in diagonal for-
mation swayed-glided toward the trio. She introduced multiple pairs of dancers performing eerie swaying movements: two dancers in profile on their knees rocked their way across the stage while two pairs of dancers, on their feet, swayed in tango fashion behind them, creating a curious image of sexual ambiguity (only two of the tango dancers had a definitively established sexual identity, wearing shawls to signify their femininity). Pendulum mechanicality of movement appeared again in Dream of Hap-
piness (1932), ten scenes built around a poem by Kraus’s friend Elias Canetti; some of the accompaniment included the speaking of Canetti’s words. In this work, a monumental machine dance turned into a triumphal procession to signify the “dream of happiness” arising from “a vicious circle of hopelessness” (Manor, Life, 30). In 1932, Kraus also worked on a dance inspired by Karl Kraus’s (no relation) enormous drama The Last Days of Mankind (1921), in which the female dancers were soldiers wearing gas masks. Her last and perhaps most popular work, The Czty Waits (1933), derived from a story by Maxim Gorky: “A boy goes to [a] town and hears how the town suffers” (Ingber, “Conversations,” 46). The accompaniment included the speaking, by a woman, of words from the Gorky story as well as music composed for the piece by Marcel Rubin. Kraus herself played the boy, though by this time she had at least one male student, Fritz Berger (aka Fred Berk [1911-—1980]) in her group. When Kraus disbanded her group the following year, Berger achieved some success in Vienna as a solo performer of folk dances and political allegories, such as the Pharaonic The Tyrant (1932), and as a partner for the Viennese ballerina Hedy Pfundmayr (1899-1966). He emigrated (1939) to Switzerland, Cuba, and finally New York, where he became prominent in the research and preservation of Jewish folk dance traditions (Ingber, “Vienna”). In spite of having such a strong male talent on hand, however, Kraus deliberately welcomed opportunities,
194 SOLO DANCING
provided by narrative situations, for female bodies to appropriate male identities and thereby create a strange, alien image of female beauty. She liked shifting sexual identities, just as she liked shifting impulsively from dancing to accompanying dance on the piano, just as she liked rocking, pendulum movements of the body. GERTRUD LEISTIKOW
In 1921, before Wigman’s genius was fully apparent, Hans Brandenburg
regarded Gertrud Leistikow (1885-1948) as the most tragic and “Dionysian” of all German modern dancers, the figure closest to the primeval concept of dance as an expression of an ecstatic body (HB 157-173; Bragaglia, too, Scultura vivente, 84-85). But by 1925, Leistikow’s
significance seemed confined almost entirely to the Netherlands, where she had resided since about 1917, although she kept trying to achieve dramatic comebacks as a dancer until 1939. After attending girls’ schools in Metz and Spa, she studied at a school of applied arts in Dresden, where in 1904 she observed a demonstration by Dalcroze. The same year she apparently took lessons in the Delsarte-Stebbins “artistic gymnastic” method of Hedwig Kallmeyer in Berlin. Leistikow gave her first dance recitals sometime between 1906 and 1910, with the earliest known dances dating from 1910 (Lustig). By then her reputation was such that until 1914 she could
command sizable audiences for her solo concerts in St. Petersburg, Moscow, Lausanne, Utrecht, and Sarajevo. In summer 1914 she joined Laban’s group in Ascona, where she and Mary Wigman assumed the main roles in Laban’s large-scale “tragic word and dance drama,” Sieg des Opfers, by Hans Brandenburg (MS 17). In Ascona, Leistikow also experimented with nude performance of several of her dances, though drawings of her
by Dora Brandenburg-Polster indicate she may have performed nude dances for special audiences as early as 1911. But she did not stick with the
Laban group; in 1916 she toured Germany and the Netherlands, where she attracted much attention in Amsterdam artistic circles. After her marriage to a Dutch rose dealer in 1921, her contact with modern dance culture outside Holland declined sharply, but her influence in the Netherlands grew stronger. By then she operated three schools, in Amsterdam,
The Hague, and Rotterdam; a tour of the Dutch East Indies in 1924 inspired her to open three more schools there. She announced “farewell”
tours of the Netherlands in 1929, 1930, and again in 1937, but in 1938-1939, she launched another tour of the Indies. When the war broke
out on her return home, she and her family became stranded in Somaliland, and when she finally managed to reach Holland again, she opened yet another school in Amsterdam. However, she distanced herself consid-
SOLO DANCING 195 erably from the pro-Nazi spirit dominating Dutch dance culture during the war years (ESG 20-21). Gertrud Leistikow had a slender, supple body, but her face lacked charm,
elegance, or mystery. She therefore constantly sought to hide her face, partly through suave manipulation of shawls, veils, or masks but also
through movements that called attention to the beauty of her body. This anxiety over exposing her face appeared clearly in various carefully
constructed photographs of her and even more conspicuously in Dora Brandenburg-Polster’s drawings of her, some dating from 1911. Many of these show her nude but faceless or with concealed face. Her earlier dances tended to project a tragic, melancholy aura, but after she moved to Amster-
dam her distinction seemed to lie in her peculiar cultivation of the grotesque. The Dutch dance critic Werumeus Buning thought she was stronger in the performance of waltzes than mazurkas, and he contended that in her pursuit of the grotesque she neglected to develop her greater potential for tragic expression (WBD 31-33). But Leistikow’s concept of the grotesque was cosmopolitan, so perhaps her grotesque dances constituted a curious evolution of a controlling tragic aesthetic rather than a break with it. Junk suggested that the grotesque dance displayed “more strength than grace” or, “more recently,” substituted “the bizarre for the graceful,” as manifested through “unusual positions, deformed body structures, and adventurous leaps and gestures” (98). In other words, grotesque dancing did not necessarily imply a comic mood but perhaps made a calculated challenge to aesthetic conventions of “gracefulness” and bodily com-
posure. Brandenburg thought such a challenge led Leistikow into the realms of the demonic and heroic rather than toward any spirit of parody, frivolity, or malicious travesty.
Yet Leistikow’s aesthetic of the grotesque placed less emphasis on displays of strength or “deformed” and “adventurous” movements than on perversities of dramatic structure and decor. For Faun (1912) she wore a furry black leotard that left her arms and lower legs exposed; her head was completely covered with a horned, furry black mask, with only two slits for the eyes, and a little black tail was attached to her bottom. Borrowing from the “sylph” movement conventions of ballet, she flitted about rapidly on tiptoe, “with increasing estrangement from her own presence in this world wherein she suddenly found herself” (WBD 33). But the dance, which began with animal exuberance, grew darker and slower as “the faun began to wonder about his own nature” and felt some troubling glimmer of consciousness, an impulse to “discover another world.” However, the movements of the dance were not in themselves grotesque; rather, the bizarre costume and the dramatic shift from exuberance to anxiety made the conventional, balletic signification of gaiety and frivolity seem grotesque.
196 SOLO DANCING In other cases, Leistikow deformed movements by performing them at flashing speed, as in the Furientanz (1912), which began slowly and ended in orgasmic frenzy. Brandenburg-Polster’s drawings show Leistikow per-
forming the dance nude, except for a great diaphanous veil. Peering directly into a glaring footlight, she started deep in the space, crouching on one knee, her entire body shrouded in the veil and projected as a great shadow behind her by the footlight. Then she rose, swirled out of the veil, and raced around in spiral configurations with the veil trailing behind her and her shadow leaping across the space. She ran lower and lower, ensnar-
ing herself in the veil, struggling with it in dervish frenzy. Finally she stopped running and starting spinning in place with the veil looped over her head, whirling with legs spread, then on tiptoe, until she collapsed (HB plates 23-25). Most of her dances observed this simplicity of technique and complexity of dramatic ambiguity. Jotentanz (1912) also used a footlight-looming shadow effect, but in this case, Leistikow, in one of her usual tight-fitting dresses, stood deep in the space, her face nakedly exposed and her legs pressed together, and moved slowly, in tiny tiptoe steps, toward the light. She made undulating movements with a shawl, and when she tossed it away ~ she seemed terribly naked; because she was closer to the violet footlight, her shadow appeared even larger than before. Her face was a violent glare of fear. Wrote Brandenburg: The violet spotlight becomes coldly reflected in the pearl ornamentation of the hair. It makes the head of the dancer, with Medusa-like, wide open eyes, perch over the purple shawl which entwines and strangles her throat. The crass red cloth separates head from body, so that the head seems to float in the air, but through constant transformation the little cloth serves the movement of the dance: now it dips and flows like blood, then it throbs and flutters like lightning flashes, then it spreads like an imperial mantel around the shoul ders, then it tightened again like a noose around the neck. And the language of the body discloses just as much fear of death as desire for death (HB 162; also Van Collem 22).
For many of her numerous dances, she appears to have repeated much
of the movement of earlier dances, merely changing the costume. For example, in Haremswachter (1911) she wore a very short dress with long, drooping sleeves and a bizarre Asian mask with a large, black, Afro sort of wig, but her movements were grotesque. For the entire dance, she moved
with her body directly facing the audience; she never turned but drifted laterally in the performance space while facing the spectator. She dipped up and down, on her toes, then on her heels; she squatted, then shot up to make odd shifting movements, with one foot on tiptoe and the other jutting forward on its heel. Meanwhile, her arms in their droopy sleeves
SOLO DANCING 197 extended sideways from her body and made wavy up-and-down motions, like the flapping wings of a strange bird. One could say that this simple dance showed the extent to which one became grotesque in maintaining a sense of balance. But “balance” implied more than physical poise; it included the problem of balancing the body between conflicting signs of cultural and sexual identity, as the harem guard wore a dress yet donned a male mask.
In subsequent years, Leistikow used pretty much the same movements with different costumes. In Maskerdans (1914) she wore a white minidress with short, billowy sleeves and a flamboyant blonde wig, as if her hair consisted of a huge mass of plumes; her mask was not Asian but macabre, skull-
like, with large dark eye sockets and a gleaming red smile (Velde). In another version of the balancing movements, she wore a black leotard that covered even her hands and feet; indeed, her hands looked like reptilian claws. She concealed her face behind an oversized male mask with vaguely
Asian features. In her right hand she dangled an Asian sword (male emblem), and in her left hand she dangled a veil (female emblem), while some sort of knotted chain was attached to both arms (WBD 16). For Rote Groteske (1922), the simplest version of all, she wore a red minidress, red stockings, and a red mask of indeterminate sex. But, according to Marja Braaksma’s 1991 reconstruction, Leistikow apparently did not retain the
crouching or tiptoe movements in this version. What made Leistikow’s dances grotesque was her determination to invest the simplest movements with startling dramatic power, an unsuspected intensity of conflict. This determination was perhaps most mysteriously evident in Gnossienne
(1924), which used as accompaniment Erik Satie’s equally simple and haunting piano melody “Gnossienne No. 1” (1889). Here Leistikow stood in a tight-fitting, shimmering gown and faced the audience in a veiled light. She concentrated the dance almost entirely in the hands and arms, which undulated slowly, like waves, horizontally, then vertically, while her face con-
stantly stared straight ahead with Sphinxlike inscrutability (one had to see
the dance more than once to make this observation, so strongly did the arms and hands attract focus). After performing a pattern of arm undulations, the dancer took a step forward and turned into profile to repeat the pattern but raised her right leg slightly and held it suspended for the duration of the repetition. Then she turned and faced the audience again and repeated the pattern. The dancer repeated the initial pattern five times, thrice forward and twice in profile. With each repetition, the dancer merely moved forward a step or, while in profile, suggested a step in another direction without actually taking it (Braaksma). The dance conveyed a sense of a body very slowly and hesitantly moving closer to the audience without, in its trancelike state, even seeming aware of the spectators. Repetition of movements was the key to bringing bodies closer to each other, but in this case it
198 SOLO DANCING did not induce a feeling of familiarity; rather, the closer the body came and the more it repeated its movements, the stranger it appeared. This was a highly sophisticated form of irony. The spectator gained the impression of watching a body moving underwater, its arms and hands undulating hypnotically like the tentacles of a luminous, aquatic plant, a human anemone. This dance still fascinates audiences today. Buning (Dansen, 32), Van Collem (21), and Brandenburg (HB 169) all remarked that in Leistikow’s dances, the body undulated like wind or water. More important, she showed that the expressive power of dance depended not on any virtuosity of technique but on intensity of dramatic purpose. Because she subordinated technique to dramatic effect, she could produce many new dances, without having to devise much in the way of new movement, for what made movement new was a different dramatic or theatrical element, such as costume, mask, lighting, or props. Her taste in music was
eclectic but not adventurous. She heavily favored music from the nineteenth-century romantic repertoire and folk songs, although in 1921 she attempted a dance to music that contrasted conditions of “blindness” and “seeing” (Buning did not think it successful [33]). In 1929 she experimented with the accompaniment of two harmonicas, then of an accordion, and further introduced a dance employing jazz music, but these did not resonate well with Dutch audiences. She appropriated folk music from many cultures—Spain, Russia, Ukraine, Java, Bohemia, India, Chile, Hungary— yet her dances never gave an image of the culture from which the music derived. Rather, they created a mysterious image of cultural ambiguity, as in Gnossienne, which adapted arm movements found in Javanese dance to pro-
duce an atmosphere of accumulating uncertainty regarding the cultural identity of dancer and movement. In Goldene Maske (1921) she used a Russian folk song (as she had in Rote Groteske), but for Anton Van Collem, “the dark, slender little god with the golden mask” performed a dance reminiscent of an ominous Aztec ritual (24). In the early 1920s, Leistikow worked with the Dutch sculptor Hildo Krop
(1884-1970) on the construction of many of her masks, and her success with them inspired other Dutch dancers to work with gifted artists in creating bizarre dance masks. Whereas Krop’s masks tended toward a sleek, constructivist image of the face, Jaap Pronk’s masks for Tilly Sylon’s group exuded a fantastic primitivism. In 1932, Hein von Essen created masks for dances by his daughter, Dini von Essen, but these were more “realistic” than either Krop’s or Pronk’s—that is to say, they functioned more as caricatures of Western faces (“social masks”) than as cultural estrangements of Western bodies (Lagerwejj-Polak; Hein von Essen; Dini von Essen).* But no dancer 4. Krop’s mask designs so impressed W. B. Yeats that he employed them in dance drama
productions at the Abbey Theatre in Dublin in the 1920s. Another Dutch dancer, Florrie
SOLO DANCING 199 seemed as sensitive as Leistikow to the face as a mask and as an object of masking and veiling; she saw in the face the decisive emblem of imperfection and deception, regardless of whatever technical perfection the body as a whole possessed. Perhaps this perception was most obvious in her dance
, to Weber’s Scherzo (1914), which apparently she performed in a bodycovering veil before a mirror. Van Collem remarked of this dance: “The beautiful woman in the dead little village lives as one estranged from herself” (24). TRUDI SCHOOP, JULIA MARCUS, AND VALESKA GERT
Grotesque dancing in the 1920s assumed so many curious forms that the term “grotesque dance” came to signify a larger and larger measure of freedom for the dancer, even if it never achieved much in the way of a stable def-
inition. Nevertheless, hardly anyone confused grotesque dancing with comic or “cheerful” dancing, and some dancers established their identities by emphasizing this distinction. Ronny Johansson, for example, consistently put on programs of cheerful (“heitere”) dances, with brisk, springy, decorative movements accompanied by lyrical music in a major key. Johansson sometimes performed dances in pretty pants, but her dances exuded cheerfulness because they presented a body radiantly freed of sexual, cultural, or psychological ambiguity. In Vienna, Elsie Altmann (1899-1984) projected a similar image of cheerfulness, reinforced by an elegant taste for
Biedermeyer-style costumes. This approach marked her entire career, beginning with her debut concert in 1919, just before her marriage to the
famous architect Adolf Loos (1870-1933), and continuing unchanged until at least 1929. Her talent brought her opportunities to choreograph operettas (Altmann-Loos 268-278). By contrast, the Swiss dancer Trudi Schoop (b. 1903) specialized in comic pantomime. An awkward child, she struggled to achieve elegant physicality through rigorous ballet training and then through the rhythmic gym-
nastics offered by the Elisabeth Duncan school; but when her own family laughed at her as she performed for them a solemn dance, she decided to devote herself entirely to comic dance, and in this direction she exhibited unprecedented ambition. In 1929 she assembled in Berlin a comic ballet company containing twenty-two members, including several men, although Schoop still employed numerous female impersonations of men. Fridolin
Rodrigo (b. 1893), commissioned, during the 1920s and early 1930s, extraordinary expressionist masks from the Dutch artists Erich Wichman, Jan Havermans, and Grietje Kots, all of whom emerged out of the Wendingen circle of Dutch expressionists. Rodrigo began her career with Grit Hegesa, who also apparently experimented with masks (de Boer).
200 SOLO DANCING (1930, music: Paul Schoop) was a great success and led to performances of the group around Germany and in Oslo, Stockholm, Venice, Paris, Prague, and Amsterdam. This pantomime established the model for her subsequent successes, which followed the episodic structure of the expressionist “journey” drama. Fridolin, for example, contained twelve scenes, each depicting Fridolin’s encounters with a new set of characters as he wanders eternally and vainly in search of a woman who will return his love. Scenes showed Fridolin achieving distinction as an acrobat, competing for a woman who despises him, joining a secret sect, stumbling into a boring marriage, joining a bowling club, and falling hopelessly in love with a cabaret acrobat.
Schoop herself played Fridolin, and her brother Max designed the costumes. The ballet company also produced divertissements, such as Want Ads (1933) and Current Events (1937), in which Schoop presented satiric views of contemporary social realities, such as unemployment, retail selling, and
male sports fanatics, but her strength lay in the ambitious comic pantomime. Blonde Marie (1938, music: Paul Schoop), with costumes by Oskar Schlemmer, presented eight scenes describing the absurd journey of Marie (Schoop) from servant girl to waitress to soubrette to diva to rich wife to bored mother to publicity-happy adulteress. All for Love (1939, music:
Lothar Perl, Schoop’s brother) contained six long scenes depicting episodes from the life of Catherine (Schoop) as a schoolgirl, at a nightclub,
around the Christmas tree, and on trial, concluding with the grotesque apotheosis of Catherine the Clown in a “super-colossal Diamond Star Revue,” in which “dancing and vocal choruses, apaches, clowns, jugglers, with the help of make-believe and blinding spotlights, combine to give the romantic illusion: ALL FOR LOVE” (Hurok). Schoop’s aesthetic seemed driven by a Brechtian inclination to puncture the illusions of socially idealized romantic erotic desire. But she achieved the puncturing through eccentric costumes and pantomimic distortions of conventionalized balletic and functional movements rather than through hauntingly bizarre transgressions of gracefulness. Her success in the United States was considerable, beginning in 1935, and when the war broke out she decided to emigrate there. She could not, however, maintain the large-scale ballet company; in the 1950s and 1960s she therefore (and not altogether unexpectedly) devoted herself increasingly to the realm of dance therapy for both physically and psychologically damaged bodies (Schoop). Schoop’s comic aesthetic relied too much on a complicated theatrical definition of society to achieve her distinction in the realm of solo dance: she showed little inclination to see how the body moved alone, apart from
a group. Most grotesque dances, however, operated in a solo mode and emphasized the power of grotesquerie to separate the body from a socially determined identity. In the years 1916-1920, Rita Aurel performed solo
parodies of Oriental dances, using her contortionist ability to produce
SOLO DANCING 201 bizarrely distorted serpentine movements of the arms and belly. Aurel did a piece in which she represented a woman injecting herself with morphine,
causing Brandenburg to suggest that she had devised a form of aesthetic movement that was neither dance nor pantomime. She was not a dance clown but a sort of freakish dancer. With the Mozartian Rondo (1916), she appeared in a child’s costume and danced with small balls suspended by strings; then a very large black ball descended, introducing “the demonic into the supposedly naively charming music.” Despite such obvious evidence of a strong imagination, this “strange, super-tall, super-slender, hysterical, graceful, and very worldly personality” most regrettably left behind very little trace of herself (HB 58-59).
Even more obscure was Hilde Schewior, who lacked any feeling for danced movement, according to Schikowski (153). But she was a dance clown with a gift for goofy, satiric costumes, and she liked impersonating grotesque types of males, deforming her movements to create an impression of bizarre physiognomy (Holtmont 227). Lotte Goslar, a student of Wigman and Palucca, was also a dance clown in the early 1930s, but she was
quite a pretty woman and sought to construct a dance aesthetic in which strong comic ingenuity was not incompatible with a confident display of feminine beauty. How she achieved such a remarkable synthesis remains unclear, but a photograph of her suggests that she may have used the theme of trying to look her best as the basis for various comic misadventures with costumes or movements (MS 95). This approach apparently succeeded best - in acabaret milieu. In 1937, asa member of Erika Mann’s Pfeffermuhl company, she came to the United States, where she has resided ever since. Like Schoop, she felt her comic talent unfolded most effectively in a company, and she founded her own in Hollywood in 1943. Julia Marcus (b. 1905), a Swiss student of Laban, Elisabeth Duncan, and Wigman, not only was active in cabaret performance but in 1931 became a
member of the unusual Berlin City Opera ballet company under Lizzie Maudrik. She apparently had a gift for dark, dramatic voluptuousness, as in her Mexican-Aztec suite of dances (1930), but her uniqueness was most evident in her radically grotesque parodies of contemporary figures such as Al
Jolson (1931), Adolf Hitler (1931), Gerhart Hauptmann (1932), and Gandhi (1933). In these she collaborated with Berlin artist Erich Goldstaub, who created for her oversized, caricatured masks of these persons (with Jolson in blackface). She modeled the movements of these dances on acute observations of the gestural idiosyncrasies peculiar to the famous personalities. In Der Friedensengel (1932) she reached a truly astonishing thresh-
old of the bizarre when she donned a creepy, oversized mask of French prime minister Aristide Briand (1862-1932), winner of the 1926 Nobel Prize for Peace. But the mask was hardly all that was strange: she wore a
tuxedo shirt and jacket over the upper portion of her body, and these
202 SOLO DANCING garments clashed dramatically with the white ballet tutu, stockings, and slip-
pers apportioned to the lower half of her body. In this costume she performed a waltz satire on diplomatic gesturing. In Walzer (1933), she danced in a gas mask. Marcus was a friend of the Communist Party, and for party cabaret enter-
tainments she created dance parodies not only of contemporary political figures but also of social types, such as the symphony conductor, the servant girl, the sewing machine operator. Some of her dances used music by the communist composer Hanns Eisler and strove to construct heroic images of
proletarian figures (“Julia Tardy-Marcus”). Of course, the Third Reich severely limited opportunities for Marcus, so she began touring restlessly around Europe, inserting herself into the cabaret culture of Warsaw, Amsterdam, and Zurich. She finally settled (1933) in Paris, where, as usual, she made numerous friends and, even during the war, put on well-received
dance recitals, sometimes in collaboration with, among others, Ludolf Schild, Lisa Duncan, and Mila Cirul. In 1937 she collaborated with Schild in the production at the Théatre Pigalle of a “ballet,” Le Fievre du Temps (music: Graca), employing a scenario based, intriguingly, on scenes from
current movies. As a Swiss citizen married to a French engineer, she remained fairly safe from the Gestapo and helped other dancers escape to safety. After the war, she drifted toward cultural-literary journalism (Robinson 134-136; Jelavich 259-260). When she first arrived in Paris, Marcus rented a dilapidated little theatre in which, according to her unpublished memoirs, one could see mice scurrying across the stage during performances. She shared this space with one
of the most renowned of all the Weimar comic dancers, Valeska Gert (1892-1978). Born in Berlin to a wealthy Jewish family, Gert led a complicated international, interdisciplinary life, which she recounted in four auto-
biographies (1931, 1950, 1968, 1973) and which Frank-Manuel Peter abundantly documented in 1985. But Gert’s dance aesthetic was also complex, allowing her to function in different artistic contexts: dance recital,
cabaret, film, theatre, and writing. In the realm of dance, her success remained confined largely to the performance of grotesque caricatures, though she made occasional efforts to explore a wider emotional range. Her strength was also her weakness—an acute distrust of romantic feeling—
yet she began her career with one of the more romantic figures of prewar German dance culture. At first she considered some sort of career in the fashion industry, but in 1915 She started taking acting lessons from Maria Moissi. Through her Gert
came into contact in 1916 with the dance school of Rita Sacchetto, from whom she apparently received little guidance on matters of technique. Nevertheless, Sacchetto gave Gert a chance to perform her solo Tanz in orange (1916), a parody of ballet movements danced in a curious orange dress with
SOLO DANCING 203 billowy pantaloons. This piece was appealing enough to appear as an intermezzo item on a program of silent films. Meanwhile, Gert pursued opportunities as an actress, appearing (1917-1919) in small, odd roles—a witch, a skeleton, a parrot, a child, and so forth—in expressionist dramas and productions in Munich and Berlin. She created cabaret dances and in late 1917
introduced them in Berlin; they were so popular that by 1919 she was a prominent figure in the Berlin dance culture. Her interest in acting for the stage faded as her interest in more modernist modes of performance intensified. In 1923 she participated in an unusual production that began with the showing of an abstract color film by Walther Ruttmann, Opus 2, followed
by two grotesque dances performed by Jutta Hertig and then, after the intermission, Gert’s performance in the title role of Salome in Wilde’s play. The program purported to demonstrate, as Gert explained, the difference between technology-driven and actor-driven forms of performance, with the Salome fragments employing extremely austere scenic elements. Gert played Salome in a simple red apron-dress, and she created the “head” of
Jokanaan simply through the movement of her bare hands; Herodias and Jokanaan wore, respectively, green and silver-gray dresses, and Herod wore blue pajamas. For the Dance of the Seven Veils, Ruttmann accompanied her with “meowing” sounds on a cello, along with the “rhythmic, passionate howling of some women behind the stage” (FPV 26). Between 1924 and 1931, Gert appeared with memorable distinction in several major films of the Weimar era: Ezn Sommernachtstraum (1925), Die freudlose Gasse (1925), Nana (1926), Alraune (1927), Tagebuch einer Verlorenen (1929), So ist das Leben (1929), and Die Dreigroschenoper (1931). In all these
films she played unsavory or rather freakish characters. She always left a strong impression on the spectator, but her roles remained small, and she never became a star. Berlin photographer Suse Byk made the first film of Gert dancing, Die Kupplerin, in 1925. Throughout the Weimar years, she supplemented her comic dances with sketches and songs for cabaret per-
formances in Zurich (1918), Oslo (1919), Munich (1922), and Berlin (1926, 1931). In 1932 she formed her own cabaret company, but it provoked highly ambivalent responses. She had participated with the great dramatist Bertolt Brecht (1898-1956) as early as 1922, in Munich, on a cabaret project, Der Abnormitdtenwirt, that included appearances by the
grotesque actor Max Schreck, the comedians Lisel Karlstadt and Karl Valentin, and Brecht himself. In 1929 the Baden-Baden premiere of Brecht’s Badener Lehrstuck contained a filmed sequence, shot by Karl Koch,
of Gert performing her dance Der Tod (1927). Her international identity expanded with performances in Paris (1926, 1930) and a tour of the Soviet Union (1929), where she became friends with Soviet film director Sergey Eisenstein (1898-1948), who regarded her as the most interesting of all modern dancers.
204 SOLO DANCING
Unlike most dancers, Gert published many brief articles on dance in major periodicals, often from a critical-satirical perspective, but her ability to understand dances other than her own was quite limited. The triumph of Nazism compelled her to wander internationally and not very successfully
in search of a cabaret career, first in Paris (1933), then London (1934), New York (1936), London (1937), Hollywood (1939), New York (1940), Provincetown (1941), Paris (1947), Zurich (1948), and finally Berlin (1949). Her first husband, the physician and Sanskrit scholar Helmut von Krause (1893-1980), had built her a vacation cottage on the North Sea island of Sylt back in the early 1930s, and in 1955 she opened yet another cabaret there; it, too, failed to prosper, because of her excessively austere attitude toward scenic decor and production values. But she was always resourceful, publishing books, making guest appearances, and doing an occasional small, bizarre role in a film—for example, the hermaphrodite in Fellini’s Juliet of the Spirits (1965) and the Old Bird in Ulrike Ottinger’s Die Betorung der blauen Matrosen (1975). Gert’s dances appealed primarily to a disillusioned intellectual elite that favored modes of performance embodying a critical attitude toward socially
determined conventions of signification. Even in her most serious pieces, such as Salome and Der Tod, she parodied conventions of signification, in contrast to Marcus, who tended to parody the idiosyncratic movements of personalities. Hers was an art of satiric quotation. Like Niddy Impekoven she always worked on a small scale, but unlike her Gert never confused smallness of scale with childlike naiveté. Moreover, the range of subjects she parodied was fairly wide, although her repertoire of dances as a whole was small. She started by parodying dance itself—first ballet, in Janz in orange (1916), then social dances such as the waltz, fox trot, and Charleston. Her Japanischer Groteske (191'7) and Japanischer Pantomime (1921) parodied not only Kabuki-style movements but also images of male bodily assertiveness
that already seemed parodies; Gert stamped, strutted, and grimaced with wildly swinging arms, turning Kabuki into a parody and parodying the parody. She also parodied the conventional Spanish dance, the Negro dance, the gavotte, the minuet, and the expressionistic dance incarnated by Mary Wigman, whose compositions, according to Gert, were “never vehemently released from a central force, but constructed and therefore never unified. Something always remains stiff. She is completely undancerly in a higher sense, because she is physically and intellectually without rapture” (Gert, “Mary Wigman,” 362).
In 1919 Gert moved toward the parodying of sleazy social types with Canaille, in which she impersonated the movements of a street girl who transformed herself from a “sweet, helpless” waif into a brazen, lewd, vulgar slut (KTP 4, 1920, 115-116). This parody of feminine modes of seduction remained in her repertoire until at least 1930. In Die Kupplerin (1920) she
SOLO DANCING 205 was apparently even more lascivious (and disturbing) in her portrayal of a procuress, but in this case the imaginary object of her extravagantly wanton movements was not a man but a woman she wished to turn into a prostitute (a dramatic situation defining her role as Frau Greifer in the film Dre freudlose Gasse); here she parodied the movements she had already used to parody seduction in Canaille. More lurid still was Griiss aus dem Mumienkeller (1925), in which she presented, through movement above all, the most sordid, depraved embodiment of female desire “greeting” the habitués of the mummy dive, a “hellish vision of misery from the deepest depths” and an excellent example of “pornochoreography,” according to a 1926 comment in the socialist journal Vorwarts (FPV 39). In the mid-1920s, Gert extended her range of parody subjects to include the boxer, the cabaret singer, the concert singer, the celebrated pianist, the “profane Madonna on the cigarette package,” and the circus clown (Figure 51). With Verkehr (1926) she parodied the impatient movements of pedestrian, driver, and traffic cop at a busy Berlin intersection, and in Kino (1926) she parodied cinematic newsreels and film-star posturing. In the late 1920s, she began doing parodies of abstract emotional conditions, such as “nervousness,” “pleasurable despair,” and, most interesting, “tragic sorrow.” The latter characterization appeared in Kummerlied (1928), in which she distorted the movements and sounds of sobbing until she burst into a scream, then subsided into a slow, weak, dry, pulsating sobbing (Gert, Mein Weg, 41). In these strange pieces, she used dance to parody conventions of acting, and only a dancer with strong acting talent could produce such entertainingly sophisticated semiotic analysis. Actors tend to conserve rather than
complicate bodily movement, preferring to emphasize the transparent function of a gesture instead of its autonomous beauty, although in 1920 a critic complained that Gert’s dances suffered from too much superfluous, “restless” movement (KTP 4, 116). Gert relied heavily on her upper body to
construct parodistic signification, but in Der Tod (1927) she went to extremes, wearing a simple black dress and painting her face white. One critic wrote: “She does nothing. She stands and dies.” That is to say, she moved only her hands and face; her eyes, mouth, chin, cheeks, forehead, and shoulders did all the dancing to convey the approach of death, presenting a “face which seeks help... and already knows that nothing more is possible, no return, no escape.” No music accompanied the piece, just the dancer’s soft sighing or moaning. The movements of hands and face grad-
ually diminished into a “soft and scarcely perceptible trembling.” She became so still and silent, yet with eyes wide open, that spectators could not even hear themselves breathe, so powerfully did the parody of dying intensify rather than dissipate the fear of death (Hildenbrandt 128-129). Gert always danced to popular forms of music—waltzes, Charlestons, tangos, jazz tunes—for “so-called art music says nothing to me.” She claimed
206 SOLO DANCING
her favorite musical instruments were the accordion, the saxophone, the calliope, and the street organ. She contemplated a “new music” derived from the sounds of neighing horses, mooing cows, squeaking birds and frogs, barking dogs, the rustling of wind or waves, the buzzing of airplanes and motorcycles, the pulsation of machines, the scolding of women (Gert, Mein Weg, 44-45). She believed, however, that dancing without music was “senseless,” for she regarded music as the whole motive for dancing. Thus, for her, Der Tod was “no longer a dance” but simply an impersonation of
dying and death (Gert, “Der neue Tanz”). Hardly any other dancer appeared so closely identified with the cynical, antiromantic atmosphere of Weimar-era Berlin. Bragaglia thought she was the most vivid incarnation of
femininity deformed or demonized by immersion in “modern life, the immensity of the city” and the most perfect example of the “macabre apparition” the dancer becomes when she invests the grotesque with purely modernist qualities (Jazz Band, 161—168). But one can just as well say that, through her dance parodies, Gert embodied a highly intelligent femininity, deriving ecstasy from the “brutal,” as she put it, deconstruction of semiotic conventions that strangled bodily expressivity with “gracefulness.” One could discuss other dancers who pursued careers in the solo concert
mode, including Lisa Ney, Hannelore Ziegler, Tatiana Barbakoff (18991944), Leni Riefenstahl, Oda Schottmuller (1905-1943), Ilse Meutdner, and numerous others. However, their contributions to the solo medium still
remain inadequately documented or, as in the case of Riefenstahl, less important than their contributions in another vein. As for Meutdner, she did not begin giving solo concerts until the late 1930s; though she was not
an especially innovative dancer and did little to expand the expressive power of the solo medium, she was nevertheless significant in preserving a
measure of the individuating spirit of Ausdruckstanz during a time (1937-1949) of intense efforts to discredit Weimar-era dance. Oda Schottmuller was a sculptor as well as a dancer and created an extraordinarily imaginative variety of self-designed masks of fascinating, exotic beauty; in one dance from 1940 she wore a tuxedo, carried a bowler and umbrella, and covered her head with a mask that made her bald and put strange eyes on her forehead, above her real eyes. She also employed music written especially for her, including a “xylophone dance,” and, intriguingly, she constructed dance cycles using the music of different composers. But knowledge of her aesthetic remains obscure; research has focused on her participation in the anti-Nazi resistance and her arrest and decapitation by the Gestapo. Her dances themselves apparently did not trouble the authorities, who permitted her to perform them for troops at the front (Molkenbur; MS 202-203).
Pair Dancing
Although the solo dance was perhaps the strongest medium for projecting a distinctive attitude toward the body, it lacked power to expose insightful attitudes about relations between bodies. Such attitudes never escape affiliation with attitudes toward sexual difference, sexuality, and erotic orientation; in spite of occasional modernist efforts (such as the Triadic Ballet) to construct an abstract, genderless human body, no convincing justification has yet emerged for the belief that the sex of the dancing body “doesn’t matter” in exposing relations between bodies. Modern dance clearly expanded conditions of freedom for the female body, but it did little to undermine the
perception that dance was a feminine art and a culture overwhelmingly populated by female bodies. The dearth of male dancers in the art made it almost impossible for many female dancers to explore in a satisfactory manner their unique attitudes toward sexual difference and erotic feeling. The
solo format allowed them to dramatize this powerful absence and to disclose the redemptive beauty of moving alone. In a sense, the solo dancer’s partner was the spectator, whose sexual identity was often ambiguous—even more so in relation to solo dancers than to many all-female group dances in the schools. The solo dance exposed a relation between the passive, desiring body of a critical spectator and the active, desired body of a performer:
the solo dance established the desirability of a body vis-a-vis the desiring body of the spectator. That the structure of desire entailed greater complexities than the passive-active dichotomy indicated was obvious even to the solo dancers, par-
ticularly those who ventured into realms of the grotesque, the bizarre, and the tragic, where desirability asserted itself with less certainty and desire required more active articulation than in conventional contexts. But such ambiguities could scarcely modify the perception that dance was a 207
208 PAIR DANCING feminine mode of expression. In a 1913 comment on the “metaphysics of dance,” Paul Hatvani claimed that men find their identities through action that builds representation, art, images of ideas, whereas women find their identities, their being (Dasein), in “the dance—the only expressive form of womanliness,” a form that has no intellectual significance. “I saw a woman dance a dance which signified ‘God’: a smile lay on her cheeks. . . . For the true woman every movement is dance and in every movement she gives something of herself to a beloved” (24-27). No doubt this sort of thinking, which is as prevalent today as it was in 1913, inspired Mary Wigman to remark in response to a 1926 “question about the dance as an expression of sensuality: ‘I envision only our aim. My students must give such an impression that every man should enthusiastically call out: “I would not like to be married to any one of them!”’” (MWB 96). But such comments merely reinforced the perception that dance was a zone of signification wherein women made up all the rules and were free of competition from or even for men. If anything, Wigman’s remark called greater attention to the cryptic aura of female homoeroticism emanating from various schools
and their groups (including Loheland, Gunther, Hellerau-Laxenburg, Tels, and Wigman) that consistently fostered a hostile attitude toward the inclusion of male students. The strongest attempt to cultivate the idea of the new male dancer came from Laban and his disciples, but the rationale they employed was not alto-
gether persuasive. In Die Schonheit (22/2, 1926, 69-81), Wilhelm Burghardt, a Laban disciple, proposed a theory of “Der mannliche Tanzer,” asserting that, due to physiological differences, serious male dance differed significantly from female dance. He criticized Hans W. Fischer’s Wezberbuch (1924) contention, very similar to Hatvani’s, that dance, as the essence of feminine being, feminized and diminished the unique beauty of the male body. Burghardt pointed out that in other historical and cultural contexts men had dominated the art of dance and that even in many European cultures the construction of a manly, warrior identity depended on displaying
skill at dancing. Recent geniuses of German culture, such as Goethe, Beethoven, and Nietzsche, showed no fear of dance, and Beethoven’s desire to take turbulent walks during thunderstorms was evidence of a male mode of dancing. As Burghardt saw it, the industrialization of European civilization since the French Revolution had intensified sexual difference in regard to the coding and display of bodily movement. What inhibited men from becoming dancers was the misguided notion that men should move in the same way as women. Rather, men should derive their sense of dance movement from “natural” sources of male action such as felling a tree, pulling a rope, or pushing a wagon. Yet photographs accompanying this and other
articles in the special Laban issue consistently showed nude men and women performing the same types of movement and never gave the impres-
PAIR DANCING 209 sion that a presumed sexual identity for movement somehow compromised the sexual identity of the body.
In any case, male dancing within the Laban cult remained confined largely to lay movement choirs, and although some of the Laban schools produced a few memorable male teacher-choreographers (Jooss, Gleisner, Weidt, Keith), one clearly could not get men to pursue serious careers as dancers by arguing that dance could elevate the esteem in which other men held them. The key to getting men to dance lay with women: men were much more likely to dance in response to a desiring voice of women than to some sort desirable or desiring voice of men. Hertha Feist (Berlin), Helmi Nurk (Bremen), and Margarethe Schmidts (Essen) probably enjoyed more success in recruiting male students than any other schools, but on the whole
women in the modern dance movement remained quite reticent about expressing a desire to dance with men or to see men dancing with women, and they did little even to acknowledge that the absence of men in artistic performance was a problem. Consequently, men with strong dance talent preferred to pursue opportunities in the admittedly moribund world of ballet, where female dancers responded much more favorably to the presence of male dance prowess. Male desire to dance manifested itself much more clearly in the realm of social dance, which, especially after the introduction in the prewar years of modernist forms of social dance such as the fox trot, tango, shimmy, samba,
turkey trot, Boston, apache, and grizzly, became increasingly a zone of opportunity for aligning the display of sex appeal through bodily movement with expanded social mobility. The fantastic popularity of the tango, introduced around 1907, did much to undermine the authority of the waltz
as the optimum dance for idealizing bodily relations between male and female. The interest of the upper class in escaping the nostalgic lyricism and decorative modesty of the waltz precipitated a curious interaction between
high and low culture (where most modern social dances originated), a process that rapidly evolved in favor of upper-class tastes. Social pair dancing established codes of conduct that did not feminize the male, who could always expect to “lead” his partner. Even in dances where the woman took the lead, as was sometimes the case with the tango or the fishtail, the man did not suffer stigmatization, for by taking the lead the woman presumably expressed an even stronger desire to dance with a man. Mastery of social dances showed quite dramatically the extent to which a man was sensitive to a woman’s body and inspired a woman’s sensitivity to a man’s body. Moreover, mastery of social dance skills seemed tied to the cultivation of cosmopolitan masculinity and a modern image of the “gentleman.” Koebner and Leonard’s Das Tanz-Brevier (1913), with an initial run of 20,000 copies, not only explained, with the help of numerous elegant photographs
and drawings, the correct execution and semiotic significance of various
210 PAIR DANCING
social dances, it situated social dancing within an elaborate, aristocratic, and sport-tinged code of superior male urbanity and competitiveness. Koebner described this code in even greater detail in Der Gentleman (1913),
a suave guidebook dealing with the aesthetic of smoking jackets, gloves, valets, monocles, and hand kisses, as well as proper bearing at tea dances or
the performance of rags and tangos. These works implied that modern social pair dancing no longer belonged primarily to the somewhat sleazy, desperate, lower-class environment of taverns and dance halls described only a few years earlier by Ostwalt in Berliner Tanzlokale (1905) and the fourth volume of Das Berliner Dirnentum (1906). Interestingly, impulses toward “sexy” bodily movement and display in that milieu did not allow male and female dancers to get close to each other, or even touch, a situation quite similar to most rock dancing today. After the war, jazz music increasingly displaced folk music in shaping the identity of social dance forms. Jazz-oriented social dancing took on the characteristics of a sport; according to Heinz Pollack in 1924, a dance, like a doubles tennis match, disclosed not the erotic or social relations between the partners but their compatibility as performers: “[T]he new dances... are only dances and not masquerades” of sublimated erotic “wishes and drives” (“Erziehische,” 124). Pollack had already designated social dancing as a sign of powerful social transformation in Die Revolution des Gesellschafts-
tanzes (1922), but Rudolph Lothar insisted that jazz worked to expose rather than sublimate the expression of erotic desire, for “the rhythm [of jazz] is so to speak the iron cage in which the noise of the primeval forest becomes adapted to the salon . . . and the rhythm pulls one into voluptuous depths in which no sound and no light from quotidian life penetrates” (88). The confusion inspired by the erotic ambiguity of social dancing led August Traber-Amiel, previously the author of a comprehensive instruction manual, to propose, in the pamphlet-sized Der Tanz als Weg zur neuen Kultur (1924), that anxiety over the erotic significance of social dancing would diminish only when social dancing established itself not as a sport or recre-
ation but as an art in which superior mastery of technique produced a “deep” exploration of the emotional currents binding male and female bodies together. Types of music or movement were always less important than the quality of the partners’ responses to each other. Nevertheless, as Leonard aphorized in Tanzsport Almanach 1924, people with different tastes
in music often marry, but then they are not able to dance together (g5). At any rate, jazz became identified with an unsystematic effort toexpand — the emancipatory significance of social dance, even if that meant provoking greater and greater uncertainty regarding the extent to which social dances affirmed or undermined sexual morality. Jazz-driven social dancing became an important, ever-expanding sector of the German entertainment industry and probably an even more pervasive sign than modern dance itself of the
PAIR DANCING 211 modern hunger for ecstasy (Eichstedt 37~—72). Despite copious efforts to produce their own, unique jazz music, the Germans persisted in viewing both jazz and the new forms of social dance as imports, manifestations of foreign bodily codes. Though German popular composers showed much inventiveness in modernizing older, folk-derived dances such as the tango, the waltz, and the mazurka, their success in producing jazz music that competed well with American tunes was limited, to put it mildly; in the huge “TanzSzene Berlin” series (1925-1934) of recordings compiled by KarlHeinrich Jordan, for example, numerous dance orchestras professing to offer jazz tunes show a curious inability to escape the relentless “oompah”
of march or polka rhythms. The German enemies of jazz were numerous | and grandiose in their apocalyptic condemnations of it as a symptom of decadence, addiction, racial impurity, sexual immorality, capitalist amorality, Jewish morbidity, Bolshevik propaganda, or animalistic submission to “low,” uncultured instincts (Schroder 329-365). But because its rhythms and harmonies urged the body to display mastery of “sexy” movements, Jazz strengthened the perception that social dancing was the most overt expression of female desire to dance with a male, and as long as this desire asserted itself with ever-greater confidence, men had strong incentives to become
_ dancers.
Not surprisingly, then, in the realm of Ausdruckstanz, pair dancing between a male and a female amplified the value of the male dancer and dramatized female desire to dance with males. Indeed, expressionist pair dancing showed the power of this desire to produce art worth watching. Pair dancing performances were almost entirely done by a man and woman who formed their own tiny company to produce concerts featuring each other, for men appeared “effeminate” if they danced either alone or in a company overwhelmingly composed of females. Some pair dancers (Isa Zarifah and Fred van Hutten; Jan Trojanowsky and Frida Hess) apparently confined themselves to appearances in cabarets and nightclubs, and their work remains poorly documented. Even the work of more “serious” pair dancers is still frustratingly scant, despite their considerable popularity at
the time; these included, in the 1920s, Ernst Matray and Katta Sterna (1897-1984), who later joined Trudi Schoop’s company, and, in the 1930s, the ballet-trained Alexander von Swaine (1905-1990) in partnership with Alice Uhlen, then Darja Collin, then Lisa Czobel (b. 1906). Czobel also paired with Karl Bergeest, who eventually became her husband. Equally vague is the partnership between Ruth Abramowitsch and George Groke, which began in Berlin around 1930 and continued in Warsaw after 1933. Pair dancing on the concert stage was extremely rare in Germany before 1914, and hardly any documentation of it exists before that time beyond Pavlova’s occasional numbers with a male ballet dancer, whose function was simply to heighten her own idealized desireability. Of course, the pairing of
212 PAIR DANCING Olga Desmond and Adolf Salge in Berlin in 1908 provoked much interest because of Desmond’s nudity in performing dances inspired by ancient Greek statuary; but, having aroused so much curiosity, the couple declined to continue their partnership. In Stuttgart, Elsa Hotzel and Albert Burger may have been active as early as 1912, but their work remains completely obscure. In 1913 the German artist Alastair (1887-1969), soon to become famous (or notorious) for his exquisitely lurid illustrations of literary works and contemporary personalities, performed “chimerical” dances with a Russian woman called Katerina in the Paris mansion of Baroness Ilse Deslandes. According to Gabriele d’Annunzio, Alastair performed “Gothic dances” in an “azure tunic brocaded with gold,” then moved gravely in the violet robes of a bishop while “bronze antelopes and other nimble animals of the Far East grazed in the carpets.” Sinking into cushions, Katerina seemed a figure of wax with enameled eyes, but her legs and ankles moved lightly and delicately, “like a serpent twitching its tail in love or in wrath” (149). It was an eccentric soiree that apparently did not persuade Alastair to develop further his talent in this direction, but the strangely androgynous aura he cast reappeared in the work of other male pair dancers, including Hans Wiener, who was active in Gera (1925-1926) as a modernist theatre choreographer before teaming up (1928) with Ottilie Foy in New York. Photos of his Ethiopian and Hindu dances convey an impression of florid, decorative male beauty (Martin, “New Dance”).
Helge Peters-Pawlinin (1903-1981) perhaps displayed an even stronger bisexual aesthetic. He had a long career as a dancer, choreographer, and costume designer, beginning with the Rita Sacchetto ballet company, then moving on to the Lotte Fassbaender company, the Rhea Glus company, and the Ellen Petz state opera company in Dresden (1927) before running his own Romantische Ballett in Munich from 1936 to 1943. After the war
he concentrated on choreographing large-scale ballets with dark and somewhat perverse themes, such as Der Student von Prag (1950), with Harald Kreutzberg, the controversial Abraxas (1948), and the rock opera Mixed Media (1973). As a dancer, however, Peters-Pawlinin displayed such ambi-
guity of sexual identity that he scarcely needed a female partner: often within the same dance he shifted abruptly from “masculine” virility to “feminine” undulation; in 1928 photos of him, both his costumes and his movements are so sexually ambiguous that it seems as if he were his own partner (Peter). Male bisexuality of this sort was not an uncommon feature of pair dancing concerts, for the male and female dancers did not perform all the dances together and did as many solos as they did pair dances. This
convention served to accommodate more than costume changes: it allowed the male dancer an opportunity to display a solitary consciousness of his divided sexuality.
PAIR DANCING 213 LO HESSE AND JOACHIM VON SEEWITZ
Lo Hesse and Joachim von Seewitz were active in Munich and Berlin between 1916 and 1920. Their dances relied heavily on extravagantly exot-
ic costumes designed mostly by the Munich expressionist artist Walter Schnackenberg (1880-1961), who also produced several charming art deco figurines of Lo Hesse (Schnackenberg; Arwas 214-216). The couple favored fantastically Oriental, Venetian, Spanish, or rococo costumes that had the effect of making dance a sign of ultrarefined luxury and exquisitely privileged voluptuousness. This linking of dance to fashion and fashionableness did not escape criticism. Hildenbrandt condemned Lo Hesse for appearing in fashion magazine poses behind the wheel of her Mercedes or
with her sleek greyhound, and he deprecated the couple as “female and effeminate mannikins for a refined masquerade wardrobe” (Briefe, 50-51). However, Elegante Welt (6/1, 3 January 1917, 4-5) praised the “orgy of beauty” and “inclination toward the bizarre” created by the couple, as well as their lack of sentimentality. Seewitz was self-taught as a dancer, but the journal compared him favorably with the great Russian male dancers. In 1920,
Ola Alsen, writing for the same journal (9/1, 7 January 1920, 7), maintained that he was “undoubtedly” the greatest of all male German dancers. Virtually all commentaries presented Lo Hesse as the decidedly inferior dancer of the pair. Nikolaus suggested that Hesse’s sense of bodily rhythm was too measured and constrained, too lacking in boldness, whereas Seewitz, despite his elaborate costumes, moved with great freedom and showed enchanting skill in shifting abruptly from one rhythm to another, although all his movements seemed suffused with lyrical “boyishness” or undulant femininity; Hesse strove to keep up with Seewitz, but she was incapable of dramatizing any serious idea of “striving” (50, 74-76). Térok in 1918 supposed that Hesse disguised her lack of talent behind a luxurious wardrobe, but he lauded Seewitz as an example of “pure fluidity,” a dancer who almost seemed not to have a body (11).
Apparently Hesse achieved more satisfactory performance when she danced with Seewitz than when she danced her solos, but the two of them performed only a couple of dances together, the Moszkowski Masquerade and Weber's Invitation to the Dance, and these never delighted as much as Seewitz’s solos. His most significant piece was probably Heliogabal (1919), a “terrifyingly beautiful masterpiece of pantomime” in which he evoked the perverse sun-worship ritual of the homosexual Roman emperor (KTP 4,
1920, 120). Here he displayed his effeminacy with stunning boldness: he swathed himself in a dark, satiny robe, which he opened up and discarded to reveal a “super-slender, quite lean” body decorated with pearl necklaces, earrings, slippers, bracelets, lipstick, mascara, a glittering blouse, and a gorgeous miniskirt. All of his movements were feminine insofar as
214 PAIR DANCING they consisted of serpentine undulations and narcissistic basking in his own refulgence. Imperial and cosmic power seemed concentrated in a “terrifyingly” ambiguous image of maleness. Seewitz also performed, in Pierrot cos-
tume, the “dancing fool” to Debussy’s music and a “grotesque waltz in black” to music by Chopin, but his main achievement was to make the presumed “effeminacy” of the male dancer a more disturbing source of power than the term implies. However, he achieved this effect probably because he chose such a weak female dancer as his partner. WALTER HOLDT AND LAVINIA SCHULZ
Knowledge of the astonishingly bizarre and tragic art of Walter Holdt and Lavinia Schulz is obscure and largely based on the rediscovery in 1986 of artifacts deposited in a Hamburg museum back in 1925 (Jockel 55-75). The artistic power within this couple apparently lay with the woman, for virtually nothing is known of Holdt. After suffering from a severe ear disease, Schulz (1896-1924) studied ballet, painting, and music in Berlin, where as early as 1913 she came into contact with Herwarth Walden’s Sturm circle of expressionists. Through this circle she became friends with Lothar Schreyer, who invited her, “my first student, a genial person with violent passion,” to perform, apparently nude, in his wild production of August Stramm’s Sancta Susanna in 1918 (LS 197). When Schreyer, disillusioned by his struggle to form an avant-garde theatre in Berlin, moved to his native Hamburg in 1919, Schulz followed him. It is not known whether she met Holdt there or whether they had already met by this time. In Berlin Schulz was a costumer and seamstress for Schreyer’s early Kampfbtihne productions, including the 1920, Edda-inspired Skirnismol; Holdt played Skirnir in a heavy, robotically abstract costume but seemed to dance in it without difficulty. Schulz married Holdt in April 1920, and the couple soon drifted away from Schreyer, for, as Schulz explained in a note, “Expressionism is not a solution; expressionism works with machines and industry.” Schulz and Holdt led a fanatically austere existence in a bizarre expressionist cellar apartment without a floor, bed, or hot water. They slept on straw and dedi-
cated themselves religiously to the construction of their strange mask dances, wearing gray tights during the day so that they could work on the dances as they worked on the masks and costumes. The couple became obsessed with recovering an archaic Aryan-Nordic identity free of JewishChristian contamination. According to H. H. Stuckenschmidt, who was their friend, Schulz craved hardship: “Poverty, hunger, cold, Nordic landscape with snow, ice, and catastrophes: that was her world, and with Holdt she found it” (36). The couple put on only a few dance concerts between 1920 and 1924, but these were among the strangest produced by the whole Weimar dance culture, and although Hamburg audiences responded with
PAIR DANCING 215 bewilderment, critics tended to recognize a powerful imagination. The marriage, however, experienced intense strain. The couple had great difficulty earning any money and longed to find a way to live without it; Holdt apparently possessed a character that was not entirely trustworthy, and Schulz was violently jealous, perpetually terrified that Holdt would betray her for another woman. In 1923 she gave birth to a son, but in this last year of the great inflation she and Holdt suffered from continual hunger. In June 1924 police
discovered their bodies in the bizarre cellar apartment, with the baby between them. Schulz had shot Holdt to death, then killed herself. Husband-wife dance pairs are quite rare on the stage; in the case of Schulz and Holdt the concept of marriage entailed a peculiarly deep implication in that it also referred to a haunting marriage of dance and costume. The couple created dances and costumes together and at the same time, so that bodily movement and the masking of the body arose from the same impulse. Schulz was a highly gifted artist whose drawings and sketches invariably star-
tle the viewer with their hard primitivism and demonic abstraction, but Holdt assumed much responsibility for the design of the costumes and masks; for most of the costumes deposited in Hamburg, it is not possible to assign definite authorship to Schulz. The mask portions consisted mostly of fantastically reptilian, insectoid, or robotic heads, whereas the rest of the costumes comprised eccentric patchworks of design, color, and material to convey the impression of bodies assembled out of contradictory structures.
One costume consisted of a white veil draped over a nude female body, topped by a large mask shaped like a triangular birdcage. To develop the “abstract organicism” of the mask-costumes, the couple built their designs out of diverse materials: wood, leather, rope, wire, metal, canvas, cloth, yarn, clay, cardboard, and gypsum. The costumes were often quite heavy and difficult to move in, because Schulz believed that art should be hard, an expression of struggle; however, all of the costumes disclose a quality of cartoonish, demonic grotesquerie rather than frightening ferocity (Figure 52). The couple gave the costumes eccentric names, as if they were mysterious pets:
“Tobaggan,” “Springvieh,” “Technik,” and so on. Yet the designs never achieved the level of abstraction reached by Schreyer or Schlemmer, partly because Schulz and Holdt cultivated a zealously ecological consciousness
that made them associate abstraction with redemptive organic forms of nature and the animal world but also because the couple had a more refined feeling for bodily movement than Schreyer or Schlemmer did. Schulz repudiated the ballet aesthetic she had studied in Berlin. In 1921 she published her notation of the dance Mann und tote Frau, using a graphic “scoring” technique similar to what Schreyer had done for Kreuzigung
(1920), although Schulz’s scoring was more precise and lucid. This Tanzschrift indicated a dance style built out of varying intensities of creeping, stamping, squatting, crouching, kneeling, arching, striding, lunging,
216 PAIR DANCING and leaping in mostly diagonal-spiraling patterns across the performance space, with both arms thrusting or grasping and the whole occasionally punctuated by pauses. It is not clear what the costumes or music were for this dance, but it is evident that the movement was uniquely expressive in dramatizing the violent struggle of a female body to achieve central, dominant control of the performance space and its emptiness. As for music, the couple worked with H. H. Stuckenschmidt, who composed a “dadaistic” piece for Springvieh (1922) and arranged “trivial music” for the ecstatic Mein Blut (1922) and Toboggan (1921). For Ungegeheuer vom Sirius (1922), a contribution to a Hamburg “astral dance show” involving several artists, Stuckenschmidt composed a shimmy; Schulz and Holdt “dashed in wild rotation;
between them a star nebula of Loheland girls, swirling to the perimeter, their raised arms a wave full of delicate arpeggios” (Hans Fischer, Hambur- — ger, 265). Jockel regards the couple as an example of the self-destructive fate
that awaits people who live so completely for their art that they become mortally estranged from life (75). The Schulz-Holdt dance aesthetic does seem to embed a powerful masochism, not only in the marriage between dancers but in the equally passionate marriage of mask and movement. But the dances of this strange couple were also a kind of bizarre, expressionist demonization of marriage itself, the most grotesquely touching critique of pairing to appear in the whole empire of German dance culture. THE FALKE SISTERS
Female pair dancing enjoyed special appeal because it dramatized competing models of femininity and exposed conditions under which one model of femininity dominated or achieved equilibrium with another. The homoerotic dimension to this sort of pair dancing was not negligible in supporting its appeal. For this reason, perhaps, it is extremely difficult to find any examples of male pair dancing, although Kurt Jooss did experiment with male duets in larger dances. Female pairs appeared more frequently in the period 1916 to 1921, and Mila Cirul danced with her sister Elia in Paris as late as 1935. The three Wiesenthal sisters were popular in the prewar years, but when Else and Berta formed a separate pair (1908-1914) they achieved only modest success. Ruth Schwarzkopf (1go00-?) danced with her sister Isabella (1899-1918) before turning to the solo mode, and in Vienna, Mila
Cirul formed a pair with Ellen Tels in 1919-1920. During the premiere exhibition in Berlin of two movies in 1916, Valeska Gert and Brigitta Riha,
wife of the artist Erich Heckel, performed an intermezzo pair dance to Debussy’s Golliwog’s Cakewalk in which one dancer wore white and the other,
clad in black, moved in “snakelike” fashion around her (FPV 29-30).
Perhaps the most interesting of the sister pairs was that comprising Gertrud (1890-1984) and Ursula (1895-1981) Falke. Their father, Ham-
PAIR DANCING 217 burg poet Gustav Falke (1853-1916), encouraged them to pursue artistic vocations and introduced them to prominent figures of the Hamburg cultural elite. After studying with Dalcroze in Hellerau (1911-1912), Gertrud established her own Dalcroze-oriented school in Hamburg in 1913 and the same year presented, with her students, her first public concert, which received much acclaim. Ursula remained uncertain of her artistic direction, drifting tentatively into music, painting, and sculpture, and she was grateful when her sister invited her to study dance at the new school and eventually become a director of it. For some time the Falke family had experienced intensifying financial difficulties, which exerted great pressure on the sisters to alleviate the situation. At Hans Brandenburg’s suggestion, the sisters went with Laura Oesterreich to Ascona in summer 1914 to study Laban’s ideas about bodily movement, but they found the atmosphere there uncongenial (“too technical”).
Not until 1916, after the death of their father, did the Falkes begin performing dances together. They enjoyed considerable popularity between 1917 and 1919, making fifty appearances in ten German cities, but the critical response never escaped the tentativeness and reserve emanating from the sisters themselves. ‘They consistently gave the impression of never giving
more than enough to please, as if they danced entirely in response to a momentary external pressure rather than out of a powerful inner drive. They were beautiful women, tall, slender, and dark, and they made much of
undulant, linear body movement, often on tiptoe, but they avoided any technical complexity and cultivated a restrained romanticism that reminded Brandenburg of the “nordic” music of Brahms (132). Peculiarly, they never attempted any productions with their students. In the solo portions of their concerts, Gertrud was apparently a more expressive dancer than Ursula, but they seemed strongest in the dances they performed together; in spite of Brandenburg’s preference for their solo dances, their pair dances provoked far greater pleasure. In these they embodied a “ghostly life.” For example, in Versunkene Kathedral (1918; music: Debussy) Ursula, clad in dark silky pants, moved as the shadow of her more radiant sister, whose short dress exposed her exquisite legs. The pair dances often dramatized a “darkness in darkness,” with both sisters wearing dark garments and constructing languid arabesques and eerie mirror movements out of the delicate intertwining of their bodies. Ursula, though tinged with “genial dilet-
tantism,” disclosed a “morbid, languid decorativeness,” a “mondainebizarre and capricious sense of movement” at the “edge of what is artistically possible.” This contrasted well with Gertrud’s soft smile, a fragile radiance slipping through the “nordic fog” (133-134). The Falke sisters favored conservative-romantic music—Chopin, Schumann, Reger, Rachmaninov, Grieg—and elegantly decorative fantasy costumes designed by Doris Boekmann. The appeal of their aesthetic reached
| 218 PAIR DANCING its strongest intensity in 1920, when Mary Wigman, a friend from the Hellerau and Ascona days, invited them to assist her in the formation of a dance school at the Dresden Opera. But this plan fell apart when political intrigue at the opera prevented Wigman from receiving the anticipated appointment. Soon thereafter, the sisters began to move in separate directions, although in 1922 they did appear together on a special program in Hamburg that also featured Lavinia Schulz and Walter Holdt. Gertrud married a lawyer, Hermann Heller, in 1921 and settled in Leipzig, where he directed the Volkshochschule, but his work as an expert on administrative law required further moves to Berlin and Frankfurt. Because he was a Jewish socialist, he and Gertrud migrated to Madrid in 1933, and when Heller died in 1936, she settled in England, where she worked with Kurt Jooss at Dartington Hall. She devoted herself in later years to dance therapy instruction in Scotland and London, where she died. Ursula sought to establish herself as a solo dancer; but this ambition proved difficult to attain because of her dark erotic life. She had long loved the sculptor Richard Luksch (1874-1936), under whom she had studied sculpture in 1914. She gave birth to his daughter in 1921 but she did not marry Luksch until 1923 because it took him until then to complete his divorce from his first wife. Because of his financial obligations to his previous wife and children, Luksch could not provide Ursula with the financial security she had craved since 1914. After the birth of her daughter she tried, unsuccessfully, to establish herself in the Berlin film industry. In 1925 she attempted to resurrect her career as a solo dancer by cultivating a more bizarre image. Luksch designed masks for three of her dances. In Der Prinz (1925) she wore a very androgynous white mask of vaguely Southeast Asian aspect, but her costume, which included dark, satiny pants, featured a vest with emphatically designated breasts (Figure 3). In Rosa (1926) her mask was that of a surprised little girl with ropelike, braided hair, reinforced by a very short, polka-dot dress. For Die weisse Frau (1925) she wore a white mask
that was actually an eerie caricature of her own face; the rest of her body remained shrouded in a gauzy white cloak, so she moved like a tall, lean Gothic apparition. Such effects, however, were not enough to sustain the interest of a reli-
able audience, for her sense of movement lacked dramatic power and always seemed governed by a sculpturesque perception of her body. By 1929 She had formed a partnership with another Hamburg dancer, Gertrud Zimmermann (1895-1962), and opened a new school that incorporated the theories of Laban, but this project was also a failure. In 1932 she and Zimmermann collaborated with Luksch on a most intriguing grotesque dance, Die grosse und die kleine Dummheit, which premiered at a Hamburg arts
festival. The piece featured an enormously inflated balloon-caricature of Adolf Hitler, who hatched two large eggs, from which emerged Zimmer-
PAIR DANCING 219 mann and Falke as a pair of lascivious, scantily clad, blonde-wigged carica-
tures of Aryan female beauty (Jockel 17~31). This piece was as much a
macabre critique of the dark sister pair Ursula had constructed with Gertrud Falke and then with Gertrud Zimmermann as a sociopolitical satire. After 1933 Ursula ceased dancing in public, and after the death of : her husband, in 1936, she moved to Berlin and taught in an arts academy. The Falke sisters had only minor artistic interest independent of each other, for what made them significant was their skill in disclosing the presence of another dark woman in the female dancer, an insight Ursula seemed to grasp with hauntingly ominous implication in her eerie Hitler dance. But the most curious aspect of the Falke sisters was their reluctance to exploit their strength with any rigor or visionary ambition; they seemed afflicted with languor, procrastinating gestures, a dilettantish disdain for technical complexity. Yet this resistance to ambition was perhaps their strongest
defense against the constant temptation to treat dance as primarily a response to the oppressive economic realities they inherited from their parents and then from the war. THE SACHAROFFS
Alexander Sacharoff (1886—1963) and Clotilde von Derp (1892-1974) formed the most enduringly popular dance pair in European history. The
aesthetic that bound them together depended on an atmosphere of extreme artificiality and refined gender game—playing, which may explain the couple’s great durability. Sacharoff was born into a middle-class Jewish family in the Ukraine. In 1903 he went to Paris to study painting at the Academie Julien under Bourgereau; however, when he saw a play in which the actress Sarah Bernhardt performed a minuet with Coquelin, he decided to become a dancer. In 1908 he began studying acrobatics in Munich, where he made friends with such modernist artists as Wassily Kandinsky, Franz Marc, Marianne Werefkin, and Alexander Jawlensky, for whom he some-
times posed as a rather androgynous figure. His own taste in art inclined much more strongly toward ancient Greek vase painting and fifteenthcentury Italian masters. He gave his first concert in Munich in 1910, and in all his early performances he projected the image of an ancient Greek vase painting figure, donning a kind of tunic-skirt while dancing to music (harps
and string quartet) by Renaissance Italian composers (Palestrina, Monteverdi, Di Lassos) or a waltz by Johann Strauss. In both movement and costume he strove toward adrogyny, which seemed to suppress all muscularity of expression. In 1912-1913 he danced with the Rita Sacchetto ballet com-
pany. Critics, according to Brandenburg, “found that the feminine part seemed masculine and the masculine feminine, and in fact Sacharoff moved with wonderful lightness; he even wept with his partner in his hands, without
220 PAIR DANCING making us think that because of this action he wanted to step too closely to a bad comedy not of his own invention.” For her part, Sacchetto sputtered in “incoherent and idle attitudes of a costumed doll” (148). Meanwhile, Clotilde von Derp was shaping her own career as a dancer.
Born in Berlin to an aristocratic family, she moved with her mother to Munich in 1900, where she studied ballet and violin. Like Sacharoff, she gave her first concert in Munich in 1910, and her success was such that Max
Reinhardt invited her to perform an elf role in a pantomime production, which led to her assuming the main role in his spectacular pantomime Sumurun in London in 1911. Brandenburg felt that before she teamed with Sacharoff she was a “purely lyrical dancer” with an unusual gift for constructing “rich” bodily rhythms, “song[s] of the blood” that did not seem dominated or determined by musical rhythms: her body appeared moved and freed by the music, not synchronized with it—not, so to speak, married to it (142-143). He regarded her partnership with Sacharoff as a mistake,
for she “denied her blood” and intellectuality to pursue an aesthetic that made him look more masculine and forced her to sacrifice her lyrical severity for an excessively sweet femininity (155). Brandenburg’s anti-Semitism somewhat clouded perception of the couple, but as a dance pair they hardly embodied the qualities pervasively associated with a distinctively German impulse in dance. They met in 1913 at an arts festival in Munich and decided to become a dance pair once they had
perfected their technique. When the war broke out, Sacharoff moved to Lausanne, with Derp following (1916), accompanied by her mother. The two did not begin dancing together until 1917, entirely in Switzerland. They married in 1919, and the same year in Zurich they made the acquaintance of the wealthy Edith Rockefeller, who offered to sponsor their performance at the Metropolitan Opera in New York early the following year. American audiences, however, showed little enthusiasm for the Sacharoffs’ aesthetic. In 1921 they settled in Paris, which became their base during the interwar
years, and they performed throughout Europe until 1930, when they embarked upon a successful tour of China and Japan. They repeated the tour in 1934, followed by concerts in Montreal, Detroit, and South American cities. In Spain when Germany invaded France, the Sacharoffs migrated, by way of Portugal, to Buenos Aires, where they remained until 1949, when they returned to Paris. In 1950, while visiting Italy, where they had once enjoyed much success, they met Count Guido Chigi Saracini, who invit-
ed them to teach a dance course at his Accademia Musicale Chigiani in Siena. Thus, from 1952 until their deaths they lived in Rome, teaching in Siena and at their own school in Rome at Palazzo Dorio. Although they stopped dancing as a pair in 1956, they remained prominent figures in the Italian dance world, with Sacharoff the subject of art exhibitions featur-
PAIR DANCING 221 ing his extravagant costume designs (Veroli; Fontaine; Ropa; Vaccarino; Vuillermoz).
The Sacharoffs made an enduring impression as a couple embodying a unified aesthetic, yet the pair performed only a few dances together, and most of these were romantic waltzes they had created in the years 1916 to 1919. Their romantic pair waltzes and chorales had the effect of masking differences between them and of presenting couplehood as the ultimate motive for dance. But despite Brandenburg’s contention that she lost her
distinctive sense of bodily rhythm through her match with Alexander, Clotilde did retain much of her original style in her solos, and her association with Alexander primarily implied (for him as well as her) a stronger mastery of ballet technique, although neither dancer was ever in any sense
a virtuoso. Ballet technique enabled the couple to build a repertoire of movements, which they applied to the construction of virtually all their dances into the 1940s. They introduced no innovations in movement, and Alexander in particular consistently showed a tendency to think out dances as a series of poses, an approach no doubt due to his education in art. His acrobatic training urged him to synchronize all his movements to the music, whereas Clotilde moved much more independently of the music, urged
more by the image the music created in her mind than by the rhythms themselves. In other words, she danced not to the music but rather to an idea within herself stimulated by the music, which is why Brandenburg described her style as “intellectual.”
Clotilde displayed a more eclectic and modern taste in music than Alexander, who seldom chose anything from the twentieth century, whereas she favored music created during her lifetime: Reger, Schmitt, Pizzetti, Faure, Stravinsky, Scriabin. The couple displayed little narrative imagina-
tion and had difficulty developing dramatic structures for their dances. However, Clotilde’s body possessed an extraordinarily dramatic and luscious glow, and in spite of her very dark hair her face exuded a hypnotic luminosity and her eyes a haunting, enticing shine. Indeed, perhaps no other dancer of the era owned such a powerful yet delicate repertoire of smiles. The music she chose projected mostly a melancholy or elegiac mood in a minor key, yet she always conveyed the impression that she experienced great pleasure in displaying, moving, and costuming her body. She seemed to suggest that no matter the context, she would feel some mysterious happiness on her own, aristocratic terms, whereas Alexander constantly adopt-
ed a more serious aspect, drifting occasionally into pathos even when he danced with her. But for neither of them was dance an expression of struggle or toil. Their art lacked a tragic dimension, just as it lacked kinetic technical innovation, yet all the same it was complex. The Sacharoffs created alluring dances by recombining their rather narrow range of balletic
222 PAIR DANCING movements and poses in relation to a gorgeous array of costumes, letting
their glamorous outfits make old movements new. Alexander and Clotilde often designed their own costumes, sometimes
they collaborated with major figures of the Parisian haute couture: Georges Barbier, Paul Poiret, Hubert de Givenchy, Jeanne Lanvin, René Goetz, Nathalia Goncharova, Marie-Louise Bruyere. All their costumes dis-
played spectacular colors, luxurious refinement, and a glorification of remote historical fashions (Figure 53). For Petit Berger (1917) Clotilde wore a stunning green chiffon minidress decorated with red, yellow, and blue cloth roses, but in Poeme Printanier (191'7) she danced in a fuller dress printed with an ecstatic multitude of brilliant flowers. In Danse (1921) she
wore an elegant medieval-Byzantine dress in blue and gold. Even when she donned folk dresses, the designs were so lavishly stylized that folk culture appeared as a charming abstraction rather than as a stable sign of “authenticity.” She also liked flaming red costumes, elegantly trimmed with
silver or accompanied by black capes and accessories. Sometimes she danced in swirling chiffon trousers, and she never lost her taste for appearing in an eighteenth-century, “half-boyish, half-girlish union of pants and coat,” for she looked extremely pretty and radiantly feminine in male garments (HB 142). Alexander’s taste in costume was just as flamboyant: from the time of Visione del Quattrocentro (1913), introduced during his work with Sacchetto, he strongly favored sacerdotal, medieval-Renaissance robes and vestments of imperial splendor. He often appeared, especially in pair dances,
wearing luxurious pajama-type pants of an exotic nature or VenetianPierrot costumes with all sorts of precious details. He loved painting and powdering his face, with Pavane Royale (1913) being perhaps his most elab-
orate masquerade of masculinity, for here he parodied the already fantastic mannerisms of an aristocrat in the court of Louis XIV. Golliwog’s Cakewalk (1916) was virtually a transvestite performance, even though he wore gaudy puff-trousers, but he really did not cultivate female impersonation. Rather, he sought to show the beauty of “effeminate” masculinity, freed from the conventional markers of modern male identity, the male body completely detached from muscularity and heroic posturing yet nevertheless pleased with itself and not at all constrained in its power to lead the woman.
When he teamed up with Clotilde, Alexander ceased to adopt the ancient Greek look, but Clotilde began to explore it, most notably in Danseuse de Delphes (1916), in which she achieved a far more elegant, refined, and yet modern (proto—art deco) look than Isadora Duncan ever did. The Sacharoffs delighted in bizarre hats, shoes, and wigs, with some of their wigs consisting of “hair” sculpted out of gold or silver metal and further ornamented with extravagant garlands of silk flowers and wax fruit.
PAIR DANCING 223
For their pair dance Chanson des Otes (1923), they wore identical furry white duck masks and trim “duck suits”; only Clotilde’s little “feather” skirt
established a difference between male and female. For Chanson Negre (1921), which used a black gospel song as accompaniment, she actually wore, for once, a modern-style dress, with spats, black gloves, a scarf, and a
sort of Litthe Orphan Annie wig, but she attached to her waist a skirt of huge ostrich plumes. One cannot say that she impersonated a black person or even a black way of dancing—rather, she demonstrated how black music disclosed yet another mask of her white femininity (Vuillermoz 33). Indeed, the great message of the Sacharoffs was that sexual identity, pairing, and marriage itself were all masquerades, the consequences of perfect artificiality rather than “nature.” The happiness of a couple depended on - elaborate masks and a common balletic rhetoric of movement to disguise powerful differences between them. Brandenburg found this implication so haunting and unsettling that he spent an unusually large number of pages trying to explain it away, for perhaps he grasped intuitively a further implication: that the “happy couple” consisted of two people who were happy together, not two people who were happiest only when they shared the same desire. In the artificial world of the Sacharoffs, no one was happy who was
not intensely narcissistic. Perhaps this point was never clearer than in Clotilde’s solo interpretation of Debussy’s Le prelude a l’apres midi d’un Faun
(1936). Nijinsky’s 1912 interpretation of Debussy’s music had provoked much controversy in Paris because of his friezelike presentation of a bacchantic female choir and his own muscular but delicate impersonation of the faun, who, unable to consummate his desire for any of the women, concluded the piece by masturbating in his bower-lair (Nectoux). Clotilde’s version was just as daring, especially if one reads it as a commentary on Nijinsky’s piece. She wore not an animal-like costume but rather a flimsy white chiton printed with red and black splotches, which gave the effect of violent
bloodstains on her torso. Around her shoulders she looped a long purple scarf, and around her head she set a garland of wax grapes. She performed her dance largely by sitting on the floor in a soft spotlight, undulating, writhing, arching, discarding the scarf, and spreading her legs so that the hem of the dress slid down her thighs to display the splendor of her flesh (Veroli 148-149). She passed through her wonderful repertoire of smiles and langorous glances. The dance was a masturbatory glorification of her beauty, of her love for herself, the dominant source of an ecstasy that depended on no one but herself; for as close as she was to the spectator, her pleasure always seemed remote, a secret she alone appreciated. Of course, it is extremely rare to witness a forty-four-year-old woman dancing with such voluptuous pleasure in herself, basking in her own beauty with a brazenness that seems to awaken an outraged urge to violate her—an urge she herself has already anticipated.
224 PAIR DANCING YVONNE GEORGI AND HARALD KREUTZBERG
Yvonne Georgi (1903-1975) and Harald Kreutzberg (1902-1968) enjoyed enormous and unprecedented international appeal as a pair from 1928 to 1930, then suddenly went in separate directions because their ambitions were so incompatible. No pair was so interesting to such a large audience, and their appeal lay precisely in their sophisticated synthesis of quite incompatible sensibilities. Georgi was born in Leipzig, where her father was a prominent physician married to a French-Algerian woman. Yvonne Georgi projected an exotic, Arabic image: sleek, black-haired, smoldering. At school during the war, she
endured embarrassments because of her French mother; when (1920), as
a result of playing in a pantomime at the home of conductor Arthur Nikisch, she announced her intention to become a dancer instead of a librarian, she faced major skepticism and disappointment from her parents. Perhaps because of a need to overcome serious doubts about the nature of her desires, Georgi was throughout her life intensely competitive and ambitious. She put on her first program of dances in 1920, then went to Hellerau to study the method of Jaques-Dalcroze, which she soon found too gymnastic and lacking in dance expressivity. Having seen Wigman perform in
Leipzig, she enrolled at Wigman’s school in Dresden, where she easily became a star pupil and a member of Wigman’s famous first group, which included Wigman, Palucca, Holm, and Trumpy. But Georgi wanted more. She started producing her own solo programs, which consisted of dances with music, dances with percussion accompaniment only, and dances in silence, as well as cyclical works built around the music of Scriabin, Haas, Milhaud, and Krenek. By 1923 she had learned all she could from Wigman and had embarked on her own path. She accepted Kurt Jooss’s invitation to dance in his production of the Tels-Wellesz Persisches Ballett (1924) in Munster, and her success prompted the Gera Municipal Opera to appoint her ballet mistress. But she was there only a year (1925) before the Hannover Municipal Opera offered her the position of ballet mistress. Her popularity in Hannover was great, enduring, and, remarkably, achieved through her desire to create distinctly Ausdruckstanz ballets using advanced modern music (Figure 54). She lured Mila Cirul and Kreutzberg away from their soloist positions with the Berlin State Opera to dance in her 1926 production of Stravinsky’s Petrouchka (1911), and at the end of the year, after establishing her own school, she and Kreutzberg put on a concert together containing fourteen pieces. Only two of these were pair dances; nevertheless, he decided not to return to Berlin (Koegler 22~33).
Kreutzberg came from a quite different milieu. His grandfather and father were in the circus and wild animal entertainment business, and his mother strongly encouraged his precocious gift for play-acting and theatri-
PAIR DANCING 225 cal gestures. He was born in Bohemia, but the family tended to wander: Breslau, Leipzig, Dresden. In 1920, while attending art school in Dresden (Kreutzberg was also a gifted draftsman), he performed a “hashish dance” at a student carnival party. The popularity of this piece was such that he decided to enroll in an amateur course at Wigman’s school. His talent impressed Wigman, but she made little use of it, so in 1923 he accepted the invitation of another Wigman student, Max Terpis, to dance in Hannover, where Terpis directed the ballet of the Municipal Opera. Working in a large
ensemble made Kreutzberg somewhat nervous, but the opera director, Hanns Niedecken-Gebhard, recognized Kreutzberg’s gift for acting and cast him in the small character roles that often make dances memorable. Meanwhile, Kreutzberg formed a partnership with Frida Holst to produce pair dance recitals. Then Terpis accepted appointment as ballet director of the Berlin State Opera and took Kreutzberg with him. In Wellesz’s controversial ballet Die Nachtlichen (1926), Kreutzberg appeared as Fear, a sinister, dissonant evocation of demonic forces circulating through the city between twilight and dawn. Despite the unpopularity of Wellesz’s morbid music, Terpis went in for more gloom with Don Morte (1926), a version of Edgar Allen Poe's The Masque of the Red Death, employing music by the Austrian compos-
er Friedrich Wilckens (1899—?). In this piece, Kreutzberg danced the role of an eccentric jester, wearing a gold costume and a mask with a bald head. The opera costume shop had difficulty devising a bald wig for him, so he
shaved off all of his blond hair. His appearance made such a powerful impression on audiences that he maintained his trademark bald head for the rest of his life. Don Morte also initiated the lifelong collaboration between Kreutzberg and Wilckens, who not only wrote numerous pieces for Kreutzberg but also was his accompanist.
With Elisabeth Grube, another dancer at the opera, Kreutzberg and Wilckens produced several dance recitals in Berlin. Kreutzberg’s partnership with Grube collapsed when Georgi invited him to Hannover, but the new collaboration stalled almost immediately when, in 1927, Max Reinhardt cast Kreutzberg in Salzburg productions of Turandot and Jedermann, then as Puck for a New York production of A Midsummer Night’s Dream (Fig-
ure 55). Even in his most serious performances, Kreutzberg cultivated the image of a jester, a medieval fool, a demonic acrobat. When he returned to Hannover in 1928 as a dance instructor, he collaborated with Georgi and Wilckens on a grotesque pantomime, Robes, Pierre and Co., which presented a man falling murderously in love with a show window mannequin and
featured dances accompanied by the sound of typewriters, gunshots, and Kreutzberg himself singing a falsetto parody of a coloratura aria (Pirchan 7-31). Like the Sacharoffs, Georgi and Kreutzberg performed only a few dances together, but their appeal as a pair rested largely on their skill at manipu-
226 PAIR DANCING
lating the architecture of the concert program so that their solo dances appeared not as autonomous, self-contained pieces but as movements with-
in a larger-scale image of pairing. Unlike the Sacharoffs, Georgi and Kreutzberg eschewed an aura of luxury and concentrated on perfecting an
austere, streamlined modernism. Both of them were muscular, athletic dancers who delighted in displaying physical prowess and dexterity, yet they each drifted into melancholy moods, with Georgi especially prone to
orgiastic-ecstatic impulses and Kreutzberg never losing touch with the grotesque, the demonic, and the macabre. Kreutzberg occasionally incorporated feminine movements and details into his dances, most obviously in his Turandot dance (1927), in which his bald head yielded to the signifying power of a dark Oriental gown and large tassel-earrings, and in Der ewige Kreis (1936), in which he wore the medieval masks and costumes of a pros-
titute and an idle rich woman. Unlike either Sacharoff or Seewitz, Kreutzberg tended to parody feminine movements for grotesque effect, though rarely in his pair dances with Georgi, where they tended to mirror or echo each other’s movements. Georgi, however, entertained hardly any doubt about the difference between masculine and feminine; indeed, she almost never wore any sort of trousers, and she avoided any movements or costume effects that destabilized the spectator’s perception of her constant, dark, athletic femaleness. She was, therefore, quite unlike Clotilde von Derp, who loved disclosing ever-new aspects of her femaleness. But as a
result, in pair dances, Kreutzberg’s movements, mirroring Georgi’s, appeared more feminine than if she had mirrored his. Fahnentanz (1928) was a quintessential mirror dance: they wore vaguely centurionlike cap-helmets, tunic-skirts, and large capes, which they waved as flags in great, rapid, swirling movements. They created the impression of ecstatic warriors controlled by a powerful, undulating current that made them echo rather than fight each other. Hymnis (1929), with music by Lully, was a much more somber, ceremonial piece: “[T]hrough it Mr. Kreutzberg and Miss Georgi were marvellous counterparts, weaving the dance in two strands, now meeting in unified motion, now parting in motion contrasted;
two in one in mated style and suggestion” (Parker 212). Pavane (1930, music: Ravel) repeated this effect with even greater gravity, with Georgi and
Kreutzberg wearing glowing white costumes as they moved slowly and mournfully through the dark space. Another slow piece, Persiches Lied (1928, music: Satie), done in glamorous Oriental costumes, showed the dancers meeting in the space, coiling about each other, striving always to
produce matching movements that allowed them to sink to the floor embracing, covered in a veil (Braaksma). All their other pair dances were variations on those described here: they sought to make the couple the source of mirror-echo effects—“complementary patterns” and “reciprocities of motion” (Parker 204). They never presented man and woman in con-
PAIR DANCING — 227
flict with each other, never created tension through competing configura-
tions of bodily rhythm, and this avoidance (or fear) of conflict greatly diminished the dramatic power of their pair dances. In their 1931 Berlin performance to Gustav Holst’s huge symphonic poem The Planets (1916), one of the largest pair concerts ever staged, they employed a monumental
abstract set consisting of a row of dark, cavelike entrances from which emerged spiraling ramps and towering, slanting walls; these gave the impression that no matter how remotely separated in space the man and woman were, the couple always retained its power to define itself through complementary movement. But in reality Georgi and Kreutzberg did not complement each other, and in their solo dances the differences between them introduced a dramatic power that their pair dances lacked. Georgi constantly hungered for rapturous excitement. In Walzer (1929, music: Wilckens) she swirled and eddied her sleek body with breathtakingly voluptuous lyricism. In Salome (1929)—which, curiously, used music by Cyril Scott rather than the more familiar pieces on this theme by Schmitt or Strauss—she was almost naked
_ and moved with an unapologetic, maybe even vulgar determination to appear sexy. With Cassandra (1929), shrouded in a great net-veil, she displayed the ominous, tragic ecstasy she could feel in prophesizing, in dreaming of vast doom. Darker and stranger still was Tanz des Boses (1923), in which, accompanied only by crashing gongs, she exulted, convulsively, in the glamor of demonic possession, of unashamed evil and sadism. In Arabische Suite (19277), however, she signified an ecstasy derived from exquisite,
shimmering, rippling refinements of a delicately fluttering body, while in Dammerung (1929, music: Debussy) she conveyed a melancholy “restlessness subdued to quiet ecstasy” (204). Kreutzberg, for his part, nurtured the image of the jester or sardonic stranger. In Narrentanz (1927) he produced a muscular, hyperexpressionist dance in which he held rather than wore a mask and dramatized a passionate spirit of revolt against the masked identity seeking to impose itself on him. In Drei irre Gestalten (1928), accompanied only by hallucinatory noises, he adopted an even more Caligariesque expressionism in his clinical impersonations of an idiot, a homicidal mani-
ac, and a paranoiac, solitary inmates of an asylum. Most spectacularly expressionist of all was Der Engel der Jungste Gericht (1928, music: Wilckens),
in which he wore an enormous, swirling black cape that concealed his entire body except for his bald head and made him a “figure of darksome splendors, blessing and warning, aloof and drawing nigh” (205). At the end of the dance, he sank to the floor as if he were a demonic body descending
into a great, rippling circle of darkness, a pool of undulant blackness. In Engel der Verkundigung (1928, music: Wilckens), he was a good angel, in biblical costume, quietly, slowly, and luminously signifying the immanence of divine message. Der Konigstanz (1928, music: Reger) was altogether more
228 PAIR DANCING muscular and martial, full of “turbulent, imperious motion” yet somewhat grotesque, with Kreutzberg wearing a weird, pharaoanic wire headpiece and a gold scarf attached to bracelets on both arms, so that the vehemence of his movements seemed curiously restrained, rather than provoked, by the vaguely feminine decorative accessories. With Caprice (1929, music:
Smetana) he introduced his archetypal incarnation of the carefree, strolling, skipping, lolling, wandering, improvising jester who, in various “vagabond” guises, exerted such endearing appeal for German audiences of the 1930s and 1940s (Parker 200-213; Wille). Clearly, pair dances alone scarcely explained the enormous international popularity of the Georgi-Kreutzberg team. Between 1929 and 1931 they
made four comprehensive tours of both Europe and the United States, where they appeared up and down both coasts and throughout the Midwest as probably the most profitable modern dance act in U.S. history (Pirchan 32-40). No American dancers, including the team of Ted Shawn and Ruth St. Denis, enjoyed such popularity. Yet, unlike the Sacharoffs, Georgi and Kreutzberg did not embody the “happy couple.” Their pair dances tended toward the elegiac and ceremonial; they seemed to express a virtuosic, synchronized cheerfulness rather than a stirring or triumphant happiness. In Potpourri (1929), for example, they wore polka-dot costumes and goofed around on stage with the pianist, Wilckens, interrupting his efforts to get a dance started with music by hovering over him and inserting their own discordant chords: “[O]ff they flung in staccato steps with that perfect mating
of heads and arms, as in a two-fold pattern made one in line and rhythm. ... Like children, they snatched up sticks, called them bows and arrows, sported with them,” until the exasperated pianist crept away with
the music and compelled the dancers to follow him off stage (Parker 206-207). But though this sort of humor proved quite delightful, it both concealed and revealed the major limitation of their pair dance aesthetic: their reluctance to build dramatic tension between each other in relation to a source of conflict—the music, the musician, or the man. Yet it was precisely because they pursued such divergent ambitions that they could not long remain a dance couple, and in 1931 they made their last tour. Georgi always wanted more powerful and commanding opportunities to assert her authority as an artist. In 1928 she accepted appointment as ballet mistress at Braunschweig as well as at Hannover. Then, when the national economic crisis of 1930-1931 severely reduced subsidies to the opera houses, Georgi accepted an invitation from the Wagner Society to choreograph in Amsterdam. In 1932 she married a prominent Dutch journalist and found even grander opportunities for her talent, although she continued to work for Hannover until 1936. Already in 1926 Georgi had published an article in the Berliner Illustrierte Zeitung in which she contend-
ed that “the modern solo and group dance must conquer the theatre in
PAIR DANCING — 229
order to enlarge its field of activity and expand its borders.” She complained about the lack of production values and the excessive modesty of concert recital dance culture, which, she believed, had enfeebled public enthusiasm for modern dance. She blamed dancers themselves for their lack of ambition in appropriating the state theatre apparatus, for “it is not true that the expressivity, the intensity of dance in the theatre, be it in a ballet or within an opera, becomes lost” (Koegler, Yvonne Georgi, 31-32). The article was in part a veiled criticism of her teacher, Wigman, who favored cultic performance at the expense of large-scale productions and never displayed any enthusiasm for a reconciliation of Ausdruckstanz with ballet. Georgi always distrusted schools, including her own, to recognize and exploit talent to the fullest, for teachers invariably accommodate the limitations of most students rather than the potential of a few. Besides, she want-
ed to put modern dance culture on a more secure economic foundation than that offered by the fragile school companies, in which, indeed, students paid to dance instead of receiving pay. An elevation in the economic
status of the dancer demanded the production of large-scale ensemble pieces sponsored by generously subsidized institutions that could attract top talent in a range of fields—dance, music, design, choreography, administration. Moreover, she wanted dance to attract strong male talent, but how was that possible if dance did not situate itself within the institutionalized emblems of power through which society expected men to fulfill their obligations to it? One might even say that Georgi aspired to become the Wagner of the German dance world, so grandiose was her sense of dance as an institutional power on the European cultural scene. She continued to give solo concerts in Germany and even in New York (1935), but her heart was
in the big theatrical productions she produced in Hannover and Amsterdam. Yet progress toward her aim remained slow. She staged over twenty ballets in Hannover and Amsterdam before putting together a company to tour the United States in 1937. But the tour was a disaster that bankrupted her, and in 1938 she accepted an offer to choreograph ballets for a Dutch circus and to direct a huge spectacle celebrating the fortieth anniversary of Queen Wilhelmina’s reign. Her success in these endeavors enabled her to form the Ballet Yvonne Georgi in 1939. By this time, however, disciples of fascism in Dutch culture, led by the artist Hein von Essen and the critic Weremeus Buning, sought to dominate Dutch dance through control of a group called Nederlands Dansliga. For many years, an oversupply of dancers had afflicted Dutch dance with dilettantism. Georgi’s productions considerably raised the standards of Dutch
dance performance, but voices within the Dansliga contended that she “monopolized” the dance world by her intensely competitive desire to attract the best talent and highest production values, by her “un-Dutch” devotion to Greek mythological themes, and by her subordination of mod-
230 PAIR DANCING ern dance expressivity to the aims of classical ballet. When the Germans invaded in May 1940, the situation became more ambiguous, for Georgi’s husband, Lodewijk Arntzenius, an official of the Concertgebouw concert hall, was sympathetic to Nazism, and the Germans firmly approved of Georgis aesthetic. With unprecedentedly generous subsidies, the Ballet Yvonne
Georgi produced works of a scale and virtuosity never before achieved in Dutch dance history: Orfeus and Euridice (1941), Josefs Legende (1942), Carmina Burana (1944). But when the war ended, Georgi and her husband faced serious stigmatization that compelled them to leave Holland in 1949. With great success she resumed her choreographic duties in Hannover (1953-1970), but a visit of this company to Amsterdam in 1967 awakened bitter criticism of her Nazi collaboration (Koegler, Yvonne Georgi; ESG 49-65). Well before the war, her choreography had begun to make ever greater concessions to ballet technique and conventions, and her enthusiasm for Greek mythological themes seems to have subdued her inclination toward unbridled ecstasy. In spite of her taste for modern orchestral music, her ballets never advanced the expressive power of dance beyond what it was in 1930, and certainly none of her ballets of the 1930s and 1940s displayed the innovative imagination of her early group pieces in Hannover, such as Saudades do Brasil (1925), Petrouchka (1926), Baby in der Bar (1928), Tanzsuite (1928), Das seltsame Haus (1928), and Robes, Pierre and Co. (1928).
After the war she achieved even greater acclaim for her ballet choreog-
raphy in Dusseldorf, Hannover, and Vienna and for television, but this
acclaim seemed directed more at her success in mobilizing postwar resources on behalf of dance than at her ballets themselves. It is surprising . how meagerly German dance historians have treated her work, especially in the postwar period, even though she significantly raised the standards of German ballet, at least in terms of production values and technical compe-
tence. Her turn toward ballet implied a sacrifice of her dark ecstatic impulse; she used modernism and dance to reconcile historical tensions within herself rather than within a society struggling with its past. She displaced the aesthetic of reconciliation from her pair dances with Kreutzberg onto her large-scale ensemble productions, resulting, despite a strong narrative element, in a lack of dramatic power and transformative effect on modern dance art. But the Berlin critic Fritz Bohme had observed as early as 1923 that Georgi had “not yet reached” a “compelling” sense of compo-
sition or made the “conquering step” toward artistic triumph (Koegler, Yvonne Georgi, 24). The problem was that Georgi was afraid of her own ambi-
tion and appetite, afraid of taking that one wild step further that might destroy her in its refusal to reconcile itself with any other step. The intense ambiguity of Georgi’s identity left an equally ambivalent legacy, for despite appearances to the contrary it was never her desire to abandon Ausdruckstanz for ballet. She more than anyone showed the power of Ausdruckstanz to
PAIR DANCING 231
take over ballet and imbue it with an expressionist attitude toward the body.!
As for Kreutzberg, he followed a different path altogether. Though he occasionally choreographed theatre productions in Leipzig and Berlin and even appeared with Georgi in a couple of her Greek ballets for Hannover in 1934-1935, Kreutzberg’s art flourished most distinctively in his solo concerts. He was always looking for a partner—Elisabeth Grube, Tilly Losch, Yvonne Georgi, Ruth Page, Ilse Meutdner—but his most enduring partnership was with Wilckens, his composer, accompanist, and business manager. With the American dancer Ruth Page (1898-1991), Kreutzberg pursued a pairs aesthetic closely resembling that of his partnership with Georgi. The two teamed up for a tour of the United States in 1933 and were so success-
ful they repeated it the following year and continued on to Japan and China. During the 1920s, Page had exhibited an exuberant modernist spirit that had somehow evolved out of the decorative ballet style imported to America by Adolph Bolm (1884-1951), her teacher, whom she regarded as an “excessive influence” on her expressivity (Page, Class Notes, 15). Her Prelude in Blue (1926), Ballet Scaffolding (1925), and Flapper and the Quarterback
(1926) were perhaps the most expressionistic-constructivist dances produced in the United States before 1930, and her astonishing Bolero (1930, music: Ravel), with its mounting tension achieved through accumulating movements of stationary bodies, was perhaps the most exciting achievement of the Ravinia Opera Company of Chicago (where Page hoped, in vain as it turned out, to create a base for modern dance culture competitive with that of New York). Like Georgi, Page longed to do big theatrical dances, but she displayed limited imagination in the construction of pair dances, with her most notable success in this vein being the violent and quite lurid Frankie and Johnny (1938, music: Moss), a WPA project. Here, at last, pair dancing (within an ensemble) was synonymous not with complementary or synchronous movements but with explosive drama.
She regarded Pavlova and Kreutzberg as the “greatest influences” on her career, but Kreutzberg’s aesthetic apparently absorbed little of her romantic spirit (Page, Video Archives, tape 13). He retained his usual 1. Max Dooijes (b. 1919) was a student of Georgi during the war years and later a prominent dance teacher in The Netherlands. When I interviewed him in Amsterdam in February 1992, he spoke of his teacher with great warmth and affection. He described the Wigman-like instruction Georgi gave, her determination to release the unique expressive potential of the student. As he spoke, it became evident that what was most significant about her was her elegant ambiguity, her ability to refine every movement, to make every movement dramatic and alluring enough for ballet without being formed completely out of ballet positions. Georgi had a unique gift for awakening in men a desire to dance expressively in a competitive and demanding way far exceeding that of the lay movement choirs in which so many female expressionist dancers encountered male movement students (Dooijes).
232 PAIR DANCING repertoire of solos and refashioned his dances with Georgi to fit Page. For
: example, in Bauerlicher Tanz (1928, music: Wilckens) the couple danced back to back in matching polka-dot costumes with their arms entwined. But in Bacchanale (1933, music: Malipiero) he took the same idea and darkened it in a way he never had with Georgi: the couple danced back to back with arms entwined, but Page wore a black dress and Kreutzberg a black shirt and pants, and both wore black elastic bands around their arms and white elastic bands crossing their faces and around their heads (Turbyfill). These bands, first introduced for Kreutzberg’s solo Kénigstanz (1927), created the impression of bodies both bound and bandaged, reinforcing the theme of bacchanalian ecstasy as an intense closeness to another body yet a frenzied (wounding?) struggle to face that body. Page began
experimenting with elastic bands for her expressionistic solos, and Kreutzberg began devising solos, such as the primeval Der erste Mensch (1934, music: Bach), in which he twisted rope around his arms in a more muscled style than elastic bands suggested. After 1935 Kreutzberg moved decisively toward the perfection of his medieval, vagabond jester image, Eulenspiegel. Georgi inspired his interest in Greek themes, which inspired Orfeus klagt um Euridike (1935), a revision of his jester’s revolt dance. This time he danced, in chiton and wig, holding
the mask of Euridice, although later presentations of the dance featured a mask with more emphatically feminine features than earlier ones. In Orestes (1935), with gold rope wig, he struggled again with ropes around his arms. The pathetic Orfeus dance remained in his repertoire for years, but his fame rested on his more grotesque works, such as the medieval Der ewige Kreis (1936), in which, with fantastic masks, he presented a death-dance suite of Boschlike impersonations of archetypal Gothic figures. Even in Der Tod (1937) he impersonated Death as a lurching, pouncing, acrobatic jester wandering aimlessly across a twilight space like one of the “mad creatures” in his asylum piece. In 1935 he toured the United States yet again, this time with four women, including Ilse Meudtner. Here he introduced his “scenes from Breughel” and his Ndachtliche Habanera (music: Debussy), in
which the four women appeared as ancient skeletons dressed in elaborate black sixteenth-century Spanish costumes with mantillas and fans (Meutdner 30-43). Kreutzberg’s appeal in the United States was perhaps only a little less than what it was in Germany, which says much for the power of his aesthetic to cross borders. Harald Kreutzberg was probably the most popular dance figure in Germany during the 1930s and 1940s, and his success with solo concerts during these years enabled him to live quite comfortably in a Tirolean chalet and to give him the sense that he had accomplished all that he was capable of doing. However, his aesthetic implied more than he intended. In 1943 Kreutzberg appeared with Werner Krauss in Pabst’s handsome film Paracel-
PAIR DANCING — 233
sus, set in the late Middle Ages. Not surprisingly, he played an acrobatic jester, who winds up assisting the great physician in his escape from the volk-
estranged authorities. The jester performs a grotesque dance in a tavern, almost a parody of expressionistic dance, creating a hypnotic effect on the male and female tavern patrons and driving them to a lunatic frenzy. When Paracelsus arrives on the scene, he recognizes the dance as a symptom of the plague and prescribes a cure based on his mysterious understanding of
the “healthy community” rather than on the impotent academic rationalism of the university doctors. The film presents Ausdruckstanz as a sign of dis-
ease and communal pathology, but it is doubtful that Kreutzberg was even conscious of this implication. He just wandered into the film and then wandered on, always living entirely in the self-contained world of his solitary jester-self. The army drafted him in 1944, but the Americans soon captured him on the Italian front; when they eventually released him, he returned to Germany and resumed his international career in the solo mode until 1959, performing mostly the same pieces he had created in the 1920s and 1930s. He also appeared in an excellent film version of Der ewige Kreis (1956) (“Harald Kreutzberg”). He was unquestionably the most significant male dancer to emerge from Ausdruckstanz, yet his impact on modern dance was far less than that of Vaslav Nijinsky (1888-1950), who in just a few years (1910-1917) had revolutionized the dance world by imposing upon it an overpowering intelligence. Nijinsky was a genius (and a madman) precisely because his mind was too complex to allow dance to construct a quintessential self for the dancer. He pushed bodies toward almost impossibly intricate and contradictory rhythms; he treated dance as the systematic dissolu-
tion of the self, the fragmentation of the body into multiple identities, bisexual ambiguities, violently conflicting impulses—as when, in The Rite of Spring (1913), the ballet corps had to shift instantly from, say, 5/16 rhythm
to 7/8 to 2/4, and the right arms and legs had to move with a different rhythm from the left. Neither Laban nor Dalcroze, on the theoretical plain, could approach Nijinsky in complexity of imagination, in the application of an often impenetrable system of expressivity. By contrast, Kreutzberg seems to have retreated into his jester-self as a way of evading the heroic, almost superhuman expectations associated with an artist such as Niinsky. The solitary jester figure was comfortably accessible to himself and to his audience;
it was, in the iconography of male dance, a touching foil to the remote, unfathomable, and uncontainable god that was Nijinsky.
Group Dancing
Group dancing evolved more slowly than solo or pair dancing, primarily because of the economic complexities involved in setting up performance companies. In Germany, dance performance received subsidies only when affiliated with an opera or school, and even school companies did not begin to receive subsidies until 1925. The problem with school companies was that they depended almost entirely on students, on immature creative talent, which lowered production values in performance. What schools saved in dancer salaries was hardly enough to finance more lavish sets, costumes, lighting, or music. Conversely, professional companies had to pay huge
salaries to dancers, which brought the further burden of providing high production values to attract audiences large enough to pay the salaries. The
more familiar audiences became with dance art, the more impatient they became with dancers who did not invest adequately in the material quality of their productions, a reality successful solo and pair dancers understood very well.
Professional dance companies could not survive without touring, as no home-city audience for dance was large enough to sustain a professional company in its own theatre; indeed, only school companies owned their own
theatres. But touring added heavily to the payroll because it tied up performers over long periods of time; thus, one could not form a professional company without having the resources to outbid other professional compa-
nies for the services of talented performers and designers. Moreover, impressive group dances depended on the controlling intelligence of a leader who had strong choreographic and managerial skills and could motivate members of a company to transcend petty differences between them on behalf of a collective aesthetic ambition. Laban grasped the importance of cultivating a “mysterious personality” for himself and his 234
GROUP DANCING — 235
students, but his leadership skills were much better suited to forming an elaborate institutional apparatus, a network of devoted schools, than in creating significant group dances themselves. His student, Wigman, showed far greater imagination in turning cultic performance into an act of choreography, a dramatic event for an audience, probably because of her obsession with thematizing ambiguous relations between group and leader. Even so, her school groups of 1921 to 1929 were always small and always built around her need to show her own skills as soloist within group dances or in a cycle of solo and group sections. As long as modern dance valued individual over group expression, it remained slow to develop a distinctive group aesthetic outside the bankrupt ballet tradition, which in the opera houses constructed ensemble pieces out of mechanical formulas and conventions authorized in St. Petersburg, Copenhagen, Paris, and Vienna. RITA SACCHETTO
In Berlin, Rita Sacchetto (1880-1959) became one of the first in Germany
to form, out of students in her school, an independent dance company, though hers lasted only a couple of years (1916-1918). Born in Munich, she was the daughter of a respected Venetian painter and an Austrian woman. Two of her brothers became painters, and Sacchetto established her own artistic identity through the creation of what she called “dance pic-_ tures” (Tanzbilder); in these she used famous paintings to model dances, so that it seemed as if music and movement made the paintings come to life. She took ballet lessons and gave her solo debut concert in Munich in 1905,
performing sarabandes, gavottes, minuettes, tarantellas, and Oriental dances in which costumes and poses resembled to a remarkable degree well-known paintings by, among others, Gainsborough, Reynolds, Botticelli,
Greuze, and Moritz von Schwind. Her success led to an invitation to perform her odalisque dance in a production of Bizet’s opera Djamilah in Vienna, where such artists as Gustav Klimt, Kolo Moser, and Joseph Hoff-
mann expressed delight in her art. Sacchetto then began a long (1907-1909) period of touring throughout Germany, Eastern Europe, Amsterdam, Paris, Madrid, South America, and New York. Loie Fuller arranged for her to perform intermezzo dances at the Metropolitan Opera, and in 1910 she gave at the Met an entire dance concert featuring her Botticelli dances, Siamese dance, and a large-scale pantomime called The Intellectual Awakening of Woman, which used Grieg’s Peer Gynt suites and a group
of thirty female dancers (Rieger). Later that year she embarked on a tour of Russia, which led to a collaboration with fashion designer Paul Poiret at his private theatre in Paris, where she impersonated a famous painting of the Empress Eugenie wearing her original dress (Ochaim). By 1912 she was
236 GROUP DANCING back in Munich as Alexander Sacharoff ’s partner in a pair dance team (HB 147). But the collaboration was brief, for in 1913 Sacchetto initiated her career as a movie star by appearing in Odette. A 1914 concert in Copenhagen was apparently a “fiasco,” but it brought her to the attention of the Nordisk film company, which never had enough female stars for the sensational erotic melodramas that made Danish films
competitive on the European market. The Danes had introduced dance into silent film melodramas such as Afgrunden (1910), Vampyrdanserinden (1911), Det blaa Blod (1912), and Atlantis (1913), and Danish film companies had even tried to make film stars out of ballet dancers such as Elna Jor-
gen Jensen. Not without controversy, Nordisk hired Sacchetto to star in films for the astonishing salary of 7,000 kroner per picture, but she made many quite successful films, including Tempeldanserindens Elskov (1914), Madame Destinn (1914), Den skonne Evelyn (1915), Rovederkoppen (1915), and Fyrstinde Bianca a Costa (1916) (Brusendorff 140-145; Hendig 49-55; Bordwell 203). Sacchetto exuded a dusky, melancholy beauty that seemed even more refined and aristocratic, a “breeze of perfume,” when displayed in opulent historical costumes. Although she excluded modern paintings of
women from her graceful productions, she was probably the first to use silent film as a model for composing dances. Brandenburg spoke somewhat disparagingly of her “kinodrama,” La Sonambula (1912), performed with
Sacharoff, and in a review of a Budapest concert the Hungarian cultural journal Nyugat (9/1, 16 March 1916, 375-376) complained that Sacchetto, excellent film actress though she was, relied too heavily on lavish costumes and theatrical devices designed to accommodate the tastes of movie audiences; consequently, her dances had “nothing to say” and represented a degradation of a Greek aristocratic ideal in which dance was central to the perfection of a highly educated intelligence.
By this time Sacchetto, now residing in a luxurious villa in BerlinGrunewald, had opened her “ballet school,” which actually had less to do with ballet than with pantomime training. Her most important students included Anita Berber and Valeska Gert. Gert caused a minor scandal ata 1916 concert in the Bluthner auditorium when Sacchetto allowed her to perform her Tanz in Orange (a lewd parody of ballet steps) and, with Sidi Riha, the homosexual duet Golliwog’s Cakewalk, which the police regarded as indecent (LF 11-13). Sacchetto, however, remained faithful to the pictorial gracefulness that Gert subverted. The dance company toured several German cities. In 1917 Sacchetto married the Polish Count Zamoysky and resumed her work in the movies with Die Nixenkonigen before returning to Munich to open another school. She was soon touring with a small company consisting of herself and two students, Wally Konchinsky (Valerie Conti [1903-1945]) and Isa Belle. Reviews of her concerts in Berlin, Breslau, and Dusseldorf unanimously reached the
GROUP DANCING 237 conclusion that her dance aesthetic was “kitsch,” “unintentionally humorous,” full of “empty pretentious poses,” very dated, technically crude, and entirely dependent on her personal beauty (KTP 4, 1920, 117-119). Nevertheless, she always seemed to find an audience; in 1921 alone, she gave 120 performances in Paris. In 1922 her company included the husband of Wally Konchinsky, Jan Pawlikowsky, and the repertoire tended to consist of ornamentally bizarre pair dances performed by different combinations of the three. For example, in the “dream of a young woman,” Konchinsky, in white tights with a white veil, danced with Sacchetto, in a black veil and black pants, a curious echo of the black-versus-white theme of the Gert-Riha Golliwog's Cakewalk. Sacchetto also created a Cocaine dance at the same time (1922) that Berber produced her own, nude Kokazin.
Through Count Zamoysky, Sacchetto and Konchinsky became acquainted with the intellectual circle around the radical modernist writerartist Stanislaus Witkiewicz in Zakopane, Poland (Siedlecka 122-126). In 1924 one of the count’s friends accidentally shot Sacchetto in the foot, and only this misfortune prevented her from continuing to dance in public, even though she was already forty-four years old; her beauty apparently compensated for all her technical defects and long-faded tastes (LF 15). Still, she continued teaching in Munich, staging pantomime pair dances for
Dagmar Helsing and Helge Peters-Pawlinin and opening a school in Krakow in 1928 (Rieger). In 1930 Sacchetto and the Count left Poland to live in her father’s homeland, Italy, in the town of Nervi, near Genoa. She remained there until her death, although in the 1930s she worked occasionally in Italian film production. It was easy to sneer at Sacchetto; critics obviously did after she entered the movies, and Berber and Gert made a
point of desecrating her gaudy, pictorial historicism. But few dancers enjoyed such popular international acclaim, and the reason for her success
lay in her attempts to historicize her beauty; like an old painting, the danced movement of the body suspended time itself and, indeed, turned the present into a luxurious cinematic image of the past. TWO OTHER EARLY DANCE GROUPS
At the end of World War I, Magda Bauer formed the Munchener Tanz-Drel. Besides Bauer, the group included Erika Skogen and Ellinor Tordis, with the occasional participation of Lucie Heyer and costumes by Hanns Haas. This group’s concerts consisted mostly of solos by each member, and the only pieces in which all three appeared were round dances in an exuberant style. The repertoire featured primarily old dance forms (waltzes, rondos, contra dances) in a free and giddy mood, although Bauer devised a piece
that told a “Chinese story” in a droll fashion. Apparently, however, her strongest piece was Gebet und Tempeltanz, which was actually the creation of
238 GROUP DANCING
Edith von Schrenck, who was hardly a cheerful or happy dancer. In this piece, to music by Grieg, Bauer included seventeen of her students in a complex set of movement patterns on all sides of the dance space, signifying an archaic temple; movement with, toward, around, and against other dances produced a “flowing polyphony,” a “great prayer machinery,” indicating a “monolithic, compulsively moving ecstasy”; “bodies made music— it was a racial dance that one had hardly expected of this cool-looking German Blondine” (HB 135; KTP 4, 1920, 122). Bauer soon faded from the dance scene, but Heyer remained active as a teacher in Munich, where her
methods coincided with Nacktkultur. Her interest in ensemble dancing drifted toward lay movement choirs, and at the 1930 Munich Dance Congress, which is the last I hear from her, she presented excerpts from a large, socialistic work called Die Elemente, scripted by Edith Grothe. Another early dance group of Munich, the Munchener Tanzgruppe, actually began in Hamburg; its name had something to do with attracting dance
talent from Munich to Hamburg. Supposedly formed by two men, Paul Theodor Et*bauer (18g92-?) and Andreas Scheller, it lasted only a few years,
from 1920 to 1924, but because of its unusual structure a large number of dancers participated in its innovative activities. The most significant personality was neither Scheller nor Et*bauer but Jutta von Collande, who participated with the group from beginning to end. Most of the dancers came from the school managed by the Falke sisters, but some obtained their education from Laban or unknown sources ( Jockel 32-51). Dancers who worked sporadically with the Munchener Tanzgruppe included Elsbeth Baack, Marna Glaan, Grete Jung (1900-?), Frida Holst (1900-1979), Gertrud Zimmermann, Elsa Kahl (1g02-?), Laura Oesterreich, Tilli Daul, Manya Haack, Brigitte Artner, Hildegard Troplowitz, and Sigurd Leeder (1902-1981). But some performances of the Munchener Tanzgruppe involved Claire Bauroff, Frances Metz, Marie Mullerbrunn, Ella Knales von Vinda, Beatrice Mariagraete, Roswitha Bossenroth, Gertrud Falke, Anita Nessen, and Edith von Schrenck, and in 1921, Jutta von Collande and Gertrud Zimmermann collaborated on a program with Sebastian Droste, who soon became the partner and husband of Anita Berber. Hans W. Fischer and Hans Brandenburg acted as advisers to the group, and H. H. Stuckenschmidt composed the music, in a decidedly modern vein. With Munchener Tanzgruppe, the notion of “group” was somewhat complex. It referred to a loose association of dancers who appeared in different combinations on programs of different dimensions at different times. This apparently was Scheller’s intention, in spite of the managerial difficulties of achieving this ambition (HB 228). Programs often consisted of solos, duets, and trios, and the Munchener Tanzgruppe even sponsored solo concerts by some of its members, such as Hildegard Troplowitz, who had given solo concerts in Hamburg since at least 1918. Yet the group clearly thrived under the
GROUP DANCING 239 controlling leadership of Collande. Scheller and Et*bauer, who was active as an expressionist artist, designer, art commentator, and dance instructor, created the Munchener Tanzgruppe to produce large-scale ensemble pieces. In January 1921 they presented their first two group works, along with “mascu-
line” (“in the best sense”) solos by Ella Knales von Vinda and “Oriental sketches” by Et*bauer. Laura Oesterreich directed the Galante Pantomime (music: Winternitz), an exquisite rococo entertainment in which Collande performed the role of a cavalier to Gertrud Falke’s baronness; Anita Nessen played the maid, Grete Jung appeared as Polchinelle, and Elsbeth Baack portrayed the baron. A contemporary reviewer felt that in successive performances of this piece, in different theatres, the performers moved toward a
refinement that was excessive and unnecessary (Ehlers). Scheller’s only choreographic effort, Faschingsschwank in Wien (music: Schumann), was a much larger work involving “fifteen or sixteen” dancers who created “whirlpools and streams” of a “collective will” against the “solo personality” of Jutta von Collande: “[S]he seeks the mass, becomes drawn and repulsed by it, and eventually seizes the leadership of it, so that all power finally comes together in a large, happy festival procession” (Hans Fischer, Hamburger, 255). Scheller planned to produce Hans Fischer’s “dance play” Die traurige Prinzess, with the Falke sisters, Collande, and music by Stuckenschmidt, but the insane inflation destroyed all the financing for the project, and it was
not until 1922 that another group dance reached performance. By that time, Scheller had departed from the group, and Collande was in control. Der himmlische Kreisel (1922) was part of an “astral dance show” conceived by
Fischer in collaboration with Collande and Stuckenschmidt and involving girl dancers from the Loheland school as well as an orchestra. By Fischer’s own account, the work was a fascinating piece of imaginative ensemble thinking, far in advance of modern dance group productions anywhere else at the time, and it still seems radical today. The thirty-five-minute work used
no consistent musical accompaniment but employed gong tones and a montage of passages from Adam, Grétry, and Sttickenschmidt. On wobbly legs, a “giant golden sphere” (Et*bauer) tottered and hopped about wildly to the snapping of a clapper while the pianist played tenderly. Suddenly
four little girls zoomed in as a scatter of shooting stars, followed by a comet——Manya Haack, dressed in black with a long gold headband trailing
behind her. She, too, danced wildly, to music by Adolph Adam, but in an “entirely mature” manner. Then a “violet moon creature” in a bearded mask appeared and made “grasshopper” leaps before Jutta von Collande performed, with “clockwork precision,” a dance of the planets with two girls. Lavinia Schulz and Walter Holdt depicted the “immensity of Sirius” as a wildly rotating shimmy, with a nebula of Loheland girls forming an undulating orbit. Finally came the pantomime of the “abduction and liberation of the sun,” which appropriated ideas from the Japanese Noh theatre. Two
240 GROUP DANCING “winter demons” snatched the frail, trembling orbit of the sun (Collande); then a sorcerer (Andre Luksch) summoned the demons, who wore doubleconed or horned masks, and engaged them in a bizarre dance in which they
used their voices to strengthen the rhythm of their movements. A gate opened with the blare of a trumpet fanfare, and the sun emerged to dispel the sorcerer and his demons. With Gretry’s music, the sun summoned all the other dancers into a great, final dance of bodies flowing in space (Hans Fischer, Hamburger, 263-266). This piece depicted collective movement as a cosmic principle, but it was a rare example of collectivity wherein differ-
ent musics, different choreographic styles, and different theoretical perspectives interacted to produce a single work. The Munchener Tanzgruppe never again attempted a work of this scale,
although Scheller apparently had this sort of aesthetic in mind when he formed the group. Financial problems plagued the company, in spite of the consistent success of its concerts in Hamburg. Under Collande the group seldom, if ever, produced any dances requiring more than four dancers, as was the case even before Scheller left (KTP 8, 1920, 221-222). Collande’s idea of “group dance” implied different combinations of dances featuring
herself in relation to different combinations of dancers, so that any one dance—-solo, duet, trio, or quartet—had a distinct context in an ever-shifting
program accommodating the ambitions of “other” performers. She disclosed a peculiar fondness for the music of the French opera composer Andre Gretry (1741-1813), but Brandenburg observed that only she knew how to dance to it (229). Perhaps for this reason, as much as for economic ones, she was hesitant to work on a larger scale. But within the modest realm of duets, trios, and quartets, she was quite inventive. For example, in Pnmavera (1920), which she danced with Claire Bauroff and Maria Mullerbrunn, the dancers moved to the music of three separate harps until, finally, one figure dominated the other two (HB 230). Of another trio, set to the music of Leoncavallo, a reviewer (KTP 8, 1920, 221) remarked delightedly that Collande, Troplowitz, and Zimmermann transformed themselves, in
response to sharp rhythmic differentiations, from gray, yellow, and red peacock-feathered puppets into beautiful human beings embodying inspiration (Collande), feeling (Troplowitz), and temperament (Zimmermann). No one seems to know what happened to Jutta von Collande after 1924. It is a haunting enigma. She seems to have obtained power over many people, yet group works provoked anxiety in her, and in her small ensemble pieces she was able to thematize the problem of constructing a group that did not devalue the individuality of its members. In her dances she sug-
gested that an emancipated idea of the group nevertheless depended on the controlling power of an individual within the group rather than on the synchronizing power of music. But in a larger sense, she treated the Munchener Tanzgruppe as a constellation of bodies orbiting around her, but
GROUP DANCING ~— 241
not in the same trajectory, to form a single, unified sphere of energy: the larger group was a magnate that attracted people because of its opportuntties for performance individuality, but Collande was at the center because she knew how to build a sense of communal identity entirely out of combinations of twos and threes. Gretry’s music was important because it com-
pelled dancers to trust Collande rather than the music and to place the body rather than the music at the center of this constellation of disparate desires. Her sudden disappearance hardly indicates the failure of her strategy; on the contrary, it implies the failure of economic systems to conceive of power and groups in anything but aggregate terms. VERA SKORONEL
Perhaps no dancer of the Weimar era was as aggressive in the pursuit of an emphatically modernist group aesthetic as Vera Skoronel (1906-1932), yet she displayed a strongly ambivalent attitude toward the abstraction conventionally associated with modernism. She was astonishingly precocious. Her father was the scientist Rudolf Lammel, whose Der moderne Tanz (1928) contains the most detailed account of her aesthetic. Born in Zurich, she studied
with Laban at age thirteen and then, in Zurich, with Laban’s student, Suzanne Perrottet; in 1921 she enrolled at the Loheland school but the following year shifted to Dresden to study under Wigman. At age eighteen she accepted an offer to direct the dance activities in Oberhausen, where she formed her first group. When in 1925 financial difficulties forced Oberhausen to suspend its dance program, Skoronel joined forces with another Wigman student from Switzerland, Berthe Trumpy (1895-1983), in man-
aging an opulent school in Berlin. A Gothic-medieval aura permeated Trimpy’s dances; in her Christmas piece of 1926, a choir of female dancers in silver gowns performed with silver swords and lighted candles, and in Verkindigung (1927) Trumpy was a girlish, “sweet,” and melancholy Ma-
donna to Skoronel’s rather cubistic-abstract and Oriental angel (RLM 172-173). Triimpy was an excellent teacher and administrator who grasped the necessity of bestowing bourgeois seriousness and respectability on dance studies, an ambition that, she felt, required the establishment of a rigorously developed state dance academy presided over by a “scholarly nondancer” (Freund 27). She needed someone to give her school a strong artistic identity, and that task fell to Skoronel, a dramatic-theoretical thinker
whose movement imagination revealed a physicist’s delight in formal abstraction. In the solo Kriegrrhythmus (1924), she introduced the “throwing, cutting, independent” arm movements for which she became famous. But this “stringent” warrior dance, with its Balinese and Singhalese influences, also conveyed a “tender” and “animal-like innocence,” a strange
242 GROUP DANCING “purity” of “unconscious culture” that had “nothing to do with militarism”
(146-147). Quadrat (1924) began with a solo by Skoronel, performing angular, broken movements as if in the grip of a fanatical demon. She sank to the floor, and the space became silent and dark; the lights returned to reveal a “stiff wall of human bodies,” their dark arms upraised. The human wall drew closer and closer to Skoronel’s inert form with “heavy waltz steps,” until the entire group slowly sank around the lifeless body. Both the concept
and choreography of the dance seemed astonishingly simple, yet it dramatized well a mysterious tension between the convulsed, “possessed” solo
dancer and the “stiff” group, with the group submissive not to the wild dancer or to a strange music but to a powerfully inert body. For the more abstract and ambitious Tanzspiel (1926), Skoronel devised a detailed written scenario to articulate the elaborate complexities of the piece and had the Trumpy school orchestra perform music specially composed to enhance particular effects of the scenario. Here the group had no visible leader, although Skoronel herself danced in it. Indeed, the group contained
no characters, only “figures” such as the Id, the Mirror Being, the Two Lengths, and the Dancing Stage Wings, but these referred more to the abstract tunic costumes worn by the dancers than to the representation of dif-
ferentiated motives for action. The piece, in three parts, dramatized the dynamic geometry of abstract movement categories. Lines and rows of bodies metamorphosed into whirlpools, spirals, triangles, diagonals, quartets, double duets, diagonals within circles, canons, and fugal patterns. Yet movement within a single configuration contained its own categories of dynamics: the elasticity of the line operated in relation to notions such as “crescendo,”
“mirroring,” “syncopation,” and “extension.” Musical rhythms shifted abruptly, and different sections of the group moved to different rhythms; for example, one pair of dancers might move only its head and shoulders while a second pair moved its arms and a third moved its legs; one section might make hacking movements with the arms while another created undulations. Skoronel furthermore imposed emotional categories on the movement, so that arms moved “softly” or “mockingly,” “violently” or “sweetly,” “grotesquely” or with “melancholy.” She concerned herself with the smallest bodily details: how the eyes should dance, when to smile, the vibration of the fingers, the melody of breathing (150-156) (Figures 56-57). A dance for her was a matter of constructing a unique relation between these abstract categories of movement. She first enunciated this approach at age fifteen in a novel (never published), “Asja und Skule” (1919), about two female friends seeking ecstatic power through an intensely intellectual
love of dance (161-162). Dance implied the mathematization of space, movement, and body, and group dance was the most powerful expression of this mathematization because it offered the greatest possibilities for combining categories of movement or signification. Skoronel associated
GROUP DANCING ~— 243
ecstatic freedom with “absolute” formal abstraction, and, in an unpublished manuscript from 1932, she explicitly linked abstraction with mechanization. By “mechanization” she did not mean imitation of or reference to machines; rather, she proposed the treatment of the body as an “instrument, which no longer displays human features” but moves according to an absolutely “pure harmony” that has “no content” and “nothing more to express” (MS 40). In an earlier article, she observed that with the “absolute dance,” “form and content do not exist,” and “superhuman ecstasy does not lie in the human psychic zones of joy and sorrow, but actually in the
cosmic experience of the infinite—in abstraction” (Freund 73). In the Kinetographie, Laban sought to identify all possible abstract categories of human movement, but he was unable to apply these categories systematically in the creation of dances: he had a dictionary but could not form any sentences or syntax. Skoronel showed far greater power in thinking out dance abstractly, yet she relied on conventional writing (scenarios and theoretical essays) and stick-figure drawings to formulate her dances; she did not move toward any system of computation tables or logarithms to optimize the mechanization of movement. In other words, Skoronel betrayed a measure of ambivalence toward her own abstractionism. This ambivalence surfaced overtly in Legende des Wetssen
Waldes (1927), a “dance fairy tale in four scenes,” with “figures” such as a Sorceress, the Child of the White Forest, the Creatures of the White Forest, twelve Black-and-White Knights, four Water Sprites, and the Demon. The various dances making up the piece contained the complex combinations of movement categories already apparent in Janzspiel, but this tme movements constructed a semipantomimic narrative about the awakening of the solitary Child of the White Forest, the failure of the Knights and Prophets
to protect the Child from the Demon, the rescue of the Child by the Sorceress, and, in a final test of “innocence,” the Child’s attempt to dance without sinking on the surface of a black lake. Silence accompanied several of the dances, but even more innovative was the imaginative use of lighting
in the choreography. For example, spotlights showed only the arms of dancers (branches of “trees”) undulating in a world of darkness; indeed, during some moments no dancers at all appeared on the stage, and one only saw the movement, the intensification or fading, of light. At one point, dancers moved in darkness; the lights came up suddenly and glaringly, then went out, conveying the impression that no one could see the whole dance,
not even the dancers, who, like the Child, are blind to the world, even to themselves. The relation between the Child and the Prophets and Red Flow-
ers was somewhat similar to that of the inert body and the synchronized wall of bodies in Quadrant, whereas the relation between the Demon and the Knights followed the model of a wild, turbulent, polyrhythmic group dominated by an explosively moving leader, who pressured the group to
244 GROUP DANCING
explore and feed off all tensions within it without ever dissolving into individuals. But the appearance of the Sorceress, “accompanied by four
Guards,” complicated group-leader relations, for she performed an “angular-pantomimic” dance that inspired neither the fanatical rhythm of
the Demon-group dances nor the trancelike tread of the Child-group dances. The pantomimic leader produced a slow, heavy rhythm, a steady, tri-
umphant motion that soon dominated the movement of all groups and marked the Child’s dance on water. Few dances, including Wigman’s, theorized leader-group relations with such sophistication and with such ambivalence over the ultimate authority of inert, abstract, or pantomimic bodies to lead, to mold bodies into groups. Yet Skoronel herself claimed that the “aim of the group dance (insofar as it has an aim) is the complete equality of given tensions: mass, group, soloist,
leader. The harmonic, melded unity of all poles, even the strongest contrasts, is the basis of the new group dance” (RLM 169). As director of the speech and movement choirs of the Berlin Volksbuhne, Skoronel applied these theoretical concepts on a larger scale in Erweckung der Masse (1927) and Der gespaltene Mensch (19277), in which, apparently, groups of women in
dark tunics and bare legs moved in tension with a group of bare-chested men in black trousers. Here she pursued the gendered dynamics by which one group leads another or consolidates competing groups. One might say that, through abstractionism, Skoronel sought to transcend the erotic themes or dynamics of erotic desire that exclusively female ensembles hesitated to explore, at least in an overt, romantic fashion. Nev-
ertheless, eroticism pervaded her aesthetic. In Tanzspiel, some female dancers wore boyish haircuts and vaguely masculine (long-sleeved) tunics. Skoronel was herself a small, lithe, muscular woman who liked to be photographed performing aggressive, thrusting, surging movements that, when incarnated by such a pretty body, exerted strong erotic appeal for male spectators. Abstraction was not for her the end of eroticism; rather, she eroticized abstraction, attempting to make the desireability of the female body manifest in angular, hacking, squatting, or pumping movements. But the attempt succeeded only partially. Fritz Bohme, dance critic for the Deutsche Allgemeine Zeitung, observed that Skoronel’s formalism resembled ballet technique, with emphasis on arm rather than leg movements, and strove toward an “ideal of objectivity” based on mechanization of movement. But
the result was a “pedantic” pleasure in exactness of execution not far removed from that displayed in the revue dances of the Tiller Girls (28 October 1926). In a review of Erweckung der Masse (27 March 1927), he complained that although the movement choirs performed expertly, the piece as a whole seemed guided by a force external to the “masses” themselves: “The movements are externally directed, not centered inwardly. The piece certainly contains symmetry, asymmetry, and polarities, but these lack
GROUP DANCING 245 an inner, living, spatial necessity. Everything appears calculated, predeter-
mined.... The ‘awakening of the masses’ does not unfold; it is given, imposed, ordained” by formal design.
Later the same year (5 October 1927), BOohme offered some deeper insight into the limitations of Skoronel’s abstractionism. He remarked that she seldom sank into herself; instead, through her exaggerated, rushing movements, she projected a powerful will to test and exceed the “limits of bodily possibilities.” But no matter how great her will, “she cannot overcome these limits,” and “she will never reach the power of Wigman’s gestural language,” for “her dances continually show gestures of cutting, striking, shaking, annihilating, destroying.” Without serious “content,” such a dance aes-
thetic produced a “sort of agitation gone demonic.” In Paris, André Levinson, a reactionary supporter of ballet, commented (1929) more favorably on the “turbulent agitation” of a “nearly tragic” aesthetic that did not strike him as German at all—perhaps Slavic. Skoronel “attacked” dances with “relentless exasperation,” moved with “vehemence,” turned “in a rage upon herself,” “projected with force a steeled arm and fist,” “stamped with anger” to embody “a young Fury prostrated by her paroxysm” (500). But in Berlin critical approval remained restrained. A reviewer for the Steglitzer Anzeiger (2317, 9 October 1930) said of a solo concert by Skoronel that she knew “only two degrees of movement—the excited, convulsed leap and the ecstatic rotation,” and as a result all of her pieces were too long. In a 1929 article for Schrifttanz, Trumpy responded to criticisms of exces-
sive abstraction in modern dance by arguing that Germans were a more intellectual than physical people and that therefore a distinctly German dance culture depended on intellectualism and abstraction. Russian-style ballet technique had emerged from a unique cultural context, she wrote, but in Germany ballet was a completely dead art, and efforts to promote a “healthy sensuality” in German dance based on pantomimic principles were misguided (VP 11-12). However, Trumpy’s article actually somewhat confused the issue of dance’s cultural identity, for Skoronel’s mother was Russian, so her inclination toward abstraction and ballet-type formalism per-
haps owed as much to Slavic heritage as to Germanic intellectualism (assuming the validity of Trumpy’s own cultural distinctions). Skoronel died suddenly and mysteriously (of leukemia’), and when the Nazis took power Trumpy found it expedient to merge her school with the Gunther school in Munich, where Maja Lex pursued a formalistic notion of the group that was far less “turbulent” and “vehemently” intellectual than Skoronel’s. HANS WEIDT
A much more conventional and overtly politicized perception of group dancing appeared in the work of Hans Weidt (1904-1988), who was an
246 GROUP DANCING agent of the Communist Party. Born into a Hamburg working-class family, his father an alcoholic social democrat, Weidt was twelve when a folk-dance
group stirred his interest in dancing. However, he had no money to study dancing, and when, as a teenager, he started working as a gardener, he found it difficult to arrange hours for dance lessons. In 1921 he studied briefly under Sigurd Leeder and then under Olga Brandt-Knack (18851978), both Laban students and ardent social democrats. But the povertystricken Weidt struggled to save money and find time for his passion, and in 1923 his participation in communist-led agitations completely radicalized his political beliefs in favor of a revolutionary transformation of society. In his solo debut concert in Hamburg in 1925, he presented dances depict-
ing “the worker,” “the lady beggar,” “the new beginning,” “on the dock,” “rebellion,” “the sick boy,” “faces in the street,” all subjects seldom intro-
duced by bourgeois dancers. Further peculiarities of the concert were Weidt’s use of Chopin compositions to accompany these unromantic themes and the use of a trumpet to perform the music (Weidt had made friends with an orchestral trumpet player who provided accompaniment for no fee).
Despite the ambivalent critical response to this concert, he decided to pursue a career as a dancer. He gathered about him a group of unemployed youths “from all classes,” mostly male, who practiced in a factory studio and
performed at communist-sponsored events. Yet financial difficulties constantly subverted his ambitions. Then Brandt-Knack, ballet mistress of the Hamburg State Opera, gave him the lead role in a ballet, Der Gaukler und der Klingelsprel (1928), enabling him to become conscious of his own capacity to sustain large-scale dance forms. Theatre director Erwin Piscator attended a performance of the Worker’s Dance Group and was so impressed that he
invited Weidt to work on theatrical productions in Berlin. There Weidt became acquainted with leading artists of the left: Friedrich Wolf, Erich Miuhsam, Stefan Wolpe, Ludwig Renn, Ernst Busch, Helene Weigel. To support himself he gave dance lessons and taught physical education at Nacktkultur camps and communist youth societies, but his living circumstances
remained hard. In 1930 he danced the role of the Dark Leader in Margarethe Wallmann’s huge dance drama Orfeus Dionysos. Though in Hamburg he had performed some duets with Lotte Lobstein, he definitely preferred the company and collaboration of men, and he viewed his female students as narcissistic dilettantes (Weidt 15). He presented himself as a hopelessly unromantic working-class ugly duckling, incapable of inspiring desire in bourgeois women, but he was actually quite good-looking, enjoyed nudism, and delighted in opportunities to display his muscular physique in dances. He choreographed movement choirs in Piscator’s production of Friedrich Wolf ’s Tai Yang erwacht (1929), and through Wolf, Weidt became indoctrinated into communist ideology, joining the party in 1931.
GROUP DANCING 247 His party connections enabled him to form Die Roten Tanzer, a company that soon comprised forty-five dancers and produced the most overtly propagandistic dance in Weimar Germany, notably in Passion eines Menschen (1931, in collaboration with Ludwig Renn), Tanz des Arbetislosen (1930), Arbeiterkampflieder (1931), Potsdam (1932), Das Gas wird von Arbeiter gemacht
(1932), and Tanz der Gefangenen (1933). However, the audience for these efforts consisted largely of the already converted, and only the red press viewed them with much favor, although Fritz Bohme, soon to become a Nazi sympathizer, expressed enthusiasm for Weidt’s aesthetic. The production of Potsdam, which clearly satirized right-wing political figures such as Hitler, Hugenberg, and von Papen, got Weidt arrested in January 1933. Theatre director Karl-Heinz Martin, for whom Weidt had originally conceived Tanz der alten Leute (1931) as part of a failed production of Alfred Doblin’s play Die Ehe, arranged for Weidt’s release, whereupon the Communist Party arranged for him and his group to participate in the Moscow Olympiade in May 1933. The Russians welcomed him effusively, but they regarded his dance aesthetic as insufficiently “militant”: “Our attempt to shape themes of the worker movement with the expressive possibilities of the new artistic dance... was at that time still hard to understand, all the more in a country in which the classical ballet played so great a role” (Reinisch 48-49). Weidt returned to Hamburg, but the police were waiting at the dock to arrest him, so he stayed on the ship and made his way to Paris, where he had friends, party connections, and opportunities through the House of Culture. He renamed himself Jean Weidt, starred in short dance films of Dukas’ The Sorcerer’s Apprentice (1933) and Ravel’s Bolero (1934), and formed a new
dance group, Ballet Weidt, which performed mostly at party-sponsored ral-
lies. The French bourgeois press reacted more appreciatively to his aesthetic than had Weimar critics, but the French police considered him a foreign subversive and took steps to have him deported. In 1935 he therefore accepted another invitation from the exiled Piscator to work again in Moscow, where he seriously began to study ballet technique at the Bolshoi. Although ballet technique offered exciting possibilities for Ausdruckstanz, the ballet productions themselves seemed tediously “conventional” and lacking in modernist revolutionary spirit. Thus, in January 1936, Weidt
journeyed to Prague to work with the avant-garde theatre director E. F. Burian and the Liberated Theatre of Voskovec and Werich. Life continued
to be hard for him, and he had to construct a pseudonymous identity to avoid deportation by the vigilantly anticommunist police. Eventually, however, he succeeded in strengthening his connections to the party in Paris,
where he returned in 1937. There he cultivated many influential friends: Jean Cocteau, Louis Aragon, Arthur Honegger, Pablo Picasso, Charles Dullin, Jean-Louis Barrault. A newly formed Ballet Weidt, following an itinerary shaped by the party, performed in Paris, Marseilles, Cannes, and
248 GROUP DANCING Corsica, often in support of fund-raising efforts to defeat the fascist forces in the Spanish Civil War. Weidt also pursued a romance with a communist French woman, who gave birth to a son in 1939, but his German identity, so
he claimed, estranged her from him, and when the Germans invaded France he never saw them again. He sought to escape persecution by fleeing to North Africa, but by 1942 Casablanca was under Vichy control, and Weidt’s life became even harder.
He spent terrible months in an Algerian concentration camp until a new commandant permitted him to dance for soldiers at the Algiers Opera House. When the British captured Algiers, he danced for them, too—mostly his solo worker dances from the Weimar days. He then joined the British army and participated, as a member of a construction brigade, in the Allied invasion of Italy. Upon his discharge in 1946 he returned to Paris, where he
founded yet another group, Ballet des Arts, comprising six men and six women. In 19477 the company produced Die Zelle, winner of the gold medal
at the international ballet competition in Copenhagen. But in spite of successful tours of Holland and Belgium, the group suffered from continually inadequate financing. Weidt could not resist an offer of generous subsidies from the communist government in East Berlin, to which he made his final
migration in 1948. There Weidt became a highly respected teacher and choreographer of ideologically correct ballets for opera companies, but his work during the many ensuing years of stability lacked both the innovation and the utterly distinct political expressivity of his fugitive years before the war (Weidt; Reinisch) Weidt’s perception of group dancing was virtually antithetical to that of Skoronel: political content entirely dominated his thinking about bodily movement, and matters of form and technique always remained subordinate to the projection of a correct spirit, which acknowledged that “dance is struggle” on behalf of an oppressed class of people (Reinisch 185-191). In his memoirs and polemical statements, he scarcely reflected on dance at all; instead, he discussed his hard struggle to live as a dancer with a communist perspective. His autobiography devoted more pages to his few dis-
mal months in the concentration camp than to any phase of his artistic career. Dance was for him a way to achieve a higher class identity, which, however, he assumed was impossible for him to achieve independently of the Communist Party. From his debut concert on, he thought of his work as
ballet, because ballet resonated with a grandeur and dignity of identity denied the working class. But his aesthetic before 1939 actually had little to do with ballet in any rigorous sense, and even in relation to Ausdruckstanz he was hardly an auspicious innovator in the realm of movement dynamics. He claimed to free dance from the prettified mythic images of bourgeois female dancers, yet his own dances borrowed heavily from the stereotyped poster imagery of downtrodden social types and heroically victorious work-
GROUP DANCING 249
ers. He asserted that his dances included movements he had learned as a gardener, but in reality none of his dances presented any insightful relation between laboring and aesthetic movements, despite the enormous and quite unexplored potential for expressivity in constructing such a relation. Slow, ponderous movements and huddled bunching of female bodies signified the oppressed masses; gaping mouths and outstretched arms signified suffering. Drooping, cowering, cringing, plodding movements characterized further aspects of oppression. The heroic side of the struggle, represented mostly by bare-chested males, entailed militant flexing of muscles, strident stepping, uplifted faces, vigorous swinging of arms, confrontational stances, and lunging rushes. For Weidt, a group implied a synchronized, uniform identity for several bodies, and although he sometimes contrasted different groups he showed
little awareness of contradictions within a group; nor did he disclose a sophisticated perception of leader-group dynamics: the destiny of a group
derived not from any force within it nor from the force of a mesmeric, lonely individual nor even from any distinct music but always from a conventional, archetypal image of “hunger” or “the worker” or, perhaps, “the red flag.” One of Weidt’s most interesting works, Passion eines Menschen (1931), with spoken narrative by Ludwig Renn, music by Stefan Wolpe, and masks by Erich Goldstaub, derived its imagery from a “novel” in woodcuts by the Flemish expressionist-socialist artist Frans Masereel. This piece followed a simple iconographic narrative: workers in a factory suddenly find themselves laid off, and, when they protest, the police persecute them. One of the workers, Klaus, kills a police spy who attacks Klaus’s mother in a bar
where she sells flowers. In jail Klaus meets his true “comrades” while “women lament over their men.” The court regards Klaus as a political murderer, and the workers’ efforts to save him from execution are in vain; however, his death provokes a revolutionary upheaval (Reinisch 165). Narrative content sustained interest in this and most of Weidt’s other dances, and as
long as the story dominated movement choices, movement retained a crudely pantomimic identity almost completely devoid of irony. To insure that his audience “got” the story, he even inscribed it into the program: Eine Frau (1930, music: Heyken)—“once she was a mother, but the war took everything from her. Now she must work again, as if she were thirty. Her life is worry and work”; Strassentdnzer (1931, music: Erben)—“China—it could be Berlin—he always dances with consuming ecstasy. For what? For the street? For pleasure? For a pair of coins?” A more curious work was Potsdam
(1932), in which narrative development remained subordinate to an abstract aim, the construction of a group piece that had no leader, even though it showed the leaders of the Weimar Republic. Hitler, Hugenberg, Hindenburg, and von Papen, wearing caricatured masks, danced as unified group to hit tunes of 1932. They moved in an amusing, courtly-bizarre style
250 GROUP DANCING
that was “not directly ridiculous” but “incredible” and so perverse as to imply a dreadful “danger” in such a unified group of leaders. Although Weidt revived the dance in Paris, his aesthetic never again moved in this intriguing direction. He loved using masks in his group works,
yet most were eerie caricatures of archetypal expressions of oppression, elderliness, and deprivation. However, in the solo [ndian-Romanttk (1934) and the group Kamp/ftanz (1934), supposedly based on Sioux Indian tribal dances, he explored opportunities to display heroic male nudity, and he made a very handsome model for nude sculptures by Niko Eekman in 1937. In his choice of music, he showed an enthusiasm for contemporary composers, as long as they possessed correct political credentials: Arthur Berger, Stefan Wolpe, Hanns Eisler, Wolfgang Erben, Alban Berg, Josef Kosma. Yet
the music he loved best was by that most bourgeois and romantic of all composers, Chopin. If it is difficult to take him as seriously as he wished, it is because he never seriously acknowledged any struggle within himself to
form the personality he valued so highly. Personality for him always emerged from without, as a struggle to rise from the depths. Ambiguities of bodily movement and sexual identity seemed obstacles to the approval of the great party of revolutionary men who understood his constant hunger to find a better place to sleep, a better home. HERTHA FEIST
Weidt expressed much gratitude for the help given him during his years in Weimar Berlin by Hertha Feist (1896-1990), although, curiously, her own students seemed reluctant to show her any gratitude at all (Reinisch 35; Peter 37). Her bourgeois socialism produced an image of group identity far removed from Weidt’s archetypal “masses.” She was the younger sister of Fritz Bohme’s first wife. Bohme, in an unpublished 1947 manuscript, gave an enchantingly vivid description of Feist dancing nude only for him in the golden twilight of a grove in the Grunewald in the summer of 1915; she asked him to close his eyes until she said open them, and when he opened them he saw a glorious female body approaching him, improvising the most complex movements, stretching, folding, trembling, kneeling, rising up on
tiptoes, twisting, spiraling, rotating, arching, turning her breathing into music, until she suddenly disappeared into the shadows (Bohme, “Laban,” 1-5). Nudity and the “purest” expression of the healthy body constituted dominant features of Hertha Feist’s aesthetic. Yet she had many teachers whose incompatible influences led to a set of works that somehow did not live up to the summer afternoon vision of her described by Bohme. She studied first with Dalcroze at Hellerau (1914), then with Bode and a Mensendieck teacher in Munich (1915); Bohme recommended that she study with Olga Desmond in Berlin (1917), where she made her debut in
GROUP DANCING ~— 251
1919 with a baring of her breasts. Finding Desmond’s instruction unsatisfying, she went to Stuttgart to study under Laban, whom she soon followed to
Mannheim and then to Frankfurt, Libeck, Bremen, Gleschendorf, and Hamburg, appearing in grandiose productions of Laban’s Der schwingende Tempel (1921), Agamemnons Tod (1922), and Faust Il (1922) and participating in his countercultural pastoral-communal lifestyle (Schuftan 32; Peter 36). By 1923, however, she decided it was time to go her own way. She therefore returned to Berlin to establish her own school and to teach a class at Carl Diem’s sports academy. Feist was especially successful at integrating the
study of gymnastics, sport activity, nudism, and dance. No other dance
school in Germany attracted such a large number of male students, although few of hers entertained professional ambitions. She continued to collaborate with Laban on Berlin performances of his Lichtwende (1923), Prometheus (1924), Daémmernde Rhythmen (1925), and Don Juan (1926), in
which she danced the role of Donna Elvira; of course, her pedagogy emphatically promoted the doctrines of Laban. She involved herself in curious projects, such as the dances for a production of Klaus Mann’s play Anya and Esther (1926), with music by Klaus Pringsheim and costumes by Lotte Pritzel, and some sort of dance in connection with the showing of an American sound film, Hands (1929), containing music by Marc Blitzstein. However, her most provocative work was the bizarre group dance Die Berufung (1928), performed by her Novembergruppe with strong support from the social democratic cultural apparatus. With this piece she toured Germany,
Poland, Switzerland, and England. In 1930-1931 she danced in the controversial Laban-Jooss Tannhduser-Bacchanal at Bayreuth (Cameron). But with the beginning of the Nazi era, her work as a choreographer came to an end. Her last ensemble piece was an ambitious production of Gluck’s Jphigenie in Aulis on the steps of the Pergamon Museum in May 1933. Soon
thereafter the Nazis appropriated her school building and compelled her to move to smaller quarters. She always had many students, but all her choreography, even after the war ended, consisted of reconstructions of Renaissance dance forms. In 1943 she moved to Celle, then Hannover, where she taught (1952-1965) at the Volkshochschule. Eventually she became an adept of the Rosicrucian Order, for which she created her last dance, in 1965, to consecrate the Golden Temple of the Rose Cross in Bad Munder (Peter, “Hertha Feist,” 37). Like Jutta von Collande, Hertha Feist cultivated an elaborately complex image of the group that achieved complete expression not in any one piece but in relations between pieces or between dancers from different schools. Just as she desired to integrate dance, gymnastics, and sports, so she welcomed opportunities to merge people from different institutions into a single work. But this inclination to merge forces conflicted with her deeper urge to achieve maximum purity of expression. Indeed, she experienced
252 GROUP DANCING some difficulty in naming her desires. A 1925 program proclaimed: “WE ARE NOT A DANCE COMPANY. NOT BALLET! Our dance work is spiri-
tualized gymnastics”; however, the program also announced itself as the work of the Tanzgruppe Hertha Feist (“Hertha Feist”). She experimented with lengthy concerts containing as many as fourteen or fifteen dances, but the organization of the dances—solos, duets, trios, ensembles—conformed to a grand structure so that different pieces by different dancers seemed to be part of a single large work, with each dance a kind of commentary on the previous one. Moreover, Feist tended to impose a formal color scheme on the order of dances. Thus, a 1925 concert opened with an ensemble sword dance, in which the movement choir wore gray; the ensuing prayer dance, for solo male, was yellow, as was the seventh dance, a female solo on the theme of “the powerful.” The third dance, a female duet, was in green, the fourth dance a female solo in white, and the fifth a female solo in blue; a female trio was in red, and the piece concluded with movement choir in a spectrum of colors. Feist worked closely with Lotte Auerbach and Seraphine Kinne in producing concerts featuring the three of them, and she gave solo concerts as late as 1933, but she liked best to assert herself within a large, complex group, and she did not mind turning her own or another dancer’s solo into a trio or ensemble piece. Early in 1927 she began including an ensemble of eight men in her concerts for “battle” dances, but she apparently had difficulty devising dances in which the sexes interacted, for the male dances con-
sistently appeared separately. That was an especially odd feature of her choreography, because in the classroom or in outdoor arenas she liked to have large groups of male and female dancers exercise together and perform gendered thesis-antithesis patterns of movement. Even in these cases, however, the male and female groups rarely actually merged; males became integrated only if females greatly outnumbered them. Though she encouraged nudism for both sexes, Feist liked having the men exercise nude or nearly nude while the women wore tunics. In her dances, however, nudity
was negligible, despite the unforgettable beauty of her nude dance for Bohme in 1915 and her association with Olga Desmond. In 1926 she and her school group started participating in concerts spon-
sored by the Social Democratic Party, performing her solo “Dionysian dance,” Auerbach’s “elegy,” and ensemble pieces on the themes of summoning, struggle, and joy. Ein Frihlings Mysterium (1927) was a huge choral-
dance work, with music by Heinz Tiessen (conductor: Jascha Horenstein) and a script by Bruno Schonlank, the radical socialist author of Der gespaltende Mensch (1927), another grand hymn to class solidarity. Vera Skoronel supervised the choreography for this work, in which Feist coordinated the movements of her own students with those of children’s, youth, and drama groups of the SDP.
| GROUP DANCING 253 Her most significant piece was Die Berufung (1928), a “dance poem in
four round dances and a prelude,” with orchestral music (now lost) by Edmund Meisel, costumes by Thea Schleusner, and masks by Wolfdietrich Stein. Die Berufung was an ensemble piece about the merging of ensembles. Feist differentiated each group by color, with each female group having a female leader: violet (Auerbach), green (Kinne), black (Anna Fligg), gray (Hertha Boethke), orange (Eva Becher). The silver group, however, was male and led by Feist herself. After a prelude establishing the control of the silver group over the space, the first round presented the “dance of isolated
animal-like humanity,” in which the five color groups danced independently of each other until the appearance of the silver leader, who imposed
unity through oppression. The second round depicted the awakening of the groups to the perception that their obsession with preserving the purity of their colors had allowed the silver leader to dominate them. The third round showed the emerging strength within the color groups, their struggle against the silver leader, the appearance of the “dark forms,” and the defeat of the dark forms by the silver group. The final round opened with a “bacchanal of groups,” which led to strife between the groups, the return of the silver group, the partitioning, immobilization, and annihilation of the
groups into an amorphous mass, and the summoning (Berufung) of two kinds of controlling, balancing forms from the mass. Feist saw the piece as dramatizing the evolution from chaos to community, but critics, not without good reason, tended to find the piece filled with obscurity. Richard Biedrzynski, in the Deutsche Zeitung (7 March 1928), observed that Feist had sacrificed dance power for visual power: “movement drama is not dance drama.” Nevertheless, he contended, “the new as such is always stronger than what has already succeeded,” and Feist had “raised movement in space to a symphony in colors.” But Bohme was already convinced that Feist was not sure what identity she wanted for herself, her group, or her dances (Deutsche Zeitung, 22 November 1927). Even Die Berufung underwent several radical revisions, at least one of which identified the different groups not by color but by species: hippopotamuses, rain worms, polyps, and “greedy, lewd, coquettish creatures.” In the Volksbuhne version, the silver group did not wear masks, but most of the other groups did. The silver group wore Buck Rogers—type capes and astro-suits that made no distinction between the female leader and the male group; the color groups wore costumes of a style that prevailed in the Dark Ages
(Figure 58). John Schikowski in Vorwarts (18 November 1927) and a reviewer for the Tagliche Rundschau (1'7 November 1927) both asserted
that Feist showed greater strength in handling grotesque or burlesque moods than melancholy or demonic themes, a serious defect in Bohme’s mind. Feist’s decision to use color rather than species groups was obviously an effort to encourage a more serious attitude toward her message,
254 GROUP DANCING
which in any case was hardly a model of purity of expression (“Hertha Feist”).
Although Die Berufung fascinated audiences, Feist abandoned the highly
uncertain direction it entailed and instead concentrated on integrating with other groups guided by Laban (1930-1931), Dorothea Albu (1930), the social democrats (1932), and Jutta Klamt (1934). Iphigenie in Aulis (1933), with Max von Schillings conducting a full orchestra performing Wagner's updating of Gluck’s music, was an immense outdoor production that apparently involved movements very difficult to execute on the great marble steps of the Pergamon Museum, but knowledge about this piece remains scant. With Jutta Klamt in 1934 she created an eight-woman piece, Botschaft, with a score by the Croatian composer and theorist of “astral music” Josef Slavensky. By 1935, however, she had only one male dance on her programs, a duet fool’s dance, and the following year she had no male
dances at all, for she had no male students (though female students remained plentiful). Meanwhile, she wrestled with a theme that had preoccupied her since 1921, writing an essay on the “relation between body culture and art.” Here she differentiated gymnastics from dance, contending that dance focused on the whole body and its emotional relation to time and space whereas gymnastics focused, in a mechanical manner, on parts of the body independently of feelings. By 1936 she had conceded the futility of integrating dance and gymnastics and proposed that dance ultimately achieved purity of expression by recovering the archaic spirit of the folk dance. At Nazified concerts she performed waltzes, mazurkas, tarantellas, humoresques, contra dances, and even dance forms from the time of the Renaissance, though nothing larger than trios; however, her taste in music did not entirely coincide with this direction, for she especially favored the music of Bach and Scriabin. Nazism clearly diminished her power to attract men toward dance and toward herself, but even before the Nazis took over she seemed to have experienced a great disillusionment over her failure to create anything as mysteriously naked and pure as the dance she performed for Bohme in the woods. The source of this disillusionment lay not within a pathological social reality or malfunctioning perception of group identity but within her own body, about which it is so difficult to decide whether it was seriously beautiful or merely good. As Schikowski remarked ( Vorwarts, 18 November 1927), she projected strength, rigor, and elegance, “lightly shadowed by a frail cloud of melancholy.” JUTTA KLAMT
Like Skoronel and Wigman, Jutta Klamt (1890-1970) associated modernity of expression with an “absolute” or “abstract” perception of dance, free of all pantomimic signification; like Feist, she equated ecstatic modernism
GROUP DANCING — 255
with a redemptive sense of purity. In 1925, Karl Grabe remarked: “Her dance comes from the depths of the most painful experiences and sinks into the depths, seeking one final expression, one final release of inner energy. A tragic seriousness pulses in her dances” (Stefan 93). Grabe com-
pared her images of the human form to the great tragic heroines of Friedrich Hebbel and the paintings of Ferdinand Hodler. But despite her devotion to modernist aesthetics, hardly any other artist of modern dance was more enamored of Nazism or committed to the ideals of the Third Reich. She came to dance fairly late, and apparently the most painful expe-
rience of her life—the death of her mother, when Klamt was twenty— triggered in her an intense hunger to dance and to free the body from a ter-
rible burden. She was completely self-taught, though she taught herself slowly; she did not give her debut concert, in Berlin, until January 1919. In 1920 a reviewer for the Berliner Borsen-Courier commented that “it is always
like moonlight around her rich, silver blondness...a gravestone under bending cypress branches... Gretchen in prison... the often too pleasantly guided hands flutter palely away from the gray veil. . . . Everything elemental becomes soft, like in a dream .. . remains finally the timid smile of a sweet passivity.” The writer recommended that she move more in the startling direction of her “nearly grotesque,” black-wigged idol dance (KTP 4,
1920, 116-117). But the grotesque did not suit her; if anything, her aesthetic became more somber. She opened a school in Berlin in 1920, and it became one of the most successful in Germany over the next two decades. In 1923 she col-
laborated with the Berlin Philharmonic in a huge, dark, tragic dancedrama, Der Aufschrei, in which she sought to purge her aesthetic of all pan-
tomimic movement: “[T]he individual will of the leader does not command; the group breathes, sways, and lives as one in a closed totality. Effects are achieved only through the rhythm of forms and colors, sound and movement curves. ... Line and color are the chief bearers of expression” (Stefan 93). Tanze der Nacht (1924) was an even darker and more lugubrious ensemble piece, in which dark-costumed dancers moved like shadows on a lunar stage that might as well have been lit by candles; it was as if Klamt sought to eclipse altogether the glowing blondness that dominated every perception of her body. In 1925 she married Joachim Vischer,
who became her partner in the management of the school, and this circumstance seems to have infused her thinking with greater radiance, although she continued to pursue a stark, abstract, modernist notion of dance. Her modernism was evident in the design by Cesar Domela, a De Stil artist, of a 1928 brochure describing her school. The cover showed a black circle, on beige background, penetrated by two vertical lines, a black one from the top and a red one from the bottom; a third, black line touched the
256 GROUP DANCING circle from the right but did not penetrate it. The penetrating lines did not meet directly in the middle of the circle; rather the red line veered perpendicularly to the right to meet the unyielding black line. On each side of the circle appeared in red block letters the words “BERLIN” and “JUTTA KLAMT SCHULE” (Broos 91). The design created a bold sense of dance and dance study as a radically abstract conflict between elemental geometric forces, between line and curve, between relative powers seeking to penetrate the closed, inner, circular zone of connection. However, neither the curriculum for Klamt’s school nor her aesthetic adopted the extreme purity
of abstraction projected by Domela’s design. For Klamt, abstraction entailed freeing the body from impersonation and narrative motives for movement: the body’s expressive power became visible only when a story did not distract, interfere with perception. This attitude assumed that particular gestures, positions, or movements were inherently expressive of particular emotions or conditions, regardless of context (Freund 42-47). Ever since the death of her mother, Klamt had regarded dance as a way to free herself from an oppressive story, from the dominating account of someone else’s life. Dance was freedom because it made the body into a symbol of those innately healthy emotions that narrative logic suppresses by compelling the body to read the self in the life of another person. Such thinking bestowed a predominately therapeutic value on dance. In the early 1930s, Klamt and her husband became enthusiastic about National Socialism, and when Hitler assumed power they launched a body culture journal, Kontakt, which promoted a Nazi ideology of body consciousness by extolling the therapeutic significance of dance. In the first issue (January 1933, 33-40), Fritz Bohme repudiated ecstasy as the aim of modern dance. He claimed that an international, individualistic pursuit of ecstasy led to an excessive, constraining formalism that estranged dance from national and racial sources of identity, from a cultural bond between “blood and movement.” The new task of modern dance was to develop a uniquely “German movement language” that elevated unifying social-communal identity over the futile search for a mythic and ecstatic individuality.
Heide Woog echoed this point in the following issue (1/2 May 1933, 22-24): “The demand now resounds: away with all individuality—only then is it possible for us to grasp the urgent concept of mature life.” Later (September 1933, 48-50) a director of a women’s auxiliary of the Nazi Party in Thuringen proposed that “the dance of German woman must consciously free itself from sultry oriental mysticism, it must free itself from the libidinous ecstasy of religious hysteria ending in negro dances.” Dance, she
asserted, referred to the “rhythm of a noble life,” the image of “a pure deep soul, the protector of everything good, the high moral power of a clear spirit, a strong will to struggle, which will trample the demons of life,”
GROUP DANCING ~— 257
and the “heart of the mother,” whose “wings spread over all suffering” (C. Richter, 49). In 1936, Klamt published Vom Erlebnis zum Gestalten, which attempted to
explain the educational process or values that symbolically manifested the body’s inner sources of energy as deindividualized, Volk-defined forms of bodily expression. She employed a mystical, aphoristic, therapeutic rhetoric of restoring strength and health to the female body—“a people gains its full
strength through obedience to nature” (11)—but the breath-centered “German gymnastic” technique she promoted was a version of the contraction-and-release themes developed by Wigman and cultivated even in the United States by Martha Graham. Klamt spent most of the book describing the inner condition that motivated the dancer—it was always an image of
strength and health modeled after an idealized racial identity given by “nature” and “the people.” Her disdain for serious theory and intellectual challenge did not allow her to get beyond vacuous, inspirational platitudes,
and she wound up reinforcing the comfortable belief that dance was for people with small brains; this conclusion probably did not worry her, for “{iJntellectualism, which overwhelmed our concept of education, also began to transform the feminine racial ideal into an aberrant image” (17). But in one sense, Klamt remained faithful to the image of modernist abstraction embodied by Domela’s brochure design of 1928. She contended that two geometric forces dominated the body’s relation to space: the line and the curve. The line symbolized will, desire, striving, release, whereas the curve, the circle, symbolized bond, fulfillment, completion, finality, unity (91-94). All dance entailed struggling combinations of lines and curves. But Klamt warned that strong dances could not emerge from a purely formal, rationalized perspective; one must always stay “obedient to a higher will” signified by an idealized racial identity. The photos in the book provided images of this identity, yet a curious tension marked them. Those pictures taken outdoors showed smiling women dancing alone or in duets or trios on grassy hills before a vast expanse of sky, across which moved masses of radiant white clouds. The camera viewed the bodies from a low angle to emphasize the sky rather than the earth. But pictures taken indoors
conveyed an altogether darker mood, with women in dark garments performing in subdued light. Klamt apparently favored ensemble dances in which trios or even larger masses of bodies moved, in friezelike fashion, in columns and circles, traversing the performance space in different config-
urations of implosion and radiation, rupture and reformation, canon and countercanon. Here the camera tended to view the bodies from a point higher than eye level. The effect is of a mysterious cultic milieu in which the
most differentiating feature of a dancer is her blondness. The somewhat somber frontispiece portrait of Klamt herself with her eyes closed, as if in a
258 GROUP DANCING trance, dramatizes this mysterious blondness even more powerfully than the indoor images of dancers. Yet her dances of the 1930s disclosed more a religious than a fascist aura, as in Ex profundis (1930), Sieghaft (1933), Tanz der Andacht (1934), Religiose Tanze (1934), Tanz der Stille (1935), and Gemeinsames Ziel (1935). In the latter piece women wore dark, satiny, abstract tunics or gowns and moved as if
belonging to a strange, modern cult rather than to an undisguisedly fascist community (Figure 59). In the outdoors pictures, of course, the dancers project a generic, heroic image of health glorified by the Nazis. But these images were so generic that one had to read Klamt’s text to situate them unambiguously within Nazi ideology. Klamt does not seem to have used specifically Nazi insignia or iconography in her dances; her distaste for narrative-pantomimic dancing prevented her from placing bodily expressivity within the context of a “story” about people who represent Nazi ideals and the struggle to validate them. Curiously, then, Nazism was an extension of her modern, personal struggle to escape entrapment within a story she did not and could not make herself. During the Third Reich, Klamt and her school prospered from favors and privileges granted by the Nazi hierarchy, but even though the cultural landscape changed substantially after the war, Klamt continued to teach in Berlin, at the Free University, until 1968, when she retired to Switzerland to
form another school, which still operates. She proved that modernist abstraction and Nazi ideology could coexist, as long as both modernism and Naziism remained subordinate to her larger therapeutic ambition. But the embrace of Nazism had much less auspicious consequences for Manda van Kreibig (1901-1990), whose aesthetic drifted toward the bizarre-grotesque rather than the tragic. After beginning dance lessons with Isadora Duncan at the age of five, she studied ballet under Heinrich Krodller in Munich and movement under Bode, but her early dances were grotesque travesties of ballet technique. In 1921 Elegante Welt (10/21, 12 October, 32) reported on a solo concert in Berlin in which she appeared in fantastic clown and ballet costumes designed by Munich artist Fritz Schaefler. She performed, with “mathematical exactness,” an American Indian dance, a jazz dance, a dance in a “luxury nightclub,” a comic dance of contrasts between balletic grace
and a grotesque parody of gracefulness, and a dance concerning a “fury over a lost coin,” which used music by Beethoven. Kreibig was ballet mistress
at Darmstadt (1925-1928), Nuremberg (1928~—1929), and Braunschweig
(1929-1930) and participated in the dance experiments of the Bauhaus (1927-1929), from which emerged her most notable ensemble piece, Farbentanze (1929; music: Kuntzsch). In this work, six dancers applied ideas
about the movement of colors and geometric forms Kreibig had gained from her collaboration with Schlemmer in Dessau. The resulting suite of dances combined ballet positions with extremely abstract visual designs that
: GROUP DANCING — 259 presented the dancing body as a genderless, robotic expression of formal absolutism. In 1929 she suffered a severe stage accident that ended her career as a dancer. She joined the Nazi Party in 1931, but despite the strong influence of party officials she was unable to secure a serious position. Poverty-stricken, she retreated to San Remo, Italy, where she lived with relatives in complete obscurity and dependency until her death (DS 164-167, 174-176, 323; Mueller, “3. Deutscher Tanzerkongress,” 21). Another dancer who embraced Nazism was Heide Woog, whose abstractionism developed more in relation to sound than to visual or geometric forces. In 1923-1924 she led a dance group in Duisberg, which, according to a review in Hellweg (4/4, 23 January 1924, 71), produced images of “healthy femininity” leading to “nothing serious.” Woog went off on her own and created a two-hour dance concert consisting of a single work, Der lebende Tempel (1924, music: Toch). In this piece she danced to speech, music, and an assortment of noises (devised by Karl Gothes), producing an odd tension between pantomimic drama and counteractive, antinarrative abstraction in which “a restlessly pulsing play of forms triumphs over theory
and dogma” (Hellweg, 4/8, 20 February 1924, 143). This uncertainty about | whether to pursue narrative or abstraction apparently fed a further ambivalence toward the ecstatic objective for dance. A reviewer for Die Schallkiste (3, 11 April 1928, 10) declared that the demonic and the ecstatic were the “power source of every dance” in contemporary culture, but Woog displayed this realization only “in moments” where a “free play of the body” struggled against constraints whose deepest cause was to be found perhaps in conflicts with theorems, but perhaps also in psychic regions. The boyish } bravado which so happily fit her image of an Ephebe overturned her efforts to project the image of an innocent girl, “leading to a stiffness” that was “no
longer restraint” but “dance in chains.” Woog’s uncertainty about the relation between narrative and abstraction, between ecstasy and stability, may therefore have derived from deeper ambiguities regarding her sexual identity.
She had a school in Muhlheim, where, like Klamt, she placed great emphasis on breathing as the basis for releasing “inner” and “healthy” sources of energy (Woog). Unlike Klamt, though, Woog enjoyed inserting explicitly Nazi symbols and iconography into her dances. Deutsche Mythe (1934), performed at the Duisburg Municipal Theatre, was a monumental,
three-part “festival play” on the theme of “leadership and heroism” for speech and movement choirs, with music by Bernhard Zelter and text by Richard Euringer. The piece showed the aimless plodding of leaderless, suffering masses of humanity, “sunk in darkness,” until the appearance, in a mysterious spotlight, of “The One,” who moved with “somnambulistic certainty” and used his hypnotic aura to draw ever greater numbers of alienated, isolated individuals into a single, ecstatic, glorious community. Thus
260 GROUP DANCING
unified by the hypnotic leader, the community in the third part of the drama performed spectacular round dances, marches, acrobatic stunts, battle dances, unfurling swastika flags, and surging choral images of human masses forged into the might of SA, Hitlerjugend, Wehrmacht, and “people’s storm” units (MS 142-143). Wezhe (1936), introduced at the International Dance Competition in Berlin, presented another glorification of Nazi unity, though with less concession to narrative order. It is difficult to say that Woog favored narrative at the expense of abstraction, for even Deutsche Mythe moved from narrated, pantomimic movement to an almost complete abstraction of humanity into formal designs modeled on and around the dominating symbols of Nazism, such as the swastika, the searchlight, the Hitler salute, and the stormtrooper pose and strut. RUDOLF STEINER
A different order of therapeutic mysticism prevailed in the movement theory of Rudolf Steiner (1861-1925), whose ideas exerted little impact on the German dance scene as a whole but nevertheless sustained an enduring cult of “anthroposophy,” the appeal of which has by no means diminished since his death. Steiner coined the term “eurhythmics” to describe his approach to the perfection of bodily expressivity, although this word, derived from ancient Greek, had long been in use among Germans (Herder, Goethe) to categorize the study of aesthetic movement; Steiner’s longtime associate and eventual wife, Marie von Sivers (1867-1948), has sometimes received credit for introducing the name (Veit 46-49). Eurhythmics, however, was but a small facet of a vast, comprehensive philosophy that sought to identify the conditions of salvation in a modern world wherein old religious doc-
trines had lost their credibility. Anthroposophy was a sort of holistic, Christian-Nirvanic-Dionysian search for the forms of thought, feeling, and action that connected the body to a cosmic sense of purpose. Steiner left hardly any area of life unexamined by his thinking; his complete writings (1954-1984) spanned 350 volumes and covered science, medicine, education, art, social planning, architecture, anthropology, theatre, and literature. But despite its stress on mobilizing mystical forces within the body and the cosmos, anthroposophy always presented itself as a theory of consciousness rather than an expression of religious faith. Born in the Croation region of Austria-Hungary, Steiner began his career as an academic, specializing in the studying and editing of Goethe’s scientific writings; his doctoral dissertation (1891) constructed a philosophy of freedom. While a lecturer at Wilhelm Liebknecht’s Worker’s School in Berlin in 1901, he turned his attention to the problem of identifying a new spirituality as pursued by the Theosophical Society of that city. For the next
twelve years Steiner gave an enormous number of lectures throughout
GROUP DANCING 261 Europe in which he explained the affinities between Christian and ancient religions, the mystical significance of organic forms, and the reform of intellectual development. The lecture was his medium; probably no one ever gave as many lectures on as many subjects as he did. Like Laban, he was a prodigious teacher but a weak scholar who expended his mental energies on innumerable lectures rather than on impressive research. He always conveyed a sense of analytical authority by introducing categories, concepts, and definitions, but he did not apply them with any systematic rigor—he preferred to move on to a new topic rather than lose his audience, often naive, in theoretical complexities. In 1913 he broke with the Theosophical Society and formed his own anthroposophical cult, with headquarters in Dornach, near Basel, where he supervised (1913-1921) the building of the famous anthroposophical temple, the Goetheanum, a huge wooden structure set among woods and orchards and made up of cavernous rooms mod-
eled after organic forms, such as caves, shells, and cellular tissues. He gained adherents throughout Europe, perhaps because he showed the compatibility of mysticism and scientific rationalism; indeed, he disapproved of
submission to unconscious powers, arguing that spiritual renewal depended on full consciousness of one’s perceptions, feelings, and actions. When in 1922 the Goetheanum burned down, he immediately launched plans to build a new one in concrete and succeeded in raising funds from adepts around the world. But he did not live long enough to see it (Kugler). Steiner had no formal training in dance, and he did not begin his adventures in “eurhythmic art” until 1912, when, in Munich, he collaborated with
a nineteen-year-old dance student, Lory Smits, on exploring relations between vowel sounds and movements. Eurhythmics, according to Steiner,
revealed “harmonic” connections between sound patterns in speech and the movement of the body. Whereas Klamt and Woog emphasized breathing as the primal sign of the body’s inner power, Steiner stressed words. He remarked in 1908, “the word, which intones the soul, the logos, was there
in the beginning, and the word so guides evolution until finally being emerges which can also appear. What finally appears in time and space was first there in spirit” (Veit 42). Music derived from tonal and rhythmic principles already embedded in speech, so spoken language disclosed the deepest, most secret bodily responses to sound. Movement made sound visible, and eurhythmics treated language as a “cosmos” of sound units, beginning with vowels and consonants, then words, syntactic structures, punctuation, sentences, meter, rhyme, alliteration, metaphor, hyberbole, recitation, and declamation, all of which corresponded to specific movement choices or combinations of movements. An elaborate process of symbolism bestowed emotional values upon sound units and structures, which then became associated with particular colors, organic and inorganic forms, creatures, planets, and abstract conditions (e.g., active or passive). For example, the letter
262 GROUP DANCING U (indigo) signified a sinking or deepening motion (arms bending parallel before the chest), whereas the letter T (yellow-red) signified a striking or pushing gesture. Letters were elements of a sound “scale,” and different combinations of letters—words—produced different “chords” and rhythmic “intervals.”
Not surprisingly, this approach, when applied to all the variables of speech, led to enormous complexities, which neither Steiner nor any of his adepts was able to put into helpful charts or tables. But Steiner’s aim was not to provide a rigorous system of correspondences; rather, he sought to suggest complexities that encouraged people to become highly conscious of sounds and movements and to realize that even the slightest utterance or movement could reverberate with significance. In reality, his approach was too complex for his lecture-style language, which suited a writer with so many interests besides the almost incidental theme of eurhythmics. But, as Laban eventually discovered with the Kinetographie, the lecture style became hopelessly inadequate in accounting for all the expressive variables of the dynamic body. Steiner therefore relied heavily on drawings, many done in colored chalk, to describe movement possibilities and correspondences, especially for ensemble pieces. A great many of these drawings traced the image of movement without showing the body or bodies and thus transmitted a powerfully mysterious level of abstraction (Steiner). Few images have ever conveyed so persuasively the perception of movement as a mystical
phenomenon. But these chalk sketches on slate backgrounds were an extension of Steiner’s lecture style, and they emblematized a metaphysical
dimension that scarcely seemed to correspond to the physical reality of actual bodies moving in specific times and spaces. In spite of the implied complexity of the cosmic-word concept, the dance culture of the anthroposophists consistently projected an aura of simplicity. Steiner never stressed virtuosity of movement, nor did he push toward any professionalization of performance. He promoted a level of performance that strengthened the cultic identity of those already initiated into the mysteries of anthroposophy; an appeal to the uninitiated audience for professional dance and theatre held practically no interest for him, although he did not hesitate to give public demonstrations of eurhythmics throughout
Europe. He regarded bodily movement as primarily a lyrical rather than dramatic action, “song made visible,” which is to say that he and his adepts overwhelmingly favored “flowing” bodily movements and movements of the
body in space. The body curved; arms and shoulders undulated; rows of bodies pulsed and surged; groups swelled or rippled into spirals, serpentine
coils, arabesques; circles metamorphosed into stars, flowers, anemones, swirling disks, and intimations of stirring cosmic and “organic” forms. Both bodily and group movement were dominated by the image of waves, cur-
GROUP DANCING — 263
rents of water. The welter of tonal and rhythmic tensions in speech and language implied by Steiner's invocation of the “cosmic word” actually had little counterpart in tensions within or between moving bodies. But this lack
of rigorous correspondence between theory and practice hardly troubled his adepts, for the arcane, convoluted mysteries defining the sound-world of speech signified a motive for movement rather than a system of it: indeed, the more complex the system became, the more it signified a mystery to which the body responded with a pliant flow of energy rather than with a compatible or congruent manifestation of complexity. Eurhythmic dancers favored long, flowing costumes—robes, chitons, gowns, capes, veils—following images of ancient Greek maenads, sacerdo-
tal Egyptians, or Romanesque-medieval figures, except that Steiner imposed a cryptic color symbolism on the fabrics. Steiner had staged “mystery plays” since 1889, when he directed his own adaptation of a Goethe fairy tale. He subsequently staged, for festival-cultic occasions, productions such as Eduard Shure’s Eleusis (1907), scenes from Goethe’s Faust (19151916), and Shakespeare’s Midsummer Night’s Dream (1923), in which he applied some eurhythmic principles. He also staged fairy-tale dramas of his own composition: Die Pforte der Einweihung (1910), Die Priifung der Seele (1911), Der Hiter der Schwelle (1912), and Der Seelen Erwachen (1913). How-
ever, strictly eurhythmic performance evolved slowly. Steiner spent several years testing his ideas with Lory Smits, and during World War I, when the
anthroposophists expended much of their energy on constructing the Goetheanum, resources for performance remained scarce. Thus, after an initial demonstration in Munich in August 1913, Steiner gave no more demonstrations of eurhythmic art until August 1918. The fantastically cavernous Goetheanum was able to provide a most appropriate setting to support Steiner's claim that “every artistic dance derives originally from the old art of temple dances, those cultic dances which were performed in the temples of the old high cultures” (Frobose 35). In the 1913 recital, featuring the movements of Lory Smits and two other women, bodies moved entirely
to the sound of recited poetry by Goethe and Brentano. But by 1918, Steiner was including musical accompaniments, composed by adepts, that sometimes underscored the speaking of poetry by Goethe, Hebbel, Morgenstern, Meyer, or Nietzsche. From 1919 to 1923, Steiner gave demonstration recitals in Dornach, Zurich, Paris, Amsterdam, Oxford, Prague, and numerous German cities, with Tatiana Kisseleff as his star dancer and Marie von Sivers as his chief reciter. It is difficult to determine how many people actually performed in the group dances or how the dances on any program differed from each other; most dances bore the titles of the poems that accompanied them, and most
documentation of the concerts focused on the concept of eurhythmics
264 GROUP DANCING
rather than on the execution of the concept. (Photo documentation is unusually scant in relation to the abundant documentation of Steiner’s eurhythmic drawings and watercolors.) In her memoirs, Kisseleff recalled the initial—and not altogether friendly—reception of public (not cultic) audiences, which tended toward bewilderment, and she observed that even
within the Anthroposophical Society many people disliked Marie von Sivers’s portentous manner of reciting poetry (Veit 69-72). Shortly before Steiner’s death, Else Klink (b.1907) began studying at the newly founded Eurhythmeum in Stuttgart under one of Steiner’s protégés, Annmarie Dubach-Donath (1895-1972). After two years (1927-1929) at the Goetheanum, Klink accepted an invitation to work at the Steiner institute in The Hague; she remained until 1935, when she returned to Stuttgart to direct the activities of the Eurhythmeum (Veit 77-110). While Steiner was alive, male adepts apparently functioned as musicians and scenic artists on eurhythmic performances, and women did the actual performing. But when von Sivers and Klink assumed greater authority within the Anthroposophical Society, men became more prominent figures in the performance of dances, and music assumed greater significance than words as a motive for movement, although the “cosmic word” still retained theoretical primacy. The Nazis banned the Anthroposophical Society in 1935 but permitted eurhythmic instruction at the Eurhythmeum until 1941, during which
time enrollment at the school rose from twenty to eighty students. The Gestapo was ever suspicious of eurhythmics and of Klink, whose dark, “unAryan” features led to a scheme in 1937 to replace her with a former Wig-
man student, Martha Morell, who refused to cooperate. In 1941 the Gestapo finally shut down the school and assigned Klink, her associate Otto Wiemer, and her students to factory labor for the duration of the war. In the immediate postwar era, Klink revived the school at the Eurhythmeum and carried on the cultic performance tradition into the 1980s, by which time Steiner’s philosophy had returned to the German cultural scene with perhaps even greater popularity than it enjoyed in the 1920s. Eurhythmics was obviously more important than nearly all dance histo-
ries suggest. Though it did not exert substantial influence on German dance culture or produce any powerful dance personalities, it did establish bodily movement as a redemptive mystery accessible to all people as long as they believed in the anthroposophical philosophy as a whole. Neither an
elaborate technique nor a powerful expressivity bestowed value upon eurhythmic dance; rather, eurhythmic dance bestowed an aura of exclusiv-
ity upon its humble performers. Such dance always functioned within the context of the temple, of a grandiose synthetic doctrine that separated the initiated from those who were blind to a mystery that transcended the banality of the physical world. Through eurhythmics, dance allowed mystery to become a visible feature of ordinary, daily life.
GROUP DANCING 265 GERTRUD BODENWIESER
Expressionism presented modernist abstraction as a primal image of inner psychic or spiritual conditions. Klamt and Steiner represented almost antithetical political variants of abstractionism in this key. But expressionism sometimes linked abstraction to heightened conditions of mechanization rather than spirituality. Skoronel insisted that in her case mechanization
referred to formal properties of movement rather than to the theme of machines or industrialization, but expressionist performance did not remain entirely indifferent to relations between bodies and machines, as was
evident in such prominent dramas as Kaiser’s Gas (1918-1920), Capek’s RUR (1920), Toller’s Die Maschinenstuirmern (1922), and Bronnen’s Anarchie
in Sillien (1924), Max Brand’s opera Maschinist Hopkins (1929), and Fritz Lang’s film Metropolis (1927). As late as 1934, one could see in Braunschweig
a full-length ballet, Menschenmaschinen, by the genial Hungarian composer
Eugene Zador (1894-1977). Unlike futurism, however, which glorified machines, expressionism projected a skeptical attitude toward their salva-
tional power, even though, in the theatre at least, expressionism relied extravagantly on new performance technologies to construct its messages. Damon Maschine (1924) was probably the most famous “machine dance”
performed in Germany during the Weimar era, but its creator, Gertrud Bodenwieser (1890-1959) resided in Vienna. Though she converted to Catholicism early in life, she came from an affluent, cultivated Jewish family influential in financial circles, and she eventually married a Jewish the-
atre director, Friedrich Rosenthal. From childhood she enjoyed contact with modernist art and music personalities in Vienna; the artists Felix Harta and Franz von Bayros collaborated with her on the designs for some of her
early dances. Between 1905 and 1910 she studied ballet under Carl Godlewski, ballet master at the Vienna Royal Opera, but the reactionary insulation of Viennese ballet from virtually any modernist impulse in dance meant that most of her “teachers” were dancers she observed at concerts or
learned about through readings and photographs. She matured quite slowly, for she did not give her debut concert, at a modernist art gallery for
an invited audience, until 1919. The program contained only six dances, but she received an enthusiastic critical response; yet she did not give her next concert, again presenting only six dances, until two years later. In 1922 she ventured into pair dancing in a recital with Ernst Walt, who was actually
a composer, but neither solo nor pair dancing accommodated her ambitions, and the only other dance in which she performed with a man (Curt Hagen) was Konstrucktivistisches Liebeslied (1928, music: Poulenc). Group dance was her passion. So in 1923 she formed a school and ensemble in the basement of the Vienna Concert House, which remained her headquarters until 1938 (MacTavish 15-20).
266 GROUP DANCING Her school, she asserted, embraced expressionism wholeheartedly and did not focus “one-sidedly” on the cultivation of “gracefulness,” nor did it adopt any of the prewar Grecian dance styles as a model for a new dance art. Bodenwieser saw dance as an image of the modern world in which she lived: “I want in my dances struggle, passion, Dionysiacally intensified feeling for life, but also chaos, horror, and degeneration” (Stefan 95). With her ensem-
ble she choreographed an enormous number of pieces, and the company visited an astounding number of European cities, perhaps more than any other Germanic dance group of the era, especially in such countries as Czechoslovakia, Poland, Italy, Rumania, Bulgaria, and Belgium; it also vis-
ited New York, France, England, Holland, and gave the first Germanic ensemble productions in Japan (1934). Wherever the Bodenwieser group appeared, it signified a self-consciously modernist attitude toward performance, informed by avant-garde tendencies in the visual arts and an openness to contemporary music. When the Nazis annexed Austria, she knew
she no longer had a future in Europe, so she and her husband went into exile, along with several of her students, first to France, where she formed a new group, then to Venezuela and Colombia, for a concert tour that even included performances in a bullfight ring. Her husband stayed behind in
France to do radio work, but two years later he disappeared after the Gestapo arrested him. Bodenwieser, at the invitation of one of her students, had traveled to New Zealand and Australia, which became her home for the rest of her life. In Sydney she soon established another school and became one of the strongest personalities in the modern dance scene of Australia
and New Zealand, producing about a hundred dance works in less than twenty years.
Though Bodenwieser choreographed an astonishing number of group dances before she left Austria, Damon Maschine remained her most famous achievement and the work upon which perception of her as an avant-garde artist rested. This piece contained all the major features of her dance aesthetic, and her prolific output was perhaps based on her skill in constructing manifold variations of these features. But the piece projected a peculiar relation to abstraction. Originally, Damon Maschine was the second part of a four-part cycle of dances, Gewalten des Lebens (1924), whose first part, Ein Wesen, dated from her brief partnership with Ernst Walt in 1922. However, the second part attracted so much fascination that the cycle as a whole often became identified as Damon Maschine. Bodenwieser began presenting the second part independent of its context, even though the cycle constituted
a dramatic narrative that disclosed an overarching, controlling attitude toward machines. The second part unwittingly showed the power of abstraction to undermine narrative unity, yet Bodenwieser’s notion of abstraction was hardly extreme, for she never allowed it to undercut her enthusiasm for decorative theatricality. In the first part, two figures, He and She, wearing
GROUP DANCING 267
light-blue veils, made swinging motions together to “dreamy” music by
Debussy. (In group performance, a woman danced the male figure.) According to Bodenwieser, “The body of the woman softly repeats the rhythm of the man. He reaches high and grasps at the stars. But already the half-sunken beings [around the couple] reach with the same desire into the ether. Full of ardor, the man kneels humbly before life. And she with him.” With the couple, a “common destiny weaves them into asingle being,” and the “great swaying of life urges them toward a final and scarcely intimated abyss” (RLM 181).
The second part, “Damon Maschine,” employed gong and percussion music by Lisa Mayer and showed how machines destroyed the unity of being
achieved by the couple. Six dancers turned their bodies into images of machines: gears, levers, pumps, pistons, pulverizers, dynamos. Five of the dancers wore abstractly colored briefs and long-sleeved tops that exposed much flesh and thus reinforced the perception of the body as a machine; the sixth dancer wore a dark, “demonic” uniform, looking somewhat like a robot. Bodies functioned as parts of a single “machine”; they intertwined
and joined mechanically through complicated, contortionistic relations among kneeling, squatting, kicking, grasping, thrusting, squirming, hammering, and interlocking, moving from lying to standing positions, from profile to full face. A group was a carnal machine—and quite decorative, too (Renner 53-54) (Figure 60). The third part presented “the golden calf” (music: Petyrek). Here two bodies formed a single idol, with four arms, a crown, and a “golden aura.”
Around the idol danced five Corybants: “Lust from tip-toes to fingertips. ... Throbbing, ecstasy, frenzy, impotence, collapse. The idol grins victoriously” (RLM 182). In the final part (music: Mussorgski), “the oppressed, the defeated, the confused, the devastated. Frost passes through the column of the outcast. The priestess strides through the group. The glow of reason and good streams through the darkness,” in the manner of a painting by Massacio. What probably made the machine dance so popular was its erotic decorativeness. The piece did not, as in revue dancing, rely on chorus-line synchronicity of movement to suggest mechanization of identity and feeling. Rather, bodies formed different patterns of synchronicity and counterpoint with each other to create a pulsing, mutant machine-organism of ecstatic intensity, amplifying both the desireability and the demonic power of female bodies. The piece was never so abstract that one lost sight of the theatrical imitation of a machine. Bodenwieser always remained devoted to theatrical
effects; indeed, she advocated closer relations not between dance and opera-ballet but between dance and the literary theatre (Stefan 58-59). For Karlheinz Martin and Friedrich Rosenthal, she “choreographed” actions
and inserted dances into productions of otherwise danceless plays by
268 GROUP DANCING
Raimund, Wedekind, and Kokoschka, and she designed a dance for Friedrich Kiesler’s experimental, spiral Raumbuhne in 1924. But in spite of her declared distaste for gracefulness, she never detached her theatricality from decorativeness and elegant pictorial effects derived from her familiar-
ity with modernist art trends; these made her dances seem advanced and sophisticated without being especially demanding or disturbing. In her solo “cubistic dance” (1923), she wore a bizarre costume of conical sleeves and pants, but the music was by the American romantic composer Edward MacDowell! Her image of the machine was peculiarly lyrical, drawing on a Viennese tradition of curvilinear beauty exemplified earlier by Grete Wiesenthal; her introductory dance course began with the study of figure-8 spiral movements (Brown 16). She created a huge quantity of charming adaptations of folk, social, and cabaret dances that pleased audiences as much in London or Crakow as in Vienna. These contrasted almost absurdly with her ambitious, mystical-allegorical dance cycles, usually in three parts, such as Biblische Themen (1923), Gotische Suite (1928, music: Gluck), Schwingungsaustausch (1930, music: Lorber), Rhythmen des Unbewussten (1928, music: Wellesz), Die grosse Stunden (1931, music: Tcherepnin), and Drei Tanzsymbolen (1933, music: Bortkievich). Stromung und Gegenstromung (1928), whose three parts were titled “Mysticism,” “Mechanization,” and “Decadence,” was another machine dance based on Henry Ford’s principles of automated factory labor, but this piece provoked less favor than others
had, perhaps because it lacked decorativeness. A Rumanian reviewer remarked: “With shining eyes, girls wander happily in pairs. Demonic mech-
anization emerges. Sucks them into its black-red song. Compels them to convulsive gliding, stamping, and swinging, to pushing and shoving.” The orgiastic bacchanal of the “decadence” part ended in paralyzed impotence (MacTavish 37). The narrative for this strange cycle suggested that mechanization arose out of mysticism, out of the mysterious unity of the couple, and destroyed it as well as the couple; mechanization awakened in the body
a hunger for a monstrous ecstasy, leading inevitably to decadence, from which no one could expect salvation or a redemptive light. A recurrent feature of Bodenwieser’s group dances was the absence of a leader figure, a major contrast to Wigman’s ensemble aesthetic. However, her mystical image of the couple appeared even stranger than most embodiments and was not without a strong homoerotic aura. Bodenwieser liked images of intertwining female bodies—pillars, pyramids, friezes of conjoined or interlocking bodies—which produced a curiously contorted, arabesque view of feminine being as multilimbed, multiheaded, and multimirrored, an effect beautifully captured in popular photographs taken by the D’Ora-Benda studio (Faber, Tanzfoto, 66-69). But Bodenwieser especially stressed the looping, cradling, embracing, nudging, plying, rubbing, and prodding of bodies, often in kneeling or reclining positions, with pairs
GROUP DANCING 269
and sometimes trios of dancers, most obviously in [ch und Du (1935), Wiegenlted der Muttererde (1934), Tanz mit goldenen Scheiben (1934), Die Masken Luzifers (1936), and Tanz der drei Schwestern (1928). For Bodenwieser, the mystical coupling of bodies entailed a lyrical mechanization of movement—ecstasy, one might say, depended on the decorative coupling of mysticism and mechanization. The intertwining of female bodies also appeared, to a lesser degree, in the work of other dancers in Vienna, such as Ellen Tels and Ellinor Tordis, and in the work of Gisa Geert and Hilde Holger, both students of Bodenwieser. Holger (b. 1905) danced in the first production of Damon Maschine,
and her ensemble aesthetic relied strongly on the Bodenwieser device of intertwined bodies creating a “single being.” This device appeared most emphatically, perhaps, in Orchidee (1933, music: Ravel), though it also pervaded her choreography of Mechanisches Ballett in 1926, with music by Hirschfeld-Mack. Holger, too, came from a cultivated Jewish family, which
brought her in touch with prominent Viennese artists and intellectuals such as Stefan Zweig, Elias Canetti, and Erni Kniepert, and she posed nude for modernist artists such as Felix Harta, Benedikt Dolbin, and Joseph Heu
and the photographer Antios (Takvorian 18-19). Yet a peculiar timidity marked her dance aesthetic and her performance productivity. In 1926 she left the Bodenwieser group and formed her own school and ensemble in the Ratibor Palace in Vienna. Unlike Bodenwieser, however, Holger ventured eventually to infuse her mysticism with overtly Jewish themes, which appeared in the solo Hebrdaischer Tanz (1929, music: Weprik), Kabba-
listischer Tanz (1933, music: Rieti), Ahasver (1936, music: Rubin), and Golem (1937, music: Wilckens).
Holger’s perception of bodily movement owed less to the image of the machine than to the image of the marionette, particularly after she became
friends with Richard Teschner (1879-1948), the Viennese designer of masks, figurines, and marionettes. Teschner’s eerily exquisite fairy-tale figurines inhabited a fantastic miniature theatrical world (“Figuren-Spiegel”) of rococo, Arabian Nights, and Indonesian puppet ornamentality. Holger began to introduce masks and historicizing costume details that made her dances appear less abstract, as in her solos for Javanesische Impression (1931) and Golem. Much of her group work in Vienna was for children, and it was
not until she went into exile in 1939 and gave up solo dancing altogether that she disclosed any expansive confidence in group dance to embody her desires. She spent the war years in Bombay, where she formed a school and put on concerts, then (1948) migrated to London, which became her permanent home (her husband, an Indian, was a physician). There she opened another school (1951), which operated continuously into the late 1980s. Unlike Bodenwieser, Holger liked working with male students and dancers, one of whom was the wild English theatre director Lindsay Kemp (b. 1939).
270 GROUP DANCING But wildness was precisely what Holger’s aesthetic lacked. Her reluctance to
push herself beyond the devices of Bodenwieser and Teschner apparently resulted from her sense, throughout her life, of having to move cautiously, with marionette decorum, in societies (rather than close-knit circles) that were permanently foreign to her (including Vienna) and easily capable, as she herself suggested, of “misunderstanding” almost any serious bodily movement of modernity (Takvorian 37). KURT JOOSS
With Kurt Jooss (1901-1979), expressionist dance avoided both abstraction and influences from modernist art yet explored themes of social alienation and anxiety. Indeed, Jooss acquired an exaggerated reputation as a satiric commentator on (or caricaturist of ) social role-playing because he respected traditional narrative models for framing bodily movement. His modernism therefore depended on his situating expressionistically distorted images of contemporary social types within a premodern narrative structure. Jooss was born on a farm near Stuttgart but never showed any serious interest in farming; even so, a vaguely agrarian-guildish (rather than cultic) notion of community shaped his aesthetic and perception of social reality.
At first he considered a career as an artistic photographer, then (1919) focused on singing and drama at the Stuttgart Academy of Music. But “something was missing everywhere, and I no longer believed in my dream
of the arts” (Markard 29). He therefore resolved to return to the family farm. However, as soon as he made the vow he encountered Laban in Stuttgart, and although Jooss was, as he put it, “heavy, phlegmatic, and totally without muscles,” his “whole being gradually became a part of this art,” to the extent that “my body changed.” On the farm again, he could think only of dance, and he experienced the most intense suffering of his entire life. Shortly after his father died, Jooss could no longer live apart from dance, so in 1922 he rejoined Laban in Stuttgart and followed him to Mannheim, then Hamburg, where he met Sigurd Leeder, who had collaborated with Jutta von Collande. Early in 1924, Jooss and Leeder formed the
only male pair dance couple in German dance, but it was not until 1926-1927 that they actually devised the program “Iwo Male Dancers,” comprising solos and four duets, all apparently grotesque. The composer Marcel Lorber, who worked so closely with Bodenwieser in Vienna, accompanied them on the piano. But the tour collapsed when Jooss injured his knee. By this time, however, he had other tasks to fulfill. His close connection
to Laban recommended him to the innovative opera director Hanns Niedecken-Gebhard in Munster, where in 1924 Jooss had choreographed
GROUP DANCING 271 his first notable ensemble piece, the Tels-Wellesz Perstsches Ballett, with Yvonne Georgi and Jens Keith. Jooss and Leeder worked with a small corps of six men and ten women on modernistic operatic and dance works by Hindemith, Toch, and Wellesz; Jooss supplemented these pieces with large and small scenarios of his own composition, primarily of a grotesque and satirical nature. After observing ballet schools in Paris and Vienna, Jooss and Leeder began to incorporate ballet technique into their pedagogy and pro-
| ductions, although Jooss continued to regard ballet as “dead from within” (35). In 1927 the city of Essen invited Jooss and Rudolf Schulz-Dornberg to establish a subsidized arts school, the Folkwangschule, with Jooss as director of a dance studio aiming to integrate dance and theatre—“Tanztheater.” At
Essen he gathered about him a team of collaborators whose talents were manifest at Munster: Leeder, the scenic designer Hein Heckroth (19011970), the composer Fritz Cohen (1904-1967), and the Estonian dancer Aino Simola (1901-1971), whom Jooss married in 1929. Jooss further consolidated dance and theatre by working with the conductor Toscanini and Laban on the Paris version of the Tannhduser Bacchanale (1930) and by accepting appointment as ballet director of the Essen Municipal Opera, for
which the Folkwang dance company performed all ballets. Then he appeared as a dancer-actor in stage productions of Kaiser’s Europa (1931) and Shakespeare’s Midsummer Night's Dream (1931), in which he played Puck. With The Green Table (1932), Jooss produced his most popular international work, winning first prize and 25,000 francs at the Concours de Choreographie in Paris. At this point Jooss detached his dance company from the subsidized theatre and formed the Ballets Jooss, which toured several Rhineland cities, Holland, Belgium, Switzerland, Paris, London. Nazi press and propaganda, however, expressed virulent hostility toward Jooss, primarily because he collaborated with Jews, but because his company enjoyed no subsidies it was not until September 1933 that the Gestapo moved to arrest him—in vain,
for Jooss and his entire company of twenty-three persons had sneaked across the Dutch border. In 1934, Lord Elmhirst invited Jooss and his com-
pany to make their headquarters in Dartington Hall, Devon, England, where the company remained until 1942, realizing “Jooss’s early dream of an academy of the arts in a rural setting” (Coton 56). But financial pressures compelled the company to tour almost continuously from 1934 to 1940 throughout Europe, South America, the United States, Canada, England, and Ireland. Probably no other dance company in the world reached such a large international audience, although the repertoire consisted primarily of works created before 1933. For reasons of national security, the company moved to Cambridge in 1942, and Jooss served in the British Army. The Ballets Jooss returned to Europe and America in 1946 as part of the British Army entertainment services, and Jooss himself became a British citizen in
272 GROUP DANCING
1947. In 1949 he accepted another invitation from Essen to direct the dance activities of the Folkwangschule; by 1953, however, the city claimed it
could not longer fund the company. After a stint at the Dusseldorf Opera
(1954- 1956), he devoted himself entirely to teaching until the 1960s, when state subsidies allowed for the establishment of the Folkwangballet. By this time Jooss enjoyed the reputation of a revered master teacher who synthesized Ausdruckstanz and ballet through the concept of “dance theatre.” His most famous student was Pina Bausch (b. 1940), probably the greatest
dance artist to emerge from Germany since the Weimar years. When he retired from the Folkwangschule, in 1968, Jooss continued to lecture and hold master classes internationally; his daughter, Anna Markard (b. 1931), supervised the elaborate documentation of his legacy. At the end of his career he seemed to have no enemies and no serious challenges to his perspective; he was always a “sweet” man, gentle, patient, persistent, friendly, and sensible, free of fanaticism and abundantly blessed with quiet, healthy optimism. As an artist, Jooss was skeptical of “barbaric Ausdruckstanz’ and believed
by 1924 that “the creative adventures of expressionism lie behind us” (Markard 15). He therefore followed a vision of “New Dance” in which a Platonic sense of order was no longer incompatible with modern bodily expressivity (Coton 30-31). At the heart of Jooss’s aesthetic was “a creative compromise between free personal expression and formal compliance with objective, intellectual laws,” “a compromise in the noblest sense, which one can likewise designate as axial to the world of art” (Markard 17). For Jooss, compromise meanta synthesis of dance and theatre achieved through a synthesis of Ausdruckstanz and ballet. But Jooss’s concept of ballet was somewhat ambiguous, for by it he did not mean an elaborately rigid system for
automating bodily movement within an extravagantly artificial performance space. He loved the idea of laws governing movement, but he wanted
a “gestural training based on natural laws of mimicry and expression,” so that movement always appeared “new” and “natural” at every moment of performance (Coton 72). In practice, this notion of compromise supposed that expressive power derived from the observation and perfection of socially coded bodily movements in daily and ceremonial life. In the rather abstract Larven (1925) and Groteske (1925), Jooss used masks and eccentric costume details to render bizarrely comic the idealizing gestures and poses of ballet—with, for example, a female dancer performing on pointe pirouettes in a specially constructed dress that made her look like a dwarf, with the other four dancers
amplifying the perception of a community unified only through a grotesquely extravagant respect for conventionalized signification of heroism and grace. In these cases, costume largely designated movement as grotesque. But in Kaschemme (1926) and Tangoballade (1926), costume
GROUP DANCING ~— 273
scarcely departed from what the dancers might actually wear on the street; instead, movements from popular social dances became powerfully exag-
gerated, with female couples dancing passionately, eyes closed, as in Kaschemme, or in a kind of somnambulatory line, as in Tangoballade. In Pavanne (1929), with its lavish sixteenth-century costumes, Jooss showed that exaggerations of conventionalized decor and movement could operate
in a tragic as well as grotesque mood (although the intense sadness of Ravel’s music probably dominates perception of any movement it accompanies to such an extent that I think it impossible for anyone to produce a grotesque-comic dance using the piece). Jooss sought a compromise between abstraction and “naturalness,” and this he achieved above all by emphasizing the restoration of conventional narrative strategies as the chief source of value and motivation for dance. As
early as 1924 he was willing to assert that “the dance pantomime is the actual theatre form of dance” (“Der grune Tisch,” 22). The exaggerated perfection of socially coded movements transformed the body into a recognizable social type (or caricature) whose actions produced an easily readable story. It was not pantomime so much as the “natural” consequence of
exaggerating the social codes signifying various emotions and motives, regardless of their historical context. Jooss did not confine himself to a contemporary image of the world. The Prodigal Son (1931), for example, with music by Prokofiev and choreography by Balanchine (originally done for Diaghilev in 1929), presented a vaguely biblical parable about a young man whose acquisition of glory and power leads to his corruption and then his betrayal by his followers. A Mysterious Stranger, who earlier had tried to dissuade the young man from his dream of power, finds refuge for him among a community of harlots, then denounces him to an underworld mob. Alone and penniless, the man journeys wearily back to the home of his father but meets the Mysterious Stranger along the way. This time he repudiates his enigmatic “friend.” Here, as in subsequent works, Jooss disclosed an acutely ambivalent attitude toward the pursuit of power and leadership, but he had difficulty constructing an image of community that effectively justified or neutralized his ambivalence.
This ambivalence toward the power and ambition of leaders reached maximum intensity in the great international hit The Green Table (1932, music: Cohen), an expressionist satire on political power-brokering inspired, according to Jooss, by the medieval dance of death. The dance drama contained eight scenes showing the triumph of Death over all who followed their leaders to war. The first depicted ten diplomats in formal attire and distorted masks “negotiating” around a green table: “They smile, persuade, flat-
ter, argue, then rage at one another. They threaten and gesticulate wildly with harsh, puppet-like movements which stress the unreality of the emotions to which they pretend. They go through a formula of discussion; they
274. GROUP DANCING
understand, they apologize, they resume their chattering until their mutual hatred impels to a mutual rage. At this point they leave the table, pacing up and down, back and forth, with the agitation of bantam cocks or the wariness of foxes” (Coton 49). This description indicates how Jooss’s idea of building dances around socially coded movements actually entailed an almost cartoonish exaggeration of conventional (or “formal”) significations to suggest
the demonic insincerity of gestural signs, an observation reinforced by archival film footage of the dance and by videotape documentation of the Joffrey Ballet’s 1976 reconstruction. Subsequent scenes depicted the call to arms, the farewell, military training, the battle, a brothel, “the dark roads
where wander the homeless and stricken refugees,” and the return of the ridiculous diplomats. The two major figures were the War Profiteer and Death, who form a macabre partnership that concludes with a chess game won by Death, who gathers up all the pieces along with the Profiteer. Originally played by Jooss himself, Death appeared in all the scenes, “sapping desire, corrupting ability, as he hovers in the background or stalks steadily, mechanically and undeviatingly through scenes of battle, flight, or surrender” (49). Death was played by a nearly naked dancer who had a skeleton painted onto his body and wore a sort of centurion hat, boots, and a black pelvis/rib cage. Though the diplomats looked contemporary, the figures in
all the other scenes projected vaguely archaic and definitely premodern images—except for the Profiteer, who wore a bowler and a T-shirt and resem-
bled more a habitué of a boxing gym than a figure from a corporate boardroom. For Jooss, the desire for power entailed the heightened expression of insincerity, which led to catastrophic misunderstandings and conflicts (war). Death, the ultimate power figure, controlled the destinies of societies; a leader was someone whose body moved in accordance with the grand ambition of Death to take everyone with him. This attitude was quite at odds with that of Wigman in the spectacular Totenmal (1930), in which the (female) leader established her command over groups (movement choirs) through movements signifying a heroic confrontation with Death rather than a foolish blindness to it. With The Big City (1932), Jooss moved toward a more cinematic narrative style that dispensed altogether with the figure of the leader and the theme of ambition as the measure of identity. Here he presented a complex image of a modern society defined and unified above all through sexual desire: “We see typists and clerks, the newsboy and prostitutes, factory girls and working lads; elegant and would-be-elegant men of leisure, a few tramps and fanatics, a sprinkling of touts, beggars and street vendors walk, loiter, amble or trot briskly along. It is the evening cross-section of Main Street anywhere, made up almost entirely of those whose lives are too formless, or whose pockets are too light, to enjoy solitude or leisure” (Coton 40). In the midst of this crowded scene appear a Young Girl and a Young Worker,
GROUP DANCING — 275
lovers, who dance romantically and innocently until the entrance of the Libertine, who casts his suave spell upon the Young Girl and entices her away,
leaving the Young Worker impotently enraged. The ensuing scene depicted, with much use of magnified shadows, the Libertine bestowing an expensive gift (a party dress) on the Young Girl in her tenement neighborhood. When the Young Girl departs momentarily to change into the dress, the street urchins display a peculiar capacity to resist the seductive charm of
the Libertine and perceive his insincerity. The Young Girl returns and dances with the Libertine into the night while the children and mothers point accusatorially at the couple. The final scene takes place in a dance hall, “where stupid, doll-like youths and girls stamp and contort through graceless motions of a debased kind of ballroom dance” (41). The Girl and
the Libertine appear and dance orgiastically. Then the music becomes melancholy, and the ballroom figures metamorphose into proletarian couples, who perform a kind of tragic waltz of futility. The Young Worker enters and dances with different partners, seeking the Young Girl, but in the end he dances all alone; dancers from both classes become mere shadows, while “the maddening stupid rhythm goes on and on, marked by the even stamp and shuffle of the dancing automatons” (44). This rather rural vision of big city life was, according to Coton, “built on all variations of human locomotion—prancing, shuffling, ambling, gliding, hesitant, bold, furtive—and a style of freely rhythmic and unstressed dance which show[ed] more elasticity but less elevation, little line but plenty of roundness, in comparison with classical Ballet” (44). Moreover, Jooss used “long cross-stage lines and full-stage circles,” with “small circles opposed to, or built towards, large circular movements,” to suggest “characters moving inside space, rather than against a background” (45). Thus, although Jooss offered a conventionally negative representation of female class mobility through erotic desireability, the movement of an entire social class was signified by intricate circular patterns—especially of multiple couples and trios—rather than by the synchronicity of feeling and action that conventionally signified “class” in theatrical performance. This work indicated that the use of socially coded movements to shape dance was synonymous with the representation of conditions of loneliness, alienation, futility, and disillusionment, an attitude cultivated with even greater intensity in the postmodern dance aesthetic of Pina Bausch. With A Ball in Old Vienna (1932, music: Lanner), Jooss satirized the conventions of the courtly waltz in a nostalgic atmosphere of the 1840s. By exaggerating its movements, he implied that the waltz disguised the desire to assert power over an entire social class: one asserted power over the body
of one’s partner in a context elaborately contrived to produce this disguise—the ball. For Jooss, dance itself implied an intensely physical “fascination in the actions and reactions of those people, at any social level, who
276 GROUP DANCING are able to exercise practically unlimited power over others” (53). In Ballade
(1935, music: Colman) he returned to the tragic, medieval mood of Pavanne, full of somberly ceremonial movement, but this time he pitted two
couples—King and Queen, Marquis and Marquise—against each other, with a virtually static Queen provoked to a display of “awful power” by a triv-
ial indiscretion of the King and the Marquise. The Mirror (1936, music: Cohen), however, told a contemporary story of three men—the Man of Leisure, the Middle-class Man, and the Laborer—comrades during the war,
who return to their homes to find expanding misery, poverty, and unemployment. The unemployed Laborer abandons his wife to a life of prostitution; the Middle-class Man attempts to form a political movement uniting bourgeois and proletarian interests, but the workers repudiate him. An encounter with the wife-whore awakens in the Middle-class Man the authority he needs to lead a full-scale revolution against the capitalists. But total chaos results, and the three men, united by pervasive social suffering, find themselves comrades again. Chronica (1939, music: Goldschmidt) followed
an even more complicated plot, set in the Italian Renaissance, about a stranger who gains the confidence of influential citizens to become leader of a city. However, when he resorts to despotic measures to restore social order, he unwittingly provokes conspiracies, treasons, revolution, madness, and the sacrifice of his life. In these later works of the 1930s, Jooss apparently wished to test the capacity of dance to construct unprecedentedly complex narratives and psychological states. The narratives became more convoluted, but the movements of the dancers did not: his repertoire of movements included hardly anything beyond the social codes he had already explored in pre-1933 works. It was thus evident that narrative complexity had little to do with choreographic complexity, semantic density, or expressive power, an indication that Jooss’s belief in conventional narrative as the force synthesizing dance and theatre was perhaps excessively optimistic. Pandora (1944, music:
Gerhard) nevertheless constructed another elaborate allegory, in three acts, in which the beautiful but evil Pandora corrupts the People with her mysterious box. Pandora releases all sorts of monsters on the world and persuades the masses to sacrifice their children to the Machine God; a lone Young Man remains ever-faithful to the virtuous but remote Psyche. Only in a context of complete destruction and desolation is it possible for the Young Man to assert power over the People and banish Pandora. But this sort of morality drama, saturated with intricate plot twists, could not disguise a fundamentally ruralistic oversimplification of tensions between leader and group, with “good” authority over the People dependent above all on loyalty to the unerotic visions of innocence cultivated by youth rather than on desire for a magnitude of love that “insincere,” conflict-ridden social codes deny people. Jooss was skillful in exposing socially coded movement, but he
GROUP DANCING ~——_277
lacked the imagination, so strong in Wigman, to perceive the power of movement to differentiate bodies, to free bodies from social codes; he failed to create in movement, rather than in a story, a convincing representation of human salvation and freedom.
Like every gifted student of Laban, Jooss attracted many strongly talented dancers (especially men, perhaps to a greater degree than any other Weimar dance personality), including Karl Bergeest (1904-1983), Jens Keith (1898-1958), Rudolf Pescht (1904-1959), Ernst Uthoff (b. 1904), Hans Zullig (b. 1914), Elsa Kahl (b. 1902), Trude Pohl (1907-1975), Lisa Czobel (b. 1906), Frida Holst, and Heinz Rosen (1908-1972). His company contained dancers from Poland, Latvia, Switzerland, France, England, Hungary, Holland, Austria, and the United States (Agnes de Mille collaborated with the Ballets Jooss in New York in 1942); no doubt his devotion to accessible theatrical narrative enhanced his appeal for young dancers wary of the great risks involved in pursuing more abstract or experimental forms of dance, with their smaller and more cultish sense of community. After World War II, when Leeder went to Chile, the doctrine of building dance out of socially coded movement spread further through the international dispersion of Jooss’s disciples. But it was in Germany that his influence reached most deeply, for in postwar Germany he appeared almost alone in
proposing that dance exposed contemporary social realities by being “about” the very movements that constructed social identities and relations in the world inhabited by the spectator. As he once remarked in Der Scheinwerfer (11/12, March 1928, 23): “But the dancer himself... experiences the highest human happiness: to rise up out of the pitiful, sorrowful realm of the small, personal quotidian life and to ascend, with body and soul, asa human of flesh and blood, into the heaven of all religions: the eternal fantasy.” Thus, even the effort to produce a sober, “objective” critique of the social basis for movement and bodily expressivity carried with it a grandiose hunger for ecstasy. LOLA ROGGE
The synthesis of Ausdruckstanz and theatre through dramatic narrative could take another form than that demonstrated by Jooss. Instead of building narratives out of socially coded movements, modern dance could build them out of idealized or historically coded movements that nevertheless did
not derive from either ballet or “nature” as Jooss understood that term. Such a strategy defined the work of Lola Rogge (1908-1990). She was born in Altona near Hamburg and spent virtually her entire career in Hamburg. Her choreographic output was small, but she favored large-scale, ambitious projects, which she liked to revise and perfect. She first studied dance at age twelve under Gertrud Zimmermann, and in 1923 she decided to become a
278 GROUP DANCING
dancer after performing a solo in a school dramatization of poems from Goethe’s West-dstlichen Divan, at which time she encountered a student familiar with Laban’s new school in Hamburg. Rogge’s parents opposed a career in dance for their daughter, believing that a career in hospitality services was more suitable. Her mother expressed alarm at the sight of barechested men in Laban’s studio; however, the daughter displayed an even stronger will. She arranged for Jenny Gertz, a Laban disciple devoted to the instruction of children, to give another demonstration, which succeeded in
persuading Rogge’s parents to let her begin study at the Laban school in 1925. During the war, Rogge’s health became delicate as a result of nutritional deficiencies, and she experienced a very sheltered life and education. Yet her dance aesthetic evolved toward a heroic-athletic image of the body,
though she did not construct an especially hygienic attitude. One might even say that Rogge showed greater interest in representing a powerful will than in manifesting a healthy spirit. At the Laban school, where she claimed she “discovered” her body, she
became active in the movement choir experiments that contributed so abundantly to Laban’s appeal and mystique. In these Laban treated the group as an abstract form, full of elaborate, geometric configurations detached from any conventional narrative context. What excited Rogge about movement choirs was the possibility of becoming a choir leader, who could “carry with her the group dancers, draw them into her sphere” (PS 29). But her sense of community was more cultured than cultic and did not altogether fit the aim of the movement choirs, with their constant, improvised appropriation of new spaces and their frequent indifference toward the idea of an audience. For Rogge, the group was the image of a powerful controlling will, the creation of a leader, whose desires manifested them-
selves in narrative movement that surpassed the strength of ballet technique or “systems” of modern dance to constrain them. But she first established her own identity as a leader by opening, at age nineteen, a school in Hamburg—the Lola Rogge Laban School, which still exists. Her first students came from elite Hamburg families, daughters of her parents’ friends; she innovated by introducing courses whereby employees of major Hamburg firms, such as Shell, Reemtsma, and Deutsche Bank, could study bodily movement through corporate-sponsored cultural and development programs. She also devised schemes that permitted working-class families to take movement courses for very nominal fees, with some subsidiary support from labor unions. In 1928 she initiated regular free days for schoolchildren, who received an entire day of instruction and exercise free. She started doing morning radio broadcasts of gymnastic exercises in 1930. In 1929, Rogge began collaborating with the Social Democratic Party and Hamburg ballet mistress Olga Brandt-Knack in coordinating lay move-
GROUP DANCING — 279
ment choir activities. This led, in 1931, to her first large-scale ensemble piece for the public, scenes from Albert Talhoff’s expressionistic “vision for word, dance, and light,” Jotenmal, a choric memorial to soldiers killed in the
Great War. Wigman had provoked much controversy the previous year at the Munich Dance Congress with her own grandiose multimedia version of Talhoff’s poem; Rogge’s treatment of the material was far less experimental, complex, or spectacular. She confined the action within a small proscenium stage and set the unmasked movement choir against painted expressionist backdrops, whereas Wigman had employed a huge space permitting antiphonal and contrapuntal relations between various masked speech and movement choirs, as well as highly abstract lighting effects achieved partially through a color organ. Rogge herself danced the role Wigman had assumed, the female spirit of life in dialogue with Death, but she apparently stressed the motherly dimension of the role at the expense of the erotic (PS 44-47; Peters 4). Nevertheless, the production received much acclaim; indeed, one can say that Rogge never created a work that was a failure with the public. Her next project, done in 1931 with her students, definitely thematized the identity of the leader by being a choreographed enactment, with original music by Willi Jansen, of the medieval story of the Pied Piper. The same year she married Hans Meyer, a businessman with a great affection for playing the piano. He added his wife’s surname to his own and became Hans Meyer-Rogge. When he lost his job with an export firm during the economic crisis of 1930, he assumed significant managerial responsibility for the Rogge school and became a kind of shadowy collaborator with his wife on the creation of her dance works.
Thyll, with original orchestral music by Claus-Eberhard Clausius, appeared in 1933. This long dance drama in four scenes, from a scenario by Meyer-Rogge, depicted the Breughelesque adventures of the Flemish folk hero Thyll, danced by Rogge herself. The vagabond Thyll exerts a charismatic spell over the carnival-like crowd in a late-medieval Flemish town, performing a dance with two swords and other acrobatic feats. Upon learning of his father’s death, he seeks his beloved, Nele, but their paths never seem
to cross (Rogge constructed a curious, spatially distanced duet between them to signify their attraction to each other without their ever becoming a couple). In a dream Thyll sees the foreign oppressors of his country, then hears the voice of his conscience, which is also “the voice of the people.” “Only when farmers and citizens are united, only then will Flanders be free. If Avarice, Envy, and Indifference hinder the work of unification, Thyll must die and with him freedom” (PS 56). When Thyll awakes, he gathers about him an expanding group of insurgents, who march on the town in the most
spectacular scene in the drama, the “Geusenmarsch,” or march of the Protestant “beggars.” Thyll remains outside while the crowd pours into the
280 GROUP DANCING city. At a patrician ball featuring a children’s gavotte and a nobles’ pavanne, Thyll sees the disunity produced again by Avarice, Envy and Indifference. He
therefore dies of despair—but who can bury the Flemish spirit? “You can sleep, but die?-—never!”
Rogge used spoken narration to clarify some actions, such as the appearance of the disunifying vices in black, yellow, and gray. Unlike Jooss, she did
not build narrative complexity through exaggeration of socially conditioned movements in daily life. Rather, narrative evolved through movements rooted in athletics, gymnastics, and military maneuvers, although these tended to signify something other than physical prowess or exertion. Rogge’s movement style was far less pantomimic than Jooss’s but always dra-
matic. She derived many of her movements from archaic or traditional dance forms, such as the gavotte, the pavanne, the Teutonic sword dance, and various German folk dances; few choreographers displayed as much imagination in making use of march rhythms. Her ensemble movements were consistently choric, faithful to the Labanian concept of the movement choir, which implied all sorts of complex geometric patterns and formal
tensions between groups (in circles, countercircles, spirals, converging diagonals, colliding rows, phalanxes) but little development of individuals
(or leaders) within groups and little effort to show transformations of groups into new communities. With the disbanding of the Social Democra-
tic Party movement choirs by the Nazis and the subsequent pressure to depict groups in unison formations, Rogge enjoyed little opportunity to explore deeper dynamics or contradictory tensions defining group movement. However, the regime did not intrude much on her completely private
school, never even reproaching her for excluding mandatory courses on ideology and race theory from her curriculum. For the Hamburg State Theatre, Rogge choreographed numerous dance interludes inserted into otherwise strictly dramatic productions, and her school participated regularly in civic festivals held by the city of Hamburg.
But these activities seemed incidental to her next big project, Amazonen (1935), a three-act dance adaptation of Heinrich von Kleist’s monumental tragic drama of female warriors, Penthesilea (1808), which already had been
turned into an exciting expressionist opera in 1926 by Othmar Schoeck and a luxuriantly eccentric comedy by Ilse Langner (1932). A passionate student of ancient Greek mythology and archeology, Meyer-Rogge wrote
the scenario; the music consisted of various compositions by Georg Friedrich Handel, whom Rogge regarded, curiously, as a superior composer of dance music. In the first act, set in the mysterious, cultic female state of the Temple of Diana, the High Priestess bestows the golden bow of power upon the newly elected Queen of the Amazons, danced by Rogge. In the
second act the Amazons encounter intruding Greeks, led by Achilles. A great battle ensues, with the outcome decided in a duel between the Queen
GROUP DANCING 281
and Achilles. The Queen wins, and the Greeks become prisoners of the Amazons. In the final act, the Amazons celebrate the festival of roses, the culmination of which entails the marriage of the Queen to Achilles, with whom she has fallen passionately in love. But Amazon law forbids female desire for the male, and the High Priestess demands that the Queen return
the bow. When the Queen resists and declares her intention to crown Achilles king, the High Priestess stabs her, and she dies in the arms of her beloved. All the women vacate the scene, leaving “men as the future rulers of the new state.”
Rogge’s productions established a powerful intersection of erotic desires and aggressive drives. But in Kleist’s tragedy Penthesilea mistakenly kills Achilles, then literally dies of a broken heart; in Rogge’s work, threats
to the authority of the female community came from women themselves (the High Priestess), not from men. The choric movement was monumentally ritualistic, making extensive use of march patterns and rhythms, salut-
ing gestures, and tensions between sinking obedience and triumphant invocation, with mass movements occasionally interrupted by grandiose solos (bow dance) and duets (Achilles/Queen duel) (Figure 61). The dancers wore sleek, art deco versions of Hellenic costumes, with male warriors, in armor, strongly differentiated from the more lightly clad female
warriors. Except for the sacred bow, Rogge declined to use any shields,
spears, or swords, preferring, apparently, to suggest martial prowess entirely through bodily gesture, although she claimed to seek a “realistic” image of antiquity (PS 87). Rogge risked a great deal of money on the production, but Amazonen proved enormously popular in the Third Reich, impressing high-level officials at the Berlin dance festival of 1935. As Meyer-Rogge remarked: “The tragedy of community differs from the tragedy of the individual in that it places the hero as the basis for action in the people, that is, it identifies the hero with a necessary moral ideal,” which reinforces unity of identity rather than accommodates difference (PS 86). However, Rogge’s enthusiasm for classical antiquity dated back to her school days, when she wrote papers on excavations at Pompeii, using books in her parents’ library (17), and it is
doubtful that she paid much attention to Nazi ideology in shaping her dance drama. After performing Amazonen in several occupied countries during the war, she was able to revive it with equal suecess in 1947 and again in the 1950s.
Her next major work, the four-part Mddcheninsel (1939), also featured music by Handel and explored much the same domain as Amazonen. It functioned as the second part of a trilogy that was to have concluded with a great dance drama about the Trojan War (however, the outbreak of the real European war prevented this from materializing). Meyer-Rogge’s scenario depicted the evolution of Achilles into a warrior. The first scene
282 GROUP DANCING shows the birth of Achilles to Thetis and Peleus. The oracle prophesies that Achilles will lead a short, glorious life or a long, peaceful but unremarkable existence, and Thetis must choose his fate. When representatives of the underworld arrive with gifts of helmets, shields, and swords, Thetis determines that Achilles shall not follow the life of a warrior. So he grows up on an island of girls, wearing girl’s clothes and playing girl games. (Rogge herself danced the role of Achilles.) In one game the girls blindfold him, but suddenly a group of Greek warriors appears, bearing shields with doves imprinted on them. The girls flee, leaving Achilles alone; when a soldier removes the blindfold, Achilles sees the warriors and shields, becomes aroused by their dark challenge to him, and begins to test his martial prowess in a powerful combat duet with shields between himself and another soldier. He displays superior instincts as a warrior, and the soldiers express their admiration by bestowing the famous armor on him and
lifting him up onto their shields. The women then return to the scene, shifting their allegiance from Thetis to Achilles, who boards the ship for Troy and a glorious doom. As in Amazonen, Rogge relied here on choric movement patterns to sus-
tain dramatic interest, with groups deployed in circles, friezelike rows, squares, and phalanxes: “The choric movements occurred chiefly through striding marches or feathery, skipping runs with raised arm gestures” (110). Not surprisingly, the Nazi-controlled press bestowed lavish praise upon the work, but Rogge herself saw nothing distinctly fascist in her production, which she viewed as an account of a figure moved by an “inner necessity,” destiny, rather than will (109). But this explanation was peculiarly ironic
from a woman for whom group dance was, as Stockemann repeatedly asserts, the expression of an “iron will.” In any case, she had no trouble reviving the dance after the war.
The war itself no more disturbed her “will” than had the political upheavals of the previous twenty years. Following the surrender, she became prodigiously active in restoring vitality to the Hamburg cultural scene and in establishing the prominence of her school within that scene. At the same time, she raised four children. She produced two more large dance dramas, Vita Nostra (1950) and Neue Liubecker Totentanz (1956), but in these works she turned for inspiration to images from the late Middle Ages rather than from classical antiquity. In both of these productions, the medieval image
of Death (a skeleton painted onto the body stocking of a male dancer) became the power driving and defining the identity of the group. In these later works it became evident that for Rogge the will, as manifested through leadership and control over groups, was synonymous with a desire to face death, a determination to test the strength of the inevitable. Dance drama was for Rogge the ideal medium for establishing the body (rather than the State) as the decisive site of conflict between the will and the inevitable. She
GROUP DANCING — 283
came from a deeply respected, almost puritanical, patrician family governed by an ambitious ideal of civic honor and dignity. This sense of honor she brought to dance in perhaps greater degree than any other dance personality of the Weimar era. Yet her art was not without ambiguities in its images of a will, of a body, of entire groups seemingly “undetermined” by the great political turbulence of the times in which they lived.
Theatre Dancing
Though Jooss and Rogge obviously saw Ausdruckstanz as moving toward an
ultimate identity as dance-theatre, the relation between dance and theatre in the Weimar Republic was in reality a power struggle in which modern dance attempted to appropriate some of the terrain occupied by the established, subsidized institutions for opera, ballet, and literary drama. The attempt succeeded for the most part, but the reason for the appropriation was as much economic as aesthetic. The institutionalization of Ausdruckstanz occurred in three large phases. In the first phase (1910-1923), dance established its expressive power and credibility through solo concerts, which revealed the authority of dance to construct distinct artistic personalities. The second phase (1924-1929), marked by the opening of an amazing number of schools, witnessed the expansion of dance as a field of study. But by 1929 it was no longer possible for the schools themselves to provide careers for all their graduates. Moreover, the public had now seen a great deal of dance, and talented dance artists (rather than teachers) believed that, if they were to sustain the interest of audiences, they needed access to greater resources and virtuosity than the schools could offer. Thus, the third phase (1930-1935) entailed a self-conscious competition for subsidized positions within the huge network of publicly funded theatres throughout the nation. The program actually was well underway before 1930, with Laban and Wigman students being especially aggressive in obtaining the-
atrical positions as choreographers: Olga Brandt-Knack in Hamburg (1922), Skoronel in Oberhausen (1924), Jooss and then Jens Keith in Mun-
ster (1924-1925), Georgi in Gera (1925), Max Terpis in Berlin (1924), Anne Grunert in Duisberg (1925), Edith Bielefeld in Karlsruhe (1926), Gunther Hess (1903-1979) in Hagen (1925), Lizzie Maudrick in Berlin (1928), Claire Eckstein in Darmstadt (1928), Ellen von Frankenberg in Aachen (1927), Manda van Kreibig in Darmstadt (1925), Ruth Loeser in 284
THEATRE DANCING 285
Dusseldorf (1929), and Laban himself in Mannheim (1922) and Berlin (1930). HEINRICH KROLLER AND ELLEN PETZ
In spite of the invading action of these and other personalities, the history of Ausdruckstanz in the theatre remains obscure and almost absurdly underdocumented. Even the history of German ballet during these years is seldom anything more than a listing of names and titles (e.g., Erben), despite the fact that Germany officially possessed the largest system of ballet companies in the world. Yet ballet might just as well have not existed at all, so powerful was the hold of Ausdruckstanz on the dance imagination of the time. Powerfully influential dance critics such as Brandenburg, Bohme, Giese, Fischer, Lammel, and Suhr tended to regard ballet as a dead and distinctly “un-German” art, and it is still something of a mystery as to why the Germans insisted on subsidizing a mode of dance in which they consistently failed to achieve any international or even national distinction. Gifted ballet dancers were hardly lacking, but imaginative choreographers trained in Paris, Italy, or Copenhagen definitely were. Curiously, the whole strategy of Ausdruckstanz to take over the ballet companies depended on a reconciliation between modern dance and ballet, with the schools making strenuous efforts to incorporate ballet technique into the curriculum. The ballet world remained quaintly insulated from the storm of body consciousness that had swept over Central Europe even before World War I. Traditionalists acted as if modern dance advocates were hysterically unreasonable in asserting that ballet’s rigid regulation of bodily expressivity emerged from a deeper—and darkly ideological—anxiety toward both modernity and the signifying power of the body. An exception was Heinrich Kroller (1880-1930), ballet director in Frankfurt (1915), Munich (1917-
1930), Berlin (1919-1922), and Vienna (1922-1928). He openly promoted the idea that ballet and Ausdruckstanz could evolve only in relation to
each other, rather than independently, and his susceptibility to at least a modern look on the ballet stage brought him invitations to choreograph in Prague, Stockholm, and Italy (see Mlakar). During World War I, in Munich, he apparently won admiration for his refusal to subordinate group movement to star solos and for his determination to make ballet an art form that conveyed serious meaning rather than a mere display of physical virtuosity (Vettermann, 217). But much more information about his work must surface before a strong statement about his significance can appear. He scored
an enormous hit in Berlin in 1921 with his version of Richard Strauss’s Josephs Legende (Suhr, Tanzerin); Strauss himself was so impressed that he persuaded Krdller to give up his duties in Berlin and direct the ballet of the Vienna State Opera.
286 THEATRE DANCING
Kroller collaborated with Strauss on further successes, including Couperin Suite (1923) and Schlagobers (1924), but he was anything but happy in Vienna. Reactionary elements within the opera, supported in part by con-
ductor Franz Schalk, persistently undermined his efforts to introduce some of the more modernistic (Stravinsky) productions of the Ballets Russes, let alone strategies affiliated with Ausdruckstanz. Munich was much more hospitable. There he choreographed bold productions of the Bartok-Balazs Wooden Prince (1924), the Krenek-Balazs Mammon (1927), and John Alden Carpenter’s Skyscrapers (1927). But these were “bold” in large part because of their expressionistic or constructivist set designs. It remains unclear how modern Kroller was in his conception of group dynamics or bodily movement, though he freely acknowledged his interest in Laban’s ideas about movement choirs. In Mammon, for example, he included a most intriguing image of a graceful huddle of women in conventional ballet slippers and
tutus menaced by a phalanx of masked, pointing, caped demonic men, while another, smaller group of dwarfish, servile humans crept between these two groups. It therefore seems possible that Kroller created compelling dance theatre by self-consciously making the tension between ballet and the movement choir a dramatic feature of the performance itself. Another puzzling figure from the world of ballet was the mysterious Ellen Petz (aka Ellen von Cleve-Petz). She studied ballet in Berlin, Budapest, and
London, with an interlude at the Mensendieck school in Berlin, and this international education allowed her aesthetic to exude an aura of cosmopolitan refinement, her dancers being “representatives of real aristocratic art,” according to a clipping from the Leipziger Tageblatt (13 August 1921). As early as 1917, she attracted attention for her taste in luxurious costumes and for her darkly glamorous Amazon solo dance (Torok 11). In 1919 she formed the Petz-Kainer Ballet with the expressionist artist Ludwig Kainer, who designed the decor for her productions. In the early 1920s she toured numerous cities in Germany, as well as Budapest and Vienna, with a corps of six female dancers. Kainer’s decor introduced Caligariesque distortions of scenic context that were otherwise lacking in ballet culture, and
Petz contributed innovative, worldly scenarios, as in Triumph der Mode (1920), which depicted the “liberation of Queen Fashion through the tempestuous Prince Fantasy” (Elegante Welt, 9/5, 3 March 1920, 7). She moved into more darkly decorative moods with Ezfersucht (1921), Phantom (1921), Sklavin Reich (1922), Groteske (1922), and Hiawatha (1923). Petz apparently
liked to keep her dancers on pointe, but she did not have enough performers to stage full-length ballets. So in her concerts she presented several small, entirely original stories (no adaptations) in quite idiosyncratic settings. She always subordinated the display of virtuosity to the necessity of telling a strange story.
THEATRE DANCING 287
But she soon wearied of running a private company and accepted the position of ballet mistress at Dresden. With more than twenty dancers at her disposal, she produced the opulent Die Elixiere des Teufels (1925), with music by Jaap Kool and almost lascivious Oriental costumes. Then she attempted a “dance symphony” (1925, music: Resznicek). Even more intriguing was her Spielzeug (1928), an abridged version of Tchaikovsky’s Nutcracker using emphatically geometrized Bauhaus set designs by Oskar Schlemmer (DS 181-183, 325). At Dresden she made Helge PetersPawlinin her partner, and in 1929, in Brussels, they produced an even more unusual dance experiment, La Masque de cuir. This production employed as
decor the projection of scenes from movies starring Ronald Colman and Vilma Banky, who were popular screen lovers between 1926 and 1928. Petz and Pawlinin apparently performed solo/duet dance commentaries on the
screen lovers to the accompaniment of music by Mozart (Colman) and Brahms (Banky) (“Ellen Petz”). In subsequent years, Petz’s already shrouded career became maddeningly obscure. She resurfaced in 1938, when Queen Elena of Italy and Ethiopia invited her to present dances with a vaguely medieval aura in Rome, but by then her decorative blurring of differences between ballet and Ausdruckstanz had led to work about which one must locate still hidden sources of information. THEORETICAL POSITIONS As the careers of Kroller and Petz indicate those who attempted to integrate
ballet and Ausdruckstanz developed vague artistic identities, and their impact was considerably less obvious or even noticeable than that of the hard-core expressionist dancers. Sull, by 1929 the appropriation of ballet
seemed a necessary facet of modern dance’s appropriation of theatre. Moreover, appropriation entailed more than approval of ballet’s rigid regulation of bodily expressivity through the classical on pointe “positions”—it
entailed the assumption that a greater expressive power for dance depended on its success in constructing sustained, comprehensible narratives of sufficient complexity to test the capacity of the spectator to read kinetic signs. In short, the appropriation of ballet and theatre implied a devaluation of the abstraction and montage aesthetics defining the domain of Ausdruckstanz.
Naturally, these aesthetic implications, driven by economic objectives, led to interesting theoretical controversies. As early as 1922, Hans W. Fischer argued that expressionist dance created its own forms of narrative, forms that, because they focused perception on the body rather than on costume or on “objective” systems of movement, were not pantomimic
(“Tanztraum”). But this argument did not explain how modern dance
288 THEATRE DANCING should appropriate established theatrical institutions if the institutionalization of dance depended on narrative values defined largely by ballet. By contrast, in Das ekstatische Theater (1924), Felix Emmel asserted that contemporary literary drama required a new mode of performance in which speech and gesture emerged out of “rhythms of destiny,” an “ecstasy of the blood” achieved by bringing acting and directing closer to dance and choreographic design, as in his own production of Der Bogen des Odysseus (1922)
in Weimar (30-33). However, at the Munich Dance Congress in 1930, Emmel declared that in the literary theatre dance must serve the aim of the text and come from within it rather than, as in the work of the Russian directors Meyerhold and Tairov, being imposed upon it. Thus, the incorporation of dance into the literary theatre would require dramatists to write plays embodying a strong dance consciousness (“Tanz und Schauspiel”). Gustav Grund, a lay movement choir director for youth groups in Hamburg, took almost the opposite position: in both the literary theatre and the opera, the written text functioned as music that motivated bodily movement. Dance was not an illustration of the words nor a pantomimic representation of the word referents; rather, it was a kind of dramatic commentary on the words,
often in tension with them, and therefore did not depend on either the author or the text for its inclusion in performance (Die vierte Wand, No. 3, 1927, 7-10).
At the Magdeburg Dance Congress of 1927, Hans Brandenburg explained that dance was the “primal cell of all theatre” and that both dance and theatre should strive toward a common goal or aesthetic identity. He insisted that modern dance not only had every right to move from the concert podiums to its own deserved zone of the subsidized theatres but even
should constitute an expected element of all literary theatre (“Tanz und Theater”). Gertrud Bodenwieser in Vienna adopted a more practical attitude. She hardly believed that dance and drama could form a single, unified art form, for the difference between the choreographic and literary imaginations was far greater than nonpractitioners supposed. But because choreographic imagination was as significant for performance as literary imagination, she displayed no hesitation about inserting dances into plays, even where they were not intended, a strategy rejected by Emmel in his 1930 Statement (see Stefan 58-59). In Tanzkunst (1926), Fritz Bohme grasped that modern dance had transformed relations between body, movement, and space to such an extent that the subsidized theatre could no longer accommodate it; modern dance required a new architecture altogether. The further evolution of Ausdruckstanz depended on freeing it from conventional ideas of a stage and situating it within radically different architectural forms so that the visual dimension of performance no longer remained confined within the picture frame of a proscenium (198-207). Laban had already expressed this sentiment
THEATRE DANCING 289 with his proposal for a Gothic, cupola “dance temple” (Die Schénheit, 22/1, 1926, 2-4; 43-48). But by 1928 it was obvious that new theatre architecture of any sort, let alone specifically for dance, would not appear soon in the Weimar Republic; dance would have to content itself with appropriating a prewar notion of performance space, which implied some form of reconciliation with ballet. At the Essen Dance Congress of 1928, Kurt Jooss offered a distinction between Tanztheater and Theatertanz. Theatertanz referred to dance as an element contained within a larger dramatic narrative, such as Salome’s dance in Oscar Wilde’s play. Tanztheater involved drama created entirely out of and for dance, and it was the strongest basis for dance’s appro-
priation of theatre. Thus, dance theatre, as defined by Ausdruckstanz, entailed new forms of danced narrative (scenarios and themes) rather than new relations between the body and space or even new methods of dancing. In another argument, Fred Hildenbrandt claimed that the institutionalization of the modern dance impulse actually meant the appropriation of the acrobatic dancing found in cabarets and revues and of contemporary social dance forms—a not altogether eccentric idea, but one that hardly resonated in the world of “serious” modern dance (Der Scheinwerfer, 11/12, March 1928, 24-26). Yet another view came from Rudolf Kolling, first solo dancer of the Berlin State Opera, who contended that as a member of a ballet corps, a dancer had to cultivate a much more complex consciousness of theatrical context than prevailed in modern dance: the dancer had to calculate every bodily movement in relation to every detail of costume, lighting, decor, music, ensemble, and special effect. The ballet dancer worked under much greater pressure than did dancers in the school companies, for “as an opera dancer, one must think of a thousand things, must overcome constraints, master obstacles. Only in this way will we succeed in conquering the theatre” (Die Schallkiste, 3/9, September 1928, 7-8). The influence of Dalcroze no doubt contributed to many dancers’ hesitation to “conquer” the theatre. He denounced the pathological effects on the body caused by the exorbitant demands of theatrical dance, especially ballet. Nevertheless, the Hellerau-Laxenburg school, guided by Valeria Kratina (1892-1983), developed its own form of dance theatre favoring open-air productions of dance dramas on themes of classical mythology cherished by Dalcroze himself—although in 1923 Kratina did stage the German premiere of Bartok’s The Wooden Prince (Chladek, 54-59). In the late 1920s she choreographed the Laxenburg dancers in open-air dance versions of Greek tragedies in the amphitheatre at Syracuse, Sicily. Then, in 1930, she accepted appointment as ballet mistress in Breslau and Karlsruhe (1933-1937), later shifting to Dresden (1938-1944). But in her case, too, a serious assessment of her significance depends on the excavation of some substantial information about her work. Like Lola Rogge, she apparently sought to create a monumental image of classical culture that was free of
290 THEATRE DANCING both ballet classicism and the excessively feminized Grecian ideal of improvised “naturalness” promoted by Isadora Duncan. Kratina’s work suggested
that dance theatre became institutionalized as Ausdruckstanz when it evolved independently of the state theatres, even if she herself eventually moved on to official positions. Wigman perhaps believed even more strongly in this position. No doubt the political intrigues that prevented her from receiving the ballet mistress position in Dresden in 1920 contributed to her distrust of the official theatres and of dance theatre itself, for her concept of the group was probably too cultic to flourish within the complex political apparatus of a state theatre. She did choreograph dances for Hans Pfitzner’s opera Die Rose von Liebesgarten (1921) in Hannover and for a Dresden production of A Midsummer Night's Dream (1922), but obviously she saw no future in this sort of
work. By 1929 she had disbanded her own school group because she felt she had reached an impasse with regard to further development of expressionist group dancing. She tried to resolve the crisis by producing one of the largest and most complex group pieces of the century, the controversial Totenmal (1930), which enjoyed an unprecedented run of ten weeks in Munich following its premiere at the Dance Congress. The production entailed an elaborate intersection of personnel and logistical support from a variety of organizations, as well as a stadiumlike performance space. But if
Totenmal represented the future of expressionist dance theatre, one could not expect the state theatre system to supply the resources for it without introducing a radical change in production practices, and subsequently no one, including Wigman, attempted an ensemble production of similar scale or complexity. At the Essen Dance Congress of 1928, she gave a lengthy statement in which she argued that the aims and working methods of expres-
sionist dancing and theatre dancing were so different that expressionist dance could “conquer” the theatre only through a radical revision of what theatre is: “We want not only dance in the theatre, but a rhythmically pro-
pelled and propelling theatre” (MS 77-82). In practice, she meant that expressionist dance theatre had to create its own institutions rather than try to fit into the prewar system, a strategy that was not convincing for some of her own brightest students, including Yvonne Georgi, Darja Collin, and Max Terpis, who accepted the necessity of accommodating ballet technique. However, Margarethe Wallmann (b. 1904), director of the prosperous Wigman school in Berlin since 1927, attempted to reinforce the complex
mode of production for Totenmal. In 1930, in Berlin, she produced the hugely successful (or, at least, far less controversial) Orfeus Dionysos (music:
Gluck), a vast and violent dance drama with a scenario by Felix Emmel. It
employed an enormous corps of dancers and musicians (including Ted Shawn, Hans Weidt, and Mila Cirul) recruited from a variety of sources; Wallman herself danced the part of Euridice. The piece contained no con-
THEATRE DANCING 291
cessions to ballet technique, even though Wallmann had studied ballet in her native Vienna, but her choreography for the savage tribe of female Furies was so complicated that she required many more rehearsals than a regular full-length ballet. Her group movements avoided synchronized or unison effects and involved convoluted configurations that individualized each dancer, creating a very turbulent image of an ecstatic community in violent contrast to the almost stately composure of the ecstatic couple (see Mueller, “3. Deutscher,” 23). For Wallmann, the ecstatic couple was an illusion destroyed by the ecstatic community of Furies, with communal ecstasy reaching its peak in mass violence, in the tearing apart of Orfeus. Wallmann continued her complex, large-scale group choreography in another violent “mystery play,” Das jungste Gericht (1931, music: Handel), which premiered at the Salzburg Festival, where she was an annual par-
ticipant during the 1930s (Figure 62). Here she situated her apocalyptic vision in a vaguely biblical context inhabited by allegorical figures such as the Rich Youth, the Poor Girl, the Spirit of Darkness, the Activist. The suc-
cess of this piece urged her to break with Wigman, from whom she had already become somewhat distanced after a difficult experience teaching
the Wigman doctrine at the Denishawn school in the United States 1928-1931). With the advent of the Third Reich, Wallmann, who was Jew-
ish, returned to Vienna, where she became ballet mistress of the Vienna State Opera and director of its ballet school. Though she devised intriguing, original ballet scenarios such as Fanny Elssler (1934) and Der liebe Augustin (1936), her work became distinctly less intriguing than it had been before 1933. In 1939 she migrated to Buenos Aires, where she directed operas at
the Teatro Colon, a task she pursued after the war in Rome and Milan, where she still lives.
CLAIRE ECKSTEIN
Another Wigman student who did remarkable work in the theatre was Claire Eckstein (1904-1994). In Munich she met the gifted scenic designer Wilhelm Reinking, whom she soon married, and he recommended her to Heinrich Strohm, director of the opera theatre in Wurzburg. Impressed with her extravagant sense of humor, Strohm hired her to choreograph Hindemith’s ballet Der Damon (1926), then Kool’s Der Leierkasten (1927) and Rimsky Korsakoff’s Scheherazade (1927), for which Reinking did the scenery. Along with stage director Arthur Maria Rabenalt, Eckstein and Reinking moved to Darmstadt, where from 1927 to 1931 Eckstein, in addition to her usual duties for the opera and operetta, staged several comic ballets with a distinctive modernist ambience: Massarani’s Der arme Guerino (1928), Milhaud’s Le boeuf sur le toit (1928), Satie’s Parade (1929), Schmitt’s
Ein hoher Beamter (1930), and two ballets for which she herself composed
2092 THEATRE DANCING
the music: Sozrée (1930) and Die Gestrandeten (1930). During these years, American dancer Edwin Denby (1903-1983) was her partner-collaborator. However, in 1930 the Berlin Kroll Opera invited Reinking to design The Barber of Seville, and this opportunity led to others for him in the city. Eckstein brought several of her Darmstadt pieces to Berlin (1931), but these did not open up possibilities for her in a theatre culture suffering from severe aus-
terity measures. She and Reinking divorced the same year. In 1933 she danced in Berlin cabaret productions of Werner Finck and Erika Mann, but she did not return to choreography until 1942, when she arranged dances for Helmut Kautner’s film Anuschka, shot in Rome and Prague. Her final
choreographies were for two musical films directed by Rabenalt in Yugoslavia in 1954 and 1955. According to Reinking, she could “no longer open herself up without her partner Denby” (176). But what did Denby—
or, more accurately, what did the peculiar collaborative environment in _ Wurzburg and Darmstadt, with Reinking and Rabenalt—bring out in her? “She had the gift of being able to observe the movements of people and to arrange these observations into dance-like gestures, in which the bearing and character of these observed persons became strikingly revealed in a lightly caricatured or at least exaggerated form” (63). It sounds as if she was close to Kurt Jooss in her aesthetic. However, Jooss
never achieved the comic intensity that Eckstein brought to grotesque dance, though his caricaturizations of ordinary movements often carried him into the realm of the grotesque. Eckstein caricatured idiosyncratic movements of persons rather than of social classes or of socially conditioned modes of gesture. She exposed the absurdities of individual rather than social identity and therefore also exposed the power of dance to treat social norms as sources of humor rather than anxiety. Moreover, having a
designer for a husband, she relied much more than Jooss on complex scenic effects to construct comic perceptions. In Oben und unten, Reinking’s
set depicted a building under construction; the construction workers (in blackface) moved on the stage, on the ramp leading to the second story of the building, and on the second story, handling boards, buckets, and building tools. Die Gestrandeten featured a bizarre collection of dancers stranded on a desert island, where they perched on small tables, lounged on pillows of “sand” under a palm tree, sewed, fixed meals, and prayed before an altar. The stage thus became fragmented into idiosyncratic zones defined by ind1vidual dancers and their props. Neues vom Tage (1929), an opera by Hindemith, was set in the headquarters of a newspaper, with dancers in business suits working at copy desks before a three-story edifice containing rows of cubicles and workers (Rabenalt 441). Offenbach’s Die schone Galatee (1929) showed dancers impersonating mannequins in display windows. Eckstein
obviously delighted in pieces that used complicated or not particularly danceable costumes; in Soirée, for example, the performers wore elaborate
THEATRE DANCING 293 formal garb of the 1890s. She constantly played with Denby’s image by outfitting him in wigs, eccentric makeup, extravagant paddings, and whimsical accessories such as a monocle. Probably no other choreographer of the era was as fond of dances in which dancers wore heeled shoes or laced boots.
Many of her dancers were actors, and she sometimes incorporated their voices into her works to create a “sort of sound painting, as if one heard the members of a grand society all speaking and perhaps the ladies laughing
but cannot understand any individual” (Reinking 108). It was therefore through the curious movements of the body that individuality revealed itself.
But Eckstein, though entirely theatrical in her attitude toward dance, had little interest in subordinating dance to narrative. She constructed her
ballets out of material she had already used for dances in operas and operettas, and her dances for the musical stage seldom had any connection with the libretto story. Reinking suggested that her dances were not ballets at all but “little theatre pieces,” in which actions and relations between bod-
| ies unfolded in strange fragments and the climax resulted from the accumulation of idiosyncratic effects rather than from the resolution of an intensifying conflict. Yet Berlin theatre critic Herbert Ihering observed that her dances were “in no way abstract, but immediately, directly critical” in a way that was quite remote from the aesthetic of her teacher, Wigman. In performance, Eckstein exuded an exquisitely radiant smile, a luscious, lavish pleasure in masquerade. LABAN IN THE THEATRE
Laban’s contribution to theatre dance was much more ambiguous than Eckstein’s, partly because of his own uncertainty regarding his aims in appropriating the theatre. His perception of group dynamics was shaped by his work with lay movement choirs, which offered all sorts of opportunities to introduce convoluted rhythmic patterns and bodily entanglements. Moreover, movement choirs, with their partially gymnastic foundation, seemed to function best when they appropriated almost any space except the theatre. Laban was more at home in meadows and groves than on the stage. Nevertheless, serious validation of his grandiose ambitions depended on his success in gaining a critical audience among established theatre circles. He therefore devoted much energy to the production of large-scale dance dramas for conventional theatres. In these works he sought to affirm the credibility of his “runic” ideas about bodily movement and to present the move-
ment choir aesthetic as an alternative to ballet in forming a modern concept of group dynamics in dance. Laban’s work for the theatre hardly
lacked ambition, but its impact on both dance and theatre remained obscure, and it is difficult to find insightful documentation for any of his
294 THEATRE DANCING
dance dramas. During the 1920s, his group choreographies for conventional theatres in Stuttgart, Mannheim, and Hamburg were largely staged by a student unit, Tanzbuhne Laban; productions included Himmel und Erde (1921), Die Geblendete (1921), Faust IT (1922), Der schwingende Tempel (1923), Gaukelei (1923), Agamemnons Tod (1924), Dammernde Rhythmen
(1924), Don Juan (1925), Terpsichore (1925), Narrenspiegel (1926), Die gebrochene Linie (1927), Ritterballett (1927), and Titan (1928). These works, originated not in the theatre but in the school, and Laban took them to var-
ious venues, such as, in Hamburg, the Conventgarten, the Deutsches Schauspielhaus, the Circus Busch, and the Schiller Opera. As ballet director in Hamburg (1923-1925), he blurred the distinction between theatre and school, but the blurring in itself suggested considerable ambivalence about grounding a dance aesthetic within the theatre.
As a choreographer, Laban apparently was innovative without being especially imaginative, guided more by theory than artistic insight. He conducted daring experiments but was reluctant to follow up on them with any tenacity. In Ritterballet (music: Beethoven), for example, he puta large num-
ber of dancers in vaguely medieval costumes with intricate, emblematic black-and-white motifs; when the dancers moved they created a strange kinetic mosaic or jigsaw puzzle, an extravagantly abstract design that nevertheless retained an archaic aura. In Die Nacht (1927, music: Kahn), the men wore fezzes, tuxedos, and tights, the women fezzes, eccentric tutus, or skirts
with aprons. Movement appeared calculated to produce striking effects through different combinations of costume motifs; design did not evolve in response to an independent movement scheme. But this approach actually resulted in highly complicated movement patterns that subordinated narrative clarity to abstract relations between body, time, and space. In Drachentoteret (1924), the dancers wore costumes faintly reminiscent of fairy-tale Orientalism, but the movements, judging from still photos, were extravagantly, expressionistically angular. For Laban, modernity did not imply an image of contemporary society, even if the movements he employed sprang completely from the time in which he lived; rather, he sought an image of modernity that was ahistorical or, as in his Gothic projects, polyhistorical in the decorative context for bodily movement, with costumes and scenes in which signs of different historical eras intersected. Yet Laban’s choreography often lacked narrative or dramatic drive. In reviews (on deposit in the Leipzig dance archive) of Laban’s work as ballet
director for the Berlin State Opera (1930-1934), Fritz Bohme observed that Laban’s choreography lacked “musicality” and expressive power. Laban apparently had difficulty shaping his material and building emotional struc-
tures for his pieces, and his productions suffered from prolixity, from a sense of squandered energy that set up grandiose expectations the work could not sustain. Don Juan (1925, music: Gluck), with Laban himself as the
THEATRE DANCING 2905
seductive hero, was three hours long, contained numerous intriguing tableaux, and enjoyed performances in numerous cities; however, the piece failed to move audiences with near the efficiency of innumerable smaller works produced by dancers who had access to far fewer resources. Indeed, the discourse provoked by Don Juan seemed almost entirely focused on its scale. In spite of his difficulty in telling a story, Laban believed that a dance theatre built around Ausdruckstanz depended on devising original scenarios. However, those of his students who accepted theatre appointments found themselves charged with maintaining a repertoire defined and associated with ballet.
OTHER THEATRE CHOREOGRAPHERS
Lizzie Maudrik (1898-1955), ballet director at the Berlin Municipal Opera (1926-1934) and then the German State Opera (1934-1945), studied bal-
let under Michel Fokine (1880-1942) in Paris before becoming one of Laban’s adepts. At the Municipal Opera she encouraged her large ensemble to adopt techniques of expressionist dance, and she guided a ballet corps composed of many dancers with modern dance backgrounds, including Julia Marcus, Jens Keith, Ruth Abramowitsch, George Groke, and Alice Uhlen. But in a 1929 article she firmly declared that an opera house dance corps must always remain subordinate to theatrical objectives and that the opera house was no place for the cultivation of “abstract” or “absolute” dance (MS 43). Thus, her ambition was to apply expressionist dance techniques to the performance of standard works from the ballet repertoire, as in her immensely successful 1930 version of Delibes’ Coppelia (1870), in which Julia Marcus danced the role of the mayor and Alice Uhlen that of the doll Coppelia. Later, at the State Opera, Maudrik devised ballets with national-historical themes, such as the rococo Die Barbarina (1935) and Bauerischer Tanze (1935), which continued to incorporate expressionist attitudes toward bodily movement. But, as with Kroller, much more evidence of her work needs to surface before a satisfactory understanding of her significance is possible.
The same is true of two other Laban-educated ballet directors: Olga Brandt-Knack (1885-1978) in Hamburg (1926-1932) and Ruth Loeser in Dusseldorf (1929-1933). Virtually all of Brandt-Knack’s choreography was
for mainstream opera production, but she put on concerts consisting of dances from seven or eight operas. These concerts, definitely in a modernist vein, had the effect of establishing her opera dances as independent entities, a view not pursued by Maudrik, who always saw dance in relation to a total, theatrical-narrative context. In Dusseldorf, Loeser presided over a corps of eight to thirteen dancers (including one male) presenting old or classical forms of dance in a sardonically modern style. For example, Suite [
296 THEATRE DANCING
und II (1930), with music by Stravinsky, consisted of several old dance forms: gavotte, Neapolitan, flamenco, balalaika, march, waltz, polka, gallop. But the dancers wore cocktail dresses, with some of the women impersonating men in tuxedos. Scenery was virtually absent from the bare stage, so
perception focused entirely on the tension between old dance steps and modern bodily inflections or distortions. No conventional narrative logic linked one dance to the next; rather, an abstract emotional logic governed the piece, making it closer to a theoretical-critical essay than to a story. However, evidence of Loeser’s achievements is even more recessed than that of
other theatre choreographers. She, like Brandt-Knack, lost her position because of her left-wing affiliations, not because she repudiated narrative in dance or incorporated modern dance techniques. Maudrik, who prospered during the Third Reich, remained devoted to the authority of narrative but consistently maintained in print that ballet
had no serious significance independent of modern dance techniques, even though the Nazis aggressively promoted the necessity of establishing a “German” idea of ballet at the expense of modern dance. Nazi cultural policy favored ballet because ballet was already so rigorously institutionalized
in the theatre: it was easier to administer, to regulate, and to standardize than modern dance. Once ballet had come to dominate dance culture, the government exerted complete control over the destinies of dancers. Despite the lack of any serious understanding of dance by members of the Nazi hierarchy, dance in the Third Reich managed to achieve some distinction, for it was during this time that Ilse Meudtner, Oda Schottmuller, Marianne Vogelsang, Dore Hoyer, Afrika Doering, Lola Rogge, Maja Lex, Alexander von Swaine, and Helge Peters-Pawlinin established their artistic identities. Of course, these personalities worked independently of the sub-
sidized theatres. One of the most impressive ballet talents of the 1930s, Aurel von Milloss (b. 1906), studied ballet in Budapest and Italy before attending the Laban school run by Hertha Feist in Berlin. In 1928 his relation to Feist ended sadly (for her) when he accepted an invitation from Max Terpis to dance at the Berlin State Opera. Though he gave his first solo concert at the Sturm Gallery in Berlin in 1928, it was not until 1932 in Breslau that he presented his first choreographed ballet, H.M.S. Royal Oak, with jazz music by Schulhof. Then his star rose. He became ballet master in Hagen, Duisburg, Augsburg, and then (1934-1935) Dusseldorf, accepting assignments in Budapest and Italy during this period. He was immensely prolific, probably staging more ballets, theatre dances, opera dances, and operetta dances in more theatres than any other figure of the 1930s and 1940s. He
favored the modernist music of such composers as Stravinsky, Bartok, Kodaly, Roussel, Honegger, Milhaud, Strauss, and Prokofiev, and he enjoyed working on scenic designs with such modernist painters as De Chirico, Prampolini, Casorati, Severini, and Cassandre. In 1936, Milloss
THEATRE DANCING 297
accepted appointment as ballet master in Budapest and stayed until 1938, when he moved to Rome, which became his home for the remainder of his long and prodigious career (Taui). His art lacked an innovative dimension,
but he brought a sumptuous elegance to his productions, and through grand production values he restored vitality to the depleted classical ballet scene. Yet the heralded ballet culture of the Third Reich apparently offered inadequate scope for his ambitions. MAX TERPIS
Perhaps the most troubled of the theatre choreographers in Germany during the 1920s was actually a Swiss, Max Terpis (aka Max Pfister, 1889-1958).
Originally a student of architecture, he encountered Laban in Stuttgart (1920) and took classes from Laban’s protégé in Zurich, Suzanne Perrottet, who urged him to study under Wigman in Dresden. He spent only a single year (1922) with Wigman. Though Terpis came to dance relatively late in his life, no one soared to such national prominence with greater speed. His
talent for group movement immediately attracted the attention of Hannover theatre director Hanns Niedecken-Gebhard, who hired him to choreograph Der Tanzer unser lieben Frau (1923, music: Sturmer), Die Nachtlichen (1923, music: Wellesz), and Der fliegende Prinz (1923, music: Paumgarten). Terpis danced the lead role in his own version of Richard Strauss’s Josephs Legende (1923). His only solo concert, given in Hannover in 1924, featured
no musical accompaniment and was a collaborative affair involving solo dances by Kreutzberg, Frida Holst, and Else Rudiger. The Hannover choreographies brought him to the attention of Max von Schillings, director of the Berlin State Opera, who sought to reform the ballet corps, which numbered nearly a hundred dancers yet failed to achieve anything resembling the seriousness of purpose that Kroller had attempted to provide it in 1919-1922. Terpis held the State Opera position for six years, but his life there was a nightmare of political intrigue and reactionary efforts to undermine his reforms and authority. He produced nineteen ballets at the State Opera, nearly all of which used music by living modernist composers, including Kool, Stravinsky, Komme, Wilckens, de Falla, Schreker, Prokofiev, Klenau, Benatzky, and Milhaud; Terpis wrote most of the scenarios himself. Scenic designers such as Emil Pirchan and Panos Aravantinos assisted him in creating expressionist-constructivist settings for ballets that largely inhabited the realm of symbolic fantasy; Die funf Wunsche (1929) contained a film sequence shot by Gina Fagg. Because of persistent resistance to his expressionist methods from doyens and classically trained dancers, he could not construct group dances as powerfully or radically as he wished, so he increasingly relied on the talents of a few extraordinarily
gifted soloists—Rolf Arco, Rudolf Kolling, Daisy Spies, Walter Junk,
298 THEATRE DANCING Dorothea Albu. This strategy only aggravated tensions between himself and the majority of the corps, although Schillings and his successor, Heinz Tietjens, continued to support him. But in 1929 Terpis faced a full-scale insurrection, from new music director Otto Klemperer, who accused him of lacking “musicality” and of failing to grasp the nature of theatrical art. Terpis
therefore handed in his resignation, and Laban soon replaced him. The next year he retreated into almost monastic seclusion, opening a school in
Berlin-Grunewald, which he directed until 1939. He then returned to Switzerland, where he directed numerous operas and stage plays in Bern, Basel, and Zurich throughout the war years. In the last decade of his life, he devoted himself primarily to the study of psychological theory, particularly to problems of color perception and semiotics, on which he even published scholarly articles, although relations between color and movement had preoccupied him in the 1920s (Schede). Terpis appealed to male theatre administrators because his thinking seemed rigorously disciplined and austerely rational. He seemed capable of creating an atmosphere of sober freedom derived from a synthesis of ballet and modern dance techniques. Thus, a major irony of his career was that his own corps regarded his thinking as too radical (expressionist), when in reality his ideas lacked sufficient respect for excess, flamboyance, and wildness. None of his ballets resonated much with either the public, the critics, or the dance world, in spite of his impressive seriousness and ambition, and useful descriptions of them remain difficult to excavate. Even his almost completely uncritical biographer, Wolfgang Schede, gave only the vaguest descriptions of them, offering only a couple of photographs, and Terpis himself did not discuss any of his ballets, publishing scenarios of ballets that never got produced rather than analyzing those that did. He offered an aes-
thetic of grandiose restraint and heightened sobriety, as he indicated in a lecture to students around 1932: “Our time has an outspoken inclination toward exaggeration, consumption; it loves the loud, the screaming, the extreme. ... The dance programs consist largely of grotesques, parodies, problematic spiritual distortions, insofar as they do not exhibit artistic or virtuoso formalisms. .. . It is rarely that one can identify a dance as ‘beautiful’ or ‘elegant,’ rarely that a dance displays internally or externally an aristocratic bearing. Today we are immediately ready to identify everything that is ‘beautiful’ and poetic—that is, harmonic—as kitsch. The ugly, unharmonic, unlogical strike us as interesting” (Schede 101-102). Terpis pursued what one might call an architectural sense of movement fusing concepts of classical ballet with theoretical categories of modern
dance; indeed, “architecture and choreography share the narrowest of affinities” (Terpis, Farbenspiel, 102). He tended to build individual movements out of classical concepts supplemented by a distinctly modern enthusiasm for swinging motions, although he showed little interest in pointe
THEATRE DANCING 299
technique. For group movements he favored modern theoretical categories, which nevertheless seemed more rooted in architecture and space
than in the body. Group movement achieved maximum expressivity through Terpis’s notion of “symmetricality”: “The ordering of masses in space is symmetrical,” he believed, for symmetricality provided the most effective “representation of the idea of power, wealth, strength, and domination” (107). Asymmetrical constructions opened up the world of “fantasy” (which he actually preferred on the narrative level), but these must never transgress “laws and order” established through symmetry (112). Group symmetry occurred through the application of abstract geometrical categories: the circle, the triangle, the square, and the row. Each category contained numerous variations—the circle, for example, included cylinders, half-circles, tunnels, balls, arches, and so forth. Asymmetry intervened when group movement no longer disclosed recognizable geometric categories. Choreography entailed the fusion of abstract geometrical categories with classical ballet positions and with modern notions of swing and pulse. Terpis’s belief in synthesis operated at a further level: he sought to fuse abstract categories of movement with a very literary sense of narrative. He wrote most of the scenarios for his ballets, which primarily projected a fantastic or Gothic atmosphere, and he seemed unable to imagine dance without an elaborate libretto (Terpis, “Wie ensteht,” 4). Yet knowledge of his scenarios is so scant that it is difficult to ascertain what he wished to say. Don
Morte (1926, music: Wilckens), perhaps his most successful work, was a grandiose adaptation of Poe’s “The Masque of the Red Death.” This piece, which revealed such powerful anxiety toward fleshly pleasures and the body, conveyed the logic of his asceticism: he feared the body and the turbulent emotions it provoked; carefully scripted narrative dance, constructed symmetrically within an elaborate theatre bureaucracy, was the most effective way to regulate the body and the threats to spatial order from impulse and fantasy, which the body “covered up.” He loved the extravagant productions of the Ballets Russes when they visited Berlin—these sent him walking alone
through the city for hours—but he was incapable of anything so unapologetically lavish and hedonistic. Yet the State Opera (including the corps) probably expected him to come up with some serious competition for the Parisians, a task he could hardly achieve through his own productions of Stravinsky’s Pulcinella (1925) and Petrouchka (1928). In the scenarios for his unproduced dances—Saul und David (1930), Orpheus Lysios (1936), Circe (1936), and Niobe (1937)—he revealed perhaps most overtly his greatest desire: to show how dance bestowed upon the body a redemptively priestly identity (Farbenspiel, 169-177). But the theatre was never a happy home for such an ascetic attitude.
Mass Dancing
Because of the difficulties of institutionalizing Ausdruckstanz within the subsidized theatres, sizable sectors of the modern dance and body culture phenomenon pursued strategies of group movement that functioned independently of the official theatres, whose expectations and conventions set too many limits on bodily expressivity. These sectors promoted the so-called
movement choirs. Movement choirs attempted to construct a dynamic image of community that preserved the amateur status of the performers yet transmitted a convincing, almost ritualistic aura of modernity, grounding an idealized communal identity in a common appreciation of bodily expressivity. Indeed, these lay productions probably appealed more to persons who performed in them than to those who watched them. Much of the pleasure of participating in movement choirs derived from improvisations
performed in “appropriated” spaces not usually designated for performance, and in this sense mass movement escaped the constricting regulation of the body associated with literary narratives, although plenty of people did devise scenarios to celebrate the movement choirs.
Laban has received much credit for introducing the concept of the movement choir in Stuttgart around 1920, but the origins of the genre were
actually more obscure and apparently owed more to the theatre than its promoters tended to acknowledge. Part of its appeal derived from the enormous publicity generated by the curious, lavish revival of Handel’s operas and oratorios, initiated on an annual basis in Gottingen in 1920 and supplemented by numerous professional productions in Hannover and Munster starting in 1923. The driving figure behind the Handel productions was
Hanns Niedecken-Gebhard (1889-1954), a master of “mass-suggestive effect,” according to a review of a 1924 Handel production (Peusch 99-100). Beginning in 1920, Niedecken-Gebhard staged the old operas (and oratorios) in a radical, antihistoricist style in which the chorus moved 300
MASS DANCING 301
in bold and complex configurations on expressionistically abstract architectural forms such as elevated platforms, stairways, and ramps. With such choreography, the archaic, rococo music and the old stories seemed to awaken a powerfully modern image of dynamic communal identity. No one who examines stills of these and many other Handel productions from this period can fail to observe a sleek, streamlined break with the operatic performance traditions of previous centuries. The chorus did not perform opera dances or pantomime or even choreographed acting—it performed “mass movement,” acting as a dynamic, pulsating organism rather than asa
mechanically precise corps. More important, the Handel productions showed that mass movement did not exist exclusively apart from theatre, from interior spaces, from elaborate texts, or even from old stories in a highly “domesticated,” classical mode. Mass movement appeared to be latent not in the text but in the idea of performance as the foundation for constructing a modern communal identity. Niedecken-Gebhard enjoyed a busy career directing operas in Hannover, Munster, Berlin (1929-1932), and even the Metropolitan Opera in New York (1933); perhaps it is not surprising that he also assumed responsibility for staging some of the most stunning of the Nazi mass spectacles in the 1930s. Nevertheless, the great majority of movement choir activities occurred outside conventional theatrical spaces, preferably in the open air or in large studios. Mass movement strove more often than not to achieve powerful dramatic expression without being theatrical. Though the Nazis brought mass movement to unprecedented dimensions (largely after 1933), during the 1920s the public consistently identified this aesthetic with left-wing or emancipatory political aims sponsored by the social democrats, the labor unions, the Nacktkultur clubs, the gymnastic organizations, and liberal bourgeois cultural and religious associations. At the 1930 Munich Dance Congress, Otto Zimmermann, leader of a Leipzig “proletarian lay group” called Der Tanzring, presented Achtung! Wir schalten um!, a “satiric dance play” with jazz music by Hermann Heyer that contrasted idealized communist lay movement with dilettantish, ineffectual, bourgeois lay movement. Mass movement, however, appealed to a wide range of political ideologies, and it is misleading to assume that the aesthetic inherently embodied
a totalitarian vision of communal identity. Laban was obviously the most persuasive spokesman for the aesthetic. By the late 1920s, Laban movement choirs affiliated with dance schools alone numbered nearly one hundred, and the generic concept of the movement choir operated in an even wider range of contexts. At the 1928 Essen Dance Congress, Laban spoke about “the choric artwork,” declaring that “the lay dance choir is a rediscovery of a much earlier artistic community” in which mysterious ritual was the foundation of social unity and “the spectator play[ed] a secondary role.” The reason the lay choir remained suspicious of theatre was that effective mass
302 MASS DANCING
movement required large performance spaces that undermined interest in solo or individualistic performances. The pleasure of watching mass movement resembled the joy of watching a “great orchestra” perform; yet “the
choric artwork can only be a mirror of our social and ideal will” (MS 88-89). The movement choirs owed as much to gymnastics as to dance techniques, but at the 1930 Dance Congress in Munich, Laban asserted that the value of the aesthetic did not depend on either gymnastic or dance skill.
Its value was pedagogic: participation in a movement choir changed the mental, emotional, and physical identity of the performer, enhancing an idealized sense of belonging to an “artistic community” (“Kunstgemeinschaft”) (g6—98; also Laban, “Vom Sinn”). Laban denounced the undisguised propagandizing of “false” movement choirs, but it was perhaps impossible for the aesthetic to thrive outside of an overt political stance as long as its value resided largely in the power of indoctrination. Mass movement evolved primarily through teachers in classrooms. Laban himself loved to improvise endlessly with lay choirs. He delighted in devising increasingly convoluted rhythms and configurations of a large
group of bodies. Mass movement did not imply synchronized or unison movements; Laban liked to see how a group could maintain unity of identity while containing all manner of different, individualized movements (Figure 63). Mass movement activity resembled Dalcrozian rhythmic gymnastics in its seemingly infinite capacity for improvised variations and for Laban, at least, it became even more exciting without music or text. The improvisational dimension revealed how membership in a group heightened individual freedom. It may seem difficult to comprehend how a pow-
erful sense of communal unity could arise out of improvisation and the abandonment of a guiding, prescribing text, especially because the movement choir leaders, including Laban, did not theorize their methods at all lucidly or systematically (for communal identity was a “mysterious” phenomenon). But the secret of the mass movement improvisational aesthetic lay, I believe, in its gymnastic foundation. An excellent American book by Bonnie and Donnie Cotteral, Tumbling, Pyramid Building and Stunts for Girls
and Women (1931), explains (often with photographs and stick-figure diagrams) numerous rolling, balancing, and mounting positions by which bodies In pairs or trios may support each other to create a lively image of bodily interdependence. These include, among many others: the wheelbarrow,
the camel walk, the eight-legged animal, the saddleback, the horse and rider, the Jack in the box, the Andy over, the Indian wrestle, the churn the butter, the wring the dish rag, the Siamese twins, the human bar, the archway, the merry-go-round, the treadway, the skin, the snake, the opening of the rose, the opening of the double rose, and thirty distinct pyramid con-
structions for between six and fourteen girls. Although performance of these stunts entailed rhythmic “counts,” music was completely optional and
MASS DANCING 303
used apparently only for competitive demonstrations. Most significant, a group could combine stunts with almost infinite variety, and maneuvers designed for pairs or trios could be combined within a larger group to produce a more complex effect. Of course, one may question what such mathematically driven improvisation says in a deeper sense, other than revealing the intricate coordination and physical trustfulness defining the ideal group. For this reason,
Laban subordinated gymnastic aims to the more complex task of constructing a dramatic, emotion-laden, mystical message. This task required not only stunts but symbolically loaded gestures, so that the meaning of group movement derived from semiotic analysis, from a self-conscious manipulation of signs rather than positions. However, the movement choirs seemed unable to produce a solid theoretical apparatus such as Delsarte
had introduced in the nineteenth century, and even Laban became distracted by an obsession with “objectifying” movement to the point of draining it of all content. The most powerful source of emotion (and therefore meaning) is conflict. But the movement choirs resisted situating conflict within the group, so afraid were they of undermining their utopian image of the community. (It was a mistake Wigman managed to avoid in her generally small group works.) Consequently, the movement choirs tended to associate conflict with a force external to the group: prudery, capitalism, fas-
cism, communism, technology, industrialization, urbanization, and so forth, often designated more by implication than by any serious embodi-
ment and against which the group appeared as a liberating antidote, a utopia in microcosm. SIGNIFICANT THEORISTS OF MASS MOVEMENT
In Hamburg (1922-1927) and then in Halle (1927-1933), Jenny Gertz (?-1966), a Laban student, achieved unrivaled distinction for her movement choir work with children and teenagers, male and female together. Most of her students came from the proletariat, and for several years she maintained close connections with both the Social Democratic Party and the Communist Party, but in the early 1930s she drifted more decisively toward communism. Nudity was central to her pedagogic method, and photographs of her nude students performing outdoor movement choir improvisations are among the most beautiful images of group action produced
during the Weimar Republic. Equally unique was her dramatic use of speech to develop bodily expressivity. She would require her students to respond in an imaginative, sometimes complex, but seldom uniform fashion to almost surrealistic commands: “run loudly,” “become big very quickly, then slowly become very small again,” “be a very small package on the floor, tightly bound,” “be noisy people when two cars have collided,” and so forth.
304 MASS DANCING The children often inserted their own voices to make the “sound” of a move-
ment. Gertz could combine these tiny body dramas into larger structures, and children themselves might lead the group (Losch 81-87). In collaboration with her friend Rose Mirelmann, Gertz did produce such “choric dramas” for young people as Schwarz-Rot (1930) and Revolutionspiel (1932), propagandistic celebrations of communist idealism. But the Gestapo shut down her school and compelled her to seek exile in Prague, where Mira
Holzbachova, another student of Laban, was a prominent communist dancer. Just before the Germans invaded Czechoslovakia, Gertz migrated to England, where she continued to teach children’s dance until 1947, when she returned to Halle. Otto Zimmermann forged a much more “determined” relation between speech and movement than prevailed in Gertz’s free-spirited pedagogy. He
directed Der Tanzring, a communist movement group in Leipzig, which had witnessed a very turbulent period of red mass spectacles in the early 1920s (Pfutzner). For the 1929 Festival of Speech and Movement Choirs in
Leipzig, Zimmermann took spoken words from the Internationale and assigned to them specific physical, unison movements. For example, the words “clean table” produced “from sideways position left, right arm swinging wide to the left side in pumping motion”; “power to the oppressed” pro-
voked “right arm stretches spaciously right and sidewards through the space, making a right-pathed circle”; “armies of slaves, awake!” meant “stride forward toward the spectating masses, great lifting movement of both hands deep and high” (Losch 338). But this sort of synchronicity of word and movement appealed to people for whom group solidarity was incompatible with internal variation and, indeed, improvisation. Yet this strategy tended to prevail in the production of large-scale dramatic works written for movement choirs, such as Bruno Schonlank’s, staged by Vera Skoronel and Berthe Trumpy at the Berlin Volksbihne (1927-1928), whose movement choir contained seventy persons.
By contrast, Martin Gleisner (1897-1983), an actor under Max Reinhardt and from 1922 on a close associate of Laban, acknowledged that the power of group identity depended on “structured work” and advocated a position between text-driven performance and full improvisation (VP 43-46). From 1925 he directed a Laban-school in Jena with a social democratic-communist orientation: “[T]he movement choir, through the creation of group artworks, is in the strongest sense social” but must not exclude “the bizarre, the dark, the grotesque,” for the path to freedom allows the layman “to express everything that is within him” (Gymnastzk, October 1926, 150-151). Gleisner’s book, Tanz ftir alle (1928), explained (not very systematically) his pedagogic-aesthetic approach. He sought to create an inherently socialistic form of group dance unique to the movement choir, which entailed deemphasizing gymnastic devices. He wanted a
MASS DANCING 305 dance form designed explicitly for performance at festivals of a political character. To achieve this aim, he followed a twofold strategy. First, to estab-
lish the social identity of group movement he drew upon old folk dances, especially round dances, and repudiated contemporary social dances, for “the ballroom of our days is a symbol of the anarchistic, bourgeois society of
our time” (Gleisner 73). Second, he sought to transform labor-related motions such as sweeping or digging into dance elements and thus to collapse the difference between labor and dance. He also liked to have as many as five discrete groups interacting with each other in a wide-open space, in different modes of movement, until they became one group. All of Gleisner’s “choric artworks” appeared at political festivals, but the documentation on them has largely disappeared, so it is difficult to say what sort of “structured” message he transmitted. Rotes Lied (1929), created to commemorate the fortieth anniversary of the German Workers’ Singing Federation in Berlin, was probably his most visible work. It was a vast production performed for more than 40,000 spectators in a football stadium. The hour-long piece required separate speech, song, and movement choirs, with a full orchestra playing sections of Beethoven’s Eroica Symphony and Tchaikovsky’s Pathetique Symphony, as well specially composed marches and folk dances by Alexander Levitan. The speech choir contained 50 speakers, while the singing choir numbered 2,000 and the movement choir 1,000. The choreography “was not illustrative, but rhythmically defined” because the narrative was so abstract. The three-part structure apparently described the power of the group to survive destruction and disintegration and reemerge triumphantly in ecstatic folk dances or monumental marches with red banners (Losch 331-333). As a socialist and a Jew, Gleisner obviously had no future in the Third Reich, so he migrated to Holland, where he became prominent as a leader of often huge socialist movement choirs, publishing a Dutch translation of
his book (1934) and working with the Flemish dancer Lea Daan. In Antwerp, Gleisner and Daan collaborated on a group movement piece, People and Machines (1936), and then produced a film of it, a fragment of which
still exists. Images show men and women in worker and peasant garb, respectively, making heavy, lurching, swaying movements in synchrony to signify “toil,” but the sexes do not make the same movements. The film fragment does not make clear what sort of music Daan employed. What makes the film unusually compelling is its use of cinematic technique. The camera moves in close to the dancers, films them at low angles from the side and the back, from high angles, and with low angle tracks and pans. The mass bodily movement techniques are designed to be seen from great distances in large spaces, but the camera brings the spectator in close, conveying a peculiar feeling of heroic, monumental physicality and, at the same time, a sense of oppression. It is a rare example of uniquely cinematic rhythms in
306 MASS DANCING
which camera movement and editing “dance” with the movement of dancers themselves rather than merely watching them, an effect that only Hollywood’s Busby Berkeley had mastered at that time. Eventually Gleisner emigrated to the United States, where he specialized in teaching movement expressivity to older people. The socialist aesthetic of People and Machines was obviously remote from the Catholic-socialist aesthetic of the massatooneel, which entirely dominated the movement choir phenomenon in Holland and Flanders, where lay public productions were favored on a scale the Germans would hardly have considered revolutionary. The Dutch Catholic girls’ association, De Graal, for
example, staged Pinksterzegen (1931) with 10,000 girls divided into nine movement choirs of 250 to 4,800 girls each and each choir, representing such things as “seraphs and cherubs,” “Grail cadettes,” and “October and the Komsomol children,” assigned specific, bold colors (Van der Poel 25). The Brussels Credo! (1936), directed by Lode Geysen for the Flemish Catholic Socialist Federation, involved 20,000 performers in a stadium filled with 150,000 spectators. The Dutch-Flemish lay choirs also employed Soviet-inspired constructivist scenography and complex, spectacular scenic technology, which, German socialists tended to feel, undermined the original focus on the body as the source of communal identity. Moreover, distinguished Dutch and Flemish authors such as Henriette Roland Holst, Martinus Nijhoff, and Michel de Ghelderode, composed the texts for movement choirs, and these inscribed the integration of speech, song, and movement with such monumental “structure” that the improvisational pleasure of the German movement choir scarcely emerged (Boon; Van der Poel;
Roland Holst) (Figures 64-65). In Holland and Flanders, the socialist movement choir enjoyed a prosperity (or grandeur) in the 1930s that it never had enjoyed in Weimar Germany, but for an improviser like Gleisner the Catholic vision of utopia, immensely inclusive though it was, perhaps excluded too much “the bizarre, the dark, and the grotesque.” TOTENMAL
The validation of the movement choir aesthetic seemed assured when various of Laban’s students incorporated it into theatrical or professional productions. Rogge, Jooss, Skoronel, Feist, Loeser, Knust, and Laban himself produced professional stage works that applied movement choir technique, even though public performance was a secondary aim of this concept. Ironically, the most ambitious and complex use of the movement choir came from a Laban student who displayed little confidence in it as an expression of modernity, Mary Wigman. In 1930, at the Munich Dance Congress, she premiered Totenmal, a work of spectacular ambiguity and fascination. The eight-part “dramatic choral vision for word, dance, and light,” written by the
| MASS DANCING 307 Swiss expressionist Albert Talhoff, called for six separate choirs representing, respectively, the spirits of fallen soldiers (two choirs) and their wives, mothers, sisters, and lovers. The eight parts, or “compositions,” included five “halls” and three interludes, with each hall signifying emotional condi-
tions—calls, forgetfulness, expulsion, echoes, and devotion. Of the six choirs, one, the Celebration Choir, consisted of two parts: one part spoke within the halls, and the other part, situated around two “light altars,” spoke in close proximity to a color organ. A female dance choir (Tanzender Chor
I) and a male dance choir (Tanzender Chor II) never spoke and only danced. A Speech-Orchestral Choir, like the Celebration Choir, contained voices of both sexes. Both of these choirs occasionally spoke in unison or broke into as many as ten groups of voices; one of these groups, for example, consisted of a boy choir. The Instrumental Choir, which played percussion instruments and music (drums, cymbals, bells) composed by Talhoff himself, sometimes spoke or screamed. From out of these choirs came eight figures who spoke numerous solo verses. Another five figures danced without speaking; these included a male Demon and a female Dance-Play figure, performed by Wigman. It is not clear from Talhoff’s text what the total number of voices was for either the choirs or the groups within them. Some of the groups appear to have consisted of voices from more than one choir. The idea, apparently, was that neither the language nor the voices that spoke it belonged entirely to any one community. It was a very complex perception of voice. However, Talhoff’s text offered no great distinctions among the voices spoken within _ it. The strongest distinction within the text was that between Talhoff ’s language and the quoted language of the actual letters written by soldiers who had died. In this huge dance, literary language did not construct characters in any way that we might expect from a dramatic text. Instead, Talhoff’s expressionistic verse turned the bodies that spoke into abstractions. Whether in a choral or a solo mode, the speaking body projected an anonymous, generic identity. The language created different communities of voice that nevertheless spoke the same types of language and (pacifist) sentiments. No single body seemed powerful enough to express any sentiment unique unto the speaker; each body (and voice) seemed but a fragment of a larger, more abstract communal identity. Despite the communality of desires signified by the interlocking choirs and solo speakers, the dominant mood of the piece was one of profound loneliness, of the living (both genders) separated irrevocably from the dead (male) and vice versa. The distribution of speech among so many choirs, groups, and soloists produced an extremely complex, antiphonal sound world. Wigman treated this sound world as a
musical accompaniment to dance movements. Though the choirs and speakers were by no means static, the piece strongly differentiated between
308 MASS DANCING
their movements and those of the dancers. Choirs swayed, undulated, or extended their arms but otherwise never moved with the freedom or complexity ascribed to the Demon or the two Dance Play figures. Just as the realm of the dead was immutably “other” than that of the living, so speech remained in tension with movement. Because, however, the text motivated the dance, one must assume that, in this case, language “controlled” movement or shaped it according to its own rhythms. But the text did not make clear how bodily movement “translated” the spoken language that accompanied it. The free verse wildly shifted rhythms from speaker to speaker. For example: SPEECH AND GESTURAL FIGURE II: No!!
from the ten million dead the dead the dead for you it is the path out of hate and need assigned all their peoples make them holy holy beacons of this planet (Darkness.) CELEBRATIONAL CHOIR:
And no one guesses that now at last before God and the world without question and for murder hammer of death falls on all those of this earth—! INSTRUMENTAL CHOIR: VOICES:
oh save Save
the light of the world! light of the world! the world world (Talhoff 71)
To intensify the anonymity and abstraction of the body, all the performers wore eerie masks designed by Bruno Goldschmidt. But whereas the costumes and masks of the males were identical, those of the females were differentiated according to eight archetypal, “feminine” emotions. Mask type
determined movement type. Performing before the various choirs was a
MASS DANCING 309 lone, unmasked woman (Wigman) who attempted, unsuccessfully, to resur-
rect the dead through dance. Speech did not issue from her or her counterpart, the shrouded male Demon. The choirs and figures recited Talhoff ’s verse lamentations for the dead and messages from the dead, and they occasionally exhorted the audience not to forget the dead. Integrated into Talhoff ’s language were fragments of actual letters written by English, French, and German soldiers who died in World War I. The solo speakers of these fragments were male and invisible, speaking in chanting, Sprechstimme style, individually, from concealed booths.
The sixth composition concluded when Wigman, having apparently revived the dead by persuading the male movement leader to imitate her gestures, became separated from her partner by a sinister male Demon (masked), who compelled her, through dance, to retreat into the shadows. The final (eighth) composition did not involve bodily movement at all: the male and female speech choirs stood rigidly with arms upheld while a color organ bathed the scene in blazing red light and the Celebration Choir thunderously exhorted the audience to believe that God’s love will triumph over
destructive human impulses toward war. The final “Amen” produced a strange ending. The lone woman appeared to have danced herself to death
trying to revive the dead. Yet the sign for triumph over death was a tableaulike image of monumental stasis, with a multitude of bodies frozen in the almighty refulgence. In the end, light and sound were dynamic, not the bodies. In Totenmal, speech signified a kind of “deadness” but not death itself. Death here had a “demonic” male body, which danced. The (male) dead themselves appeared statically uniform, but Death was dynamic. The dance of Death was indeed of such power that it vanquished the woman dancer, overshadowed the dance of Life. Yet it was the woman’s dance that invited or provoked the appearance of Death. Wigman thus represented Death as a kind of male shadow of the feminine body: dance does not conquer death but drives the dancer toward it, “heroically.” The dance culminates in complete stasis, with the male and female bodies of the speech choirs standing perfectly still, the woman dancer and movement choirs absent, and the dynamic configuration of bodiless light accompanied by bodiless dead voices. If we can’t see the woman, we can’t see death; we can only see the dead, that final condition in which language, speech, and voice are all coordinates of a triumphantly immobile, rather than invisible or repressed, body. Death is movement toward a final stasis.
Dance, then, is not a release from death—it is an exposure of it. Movement makes us see that which is otherwise hidden from us: namely, the view that death is zn life rather than opposed to it. For the feminine body, death
is “masculine” insofar as it is demonic, a figure of desire, another body exposed by the dancer’s effort to use her body to bring things to life. The
310 MASS DANCING
lone dancing body of the woman motivates a multiplicity of other bodies that are communal, male and female, speaking and moving, historical yet archetypal, dead yet alive, physical and metaphysical, choric yet suffused
with a profound sense of loneliness, abandonment. These bodies are masked, for the other is in itself the mask of identities hidden within the body that is most naked, the unmasked body of the lone woman dancer. By
keeping her face unmasked and by wrapping the rest of her body in a medieval-like gown, Wigman effectively dramatized the perception of the “real” or “authentic” body as an intensely death-conscious vortex of tension between exposure and concealment. The chief sign of loneness is nakedness (of the face); the chief sign of otherness is speech; and the chief sign of the dissolution of difference between lone being and the others is movement (KT; Manning 148-160; Prinzhorn, “Grundsatzliches”). Totenmal was probably the most controversial dance work produced dur-
ing the whole of the Weimar Republic. It provoked a turbulent critical response throughout the country and fascinated audiences during a tenweek run in Munich; some haunting film footage survives. The idea of community signified by the elaborate interlocking of choirs and groups seemed fantastically complicated and saturated with a political ambiguity further intensified by Wigman’s unresolved dramatization of tensions between the solo body and the group. Few people were ready to acknowledge that communal unity was an illusion, a matter of masks and generic identities; few people were ready to acknowledge that Death was somehow behind the illusion of unity. But what most touched many spectators was Wigman’s monumentally tragic sense of an absent, vanished, or dead maleness, which left
the curious impression of a world bereft of heroic identity except for the lone and abandoned female figure. The political significance of the piece lay in its power to divide audiences rather than unite them. In Schrifttanz (3/3, November 1930), Alfred Schlee, one of the journal’s editors, declared that Jotenmal had “brought disrepute upon the idea of the ritual theatre” and that Wigman had “wasted her talents on this amateurish creation.” “At a time when a number of theatres are fighting for their survival, one single work consumed the amount of money which would have secured a theatre’s budget for an entire year” (VP 87). Josef Lewitan, editor of Der Tanz (3/8, August 1930, 15) condemned the piece as “unworthy” of Wigman and asserted that “for dance art and dance evolution Totenmal offers virtually nothing” in “times of direst need,” when 100,000 marks might well serve a less “dilettantish” project. But Friedrich Muckermann, a Catholic priest who had addressed the Dance Congress as a proponent of lay movement choirs within the Church, praised Totenmal for its powerful Christian sentiment (Der Gral, 24/8, May 1930, 675). Hans Brandenburg also endorsed the work (Der Tanz, 3/6, June 1930, 5), but he was in a delicate position, having already prophesied (Schnifttanz, 3/1, April
MASS DANCING RII
1930) that the piece would inaugurate a new form of dance theatre and choric art. In Der Ring (3/36, 623-628), a “conservative cultural journal”
(as it described itself on the masthead), the great psychologist Hans Prinzhorn wrote possibly the most detailed description of a Weimar-era dance performance ever published. Prinzhorn condemned the production
for being underrehearsed and relying on a tedious, painfully naive text, | then systematically criticized all the multimedia performance elements. Yet he praised Wigman’s “dramatic” choreography and dancing, which he said
were in tension with the stereotyped message of the text: through movement, Wigman freed perception from “schematized” concepts of action within social reality. He complained that the whole production offered an inadequate understanding of the war’s significance and provided no insight
into the value of the sacrifices made by all the soldiers who died in it. Prinzhorn blamed Talhoff’s script for nearly all of the problems, but when, under the auspices of the Social Democratic Party, Lola Rogge staged sections of the text in Hamburg in 1931, in a far less ambitious or innovative manner, the press response was uniformly enthusiastic. Wigman never again attempted such a grandiose dance, but neither did anyone else. (Her student Margarethe Wallmann did attempt complicated choric dances, though not an interlocking image of community, in Orfeus Dionysos, also performed at the Congress.) From Wigman’s perspective, the problem with Totenmal was logistic: inadequate rehearsal time, an inadequate performance space, inadequate technical support, and, worst of all, inadequate talent within the choirs. Totenmal exposed the limit of the movement choir and of mass dancing generally to signify communal identity. From then on, a large, inclusive representation of community depended less on complexity of group movement and bodily expression and more on the technological complexity of a huge visual design.
| THE DANCE CONGRESSES The big dance congresses in Magdeburg (1927), Essen (1928), and Munich (1930) were remarkable and complex manifestations of mass dancing. The Magdeburg Congress, in conjunction with the great International Theatre Exposition in that city, was organized largely by Rudolf Laban, Hanns Niedecken-Gebhard, and Oskar Schlemmer. The event attracted about 300 people, but Laban and his disciples overwhelmingly dominated
the proceedings. Wigman and her disciples refused to attend because Laban declined to offer them an opportunity to perform. Laban hoped the congress would further his aim of uniting all German dance organizations
and institutions under a single federation, but achieving this on paper proved to have considerably less dramatic consequences than he anticipated. Nevertheless, the congress was quite successful insofar as it gave
312 MASS DANCING Ausdruckstanz unprecedented media visibility. An intellectual-theoretical aura pervaded to a greater extent here than in the subsequent congresses.
The Jena monthly journal Die Tat (19/8, November 1927) devoted an entire issue to publishing the bulk of the proceedings, and the journals Schrifttanz and Der Tanz emerged directly out of the congress. The controlling theme of the congress was the institutionalization of Ausdruckstanz. Nearly all the papers and discussions focused on the historical,
aesthetic, technical, and organizational difficulties of integrating modern
dance into the theatre, the state educational apparatus, and large-scale institutional structures. Impressive lectures addressed dance music (E. Wellesz), dance criticism (H. W. Fischer), dance in the theatre (H. Brandenburg, H. Niedecken-Gebhard, M. Terpis), dance psychology (A. Loos, H. Liebermann), and modern dance as a historical phenomenon (A. Levinson, F. Bohme, W. Howard, O. Bie). Oskar Schlemmer discussed abstract relations between dance and costume and presented models of experimental stages designed by the Bauhaus in Dessau; Laban showed films of his movement choir experiments; and Lothar Schreyer, Gertrud Schnell, Paul Et*bauer, and Gustav Klamt, among others, held a complicated dialogue on
the nature of choreography. Unlike other congresses, this one featured extensive exhibition of costumes and set designs, reinforcing the perception of dance as an art defined more by fantasy than by the reality of the body.
But perhaps the most interesting feature of the congress was the series of
open meetings conducted to identify the goals of a unified dance federation and the methods for achieving the goals. Some participants, including Berthe Trumpy, Charlotte Bara, and Olga Brandt-Knack, did not believe that modern dance would benefit much from a close affiliation with the the-
atre, the state, classical ballet, or even lay education. In other words, not everyone agreed that it was in the best interest of dance to construct a broad united front or to accommodate a wide variety of constituencies. Nevertheless, diverse sectors within dance culture expressed a willingness to support each other and to promote new ideas and new values for dance within existing cultural institutions. Laban dominated the congress performance scene with stagings of Titan, Die Nacht, and Ritterballett, and Vera Skoronel presented her mass dance Die Erweckung der Masse. Two evenings offered solo and ensemble pieces from twenty performers, including Hertha Feist, Harald Kreutzberg, Hilde Strinz, Josepha Stefan, Rudolf Kolling, and Ingeborg Roon. Curiously, Dre Tat, in its eighty-eight-page report, did not discuss the dance performances at all, though it published most of the lengthy lectures.
Fritz Bohme coordinated the Essen Congress with help from Alfred Schlee, Kurt Jooss, and Ludwig Buchholz. This time Mary Wigman was pre-
sent, along with Yvonne Georgi, Gret Palucca, Hanya Holm, and Rosalia
Chladek. Wigman had formed (March 1928) a new dance federation,
MASS DANCING 313 Deutsche Tanzgemeinschaft, to compete with Laban’s Magdeburg federation, so no one expected the congress, which attracted about 1,000 participants, to produce an image of professional, aesthetic, or political unity. Panels focused on the themes of dance in the theatre (again), dance notation,
dance pedagogy, and (again) the theory of lay dance culture. Unlike Magdeburg, Essen attempted, mildly, to situate dance modernism within an
international context. André Levinson, from Paris, was on hand again to defend the classical ballet tradition, as was the Javanese dancer Rodan Mas Jodjan. A special Sunday program offered “national” dances from England, Russia, Germany, Java, and Sumatra. The congress hoped to have the Soviet scholar Alexei Sidorow present a slide lecture on Russian modern dance, supplemented by performances of several Moscow modern dance groups, but at the last minute Soviet authorities refused to issue visas. These performances probably would have been the most exciting features of the congress, for knowledge of Russian modern dance during the 1920s was (and still is) frustratingly obscure. Mary Wigman presented her ensemble piece Die Feier, Terpis and Kroller presented ballets designed for the official the-
atres, and the Essen Municipal Theatre dancers, under Jooss, performed Honegger’s Die siegreiche Horatier and Milhaud’s Salat. An evening of solo
dances included work by Kreutzberg, Chladek, Skoronel, Georgi, and Edgar Frank. Patricia Stockemann has spoken unfavorably about this congress, claim-
ing that panelists brought nothing new to the discussion platform and bogged down in “formal things like the length of training time for dance teachers and dancers and the repeated demand for a [state-subsidized ] dance academy . . . an artistic stagnation was obvious” (MS 75; also 72—9g0).
From my perspective, the congress’s atmosphere of stagnation resulted from the complete failure to address aesthetic issues or to present any analyses of actual performances. When theoretical discourse focuses exclusively
on mundane details of pedagogic method, dance notation, and bureaucratic procedure in the theatres, one senses that dance is no longer an art or even a pleasure but an almost incidental aspect of career maneuvering. The 1930 congress in Munich, jointly organized by Wigman, Laban, Bohme, Brandenburg, and several others, achieved an unprecedented and still unsurpassed scale in dance history. It attracted 1,400 participants from several countries and from numerous schools and theatres across Germany. Scholarly presentations were virtually absent, with only a few lectures on the old themes of dance in the theatre (Emmel, Brandenburg) and lay dance culture (Laban, Gleisner), although Bohme spoke perceptively about the social identity of the dancer. Joseph Lewitan, in Der Tanz (July 1930, 2), complained acidly about the lack of academic reflection, which at a medical congress would seem “grotesque.” The major administrative objective of the congress was to formulate accreditation standards for dance academies.
314 MASS DANCING This task proved unexpectedly easy to carry out, probably because it was not difficult to agree on broad categories of instruction—the real (undiscussed) problem was to identify values for dance, domains of meaning. But the great achievement of the congress lay in the huge number of performances from
an astonishing variety of artists. Almost everybody of significance in the
world of Central European modern dance appeared: Wigman, Laban, Kroller, Chladek, Maudrik, Gertz, Eckstein, Kratina, Loeser, Wallmann, Kraus, Palucca, Brandt-Knack, Klamt, Skoronel, Heide Woog, Dorothee Gunther, Mila Cirul, Manda van Kreibig, Ellinor Tordis, to name only about half of the German groups, along with dancers from Holland, Czechoslovakia, Yugoslavia, Hungary, Austria, Poland, Bulgaria, and the United States. A special program featured solo pieces by thirty-five young dancers. Stockemann has also complained about this congress, saying that its “fail-
ing artistic impulse had a directly frightening and disillusioning effect... even the protagonists of the modern dance had hardly anything new to present” (MS 91). But this view seems to derive from the belief that the congress should have displayed a more urgent awareness of contemporary political realities or perhaps a more aggressively avant-garde image of
dance, such as Schlemmer and the Bauhaus designers introduced at Magdeburg. If, however, one examines closely many of the works performed at the congress—as I have tried to do throughout this book—the impression emerges of substantial innovation and diversity within the world
of modern dance. The congress did not exist to unify dance as a major power broker in the national cultural scene; on the contrary, it served to reveal the impossibility of unifying dance. The congress showed that the more dance expanded in a general, inclusive sense, the more it became fragmented into an enormous program of untheorized performances that supposedly spoke for themselves. The dancing body inescapably constructed patterns of difference, not structures of unity, despite the obsession with bureaucratic rhetoric emanating from nearly everyone who spoke. NAZI CONCEPTS OF MASS MOVEMENT
A fourth congress, planned for Vienna, never materialized because of the Nazi takeover. Instead, Goebbels authorized the organization of German Dance Festivals, held in Berlin in 1934 and 1935. These were autumnal rather than summertime affairs and completely devoid of scholarship, lectures, or even panel discussions. Performances alone would purportedly reveal a uniquely German dance aesthetic. But these gatherings were much
smaller in scale than the Munich Dance Congress. Georgi, Wigman, Kreutzberg, Maudrik, Kratina, Laban, Palucca, and Gunther contributed pieces to the 1934 festival, held in conjunction with a large museum exhibit on dance in art, but the following year only Wigman, Palucca, Kreutzberg,
MASS DANCING 315
Maudrik, and Gunther returned. Rogge, however, presented Amazonen; Helga Svedlund, ballet mistress at the Hamburg State Opera, gave her production of Ravel’s Pavanne; and Lotte Wernicke, a Berlin lay movement choir director, premiered Die Geburt der Arbeit (music: Kessler), a “choric dance play” in six scenes that dramatized the “awakening of humanity and its path to various modes of labor which are the foundation of human community” (MS 159). The Nazi press had criticized some of the 1934 dances, including those by Wigman and Palucca, for being insufficiently or unimpressively German; the 1935 Rogge and Wernicke works were lauded as appropriate examples of “heroic” German bodily movement, but Goebbels apparently disliked Amazonen because it was too Greek in its iconography. The provinciality of the festival strategy was obvious even to Goebbels; he therefore endorsed the idea of an International Dance Competition, sponsored by the government itself, to coincide with the 1936 Berlin Olympics. The newly formed Reichsbund fur Gemeinschaftstanz invited participants
from Italy, Poland, Holland, Rumania, Greece, Bulgaria, Austria, India, Yugoslavia, Canada, Switzerland, and Belgium. (Martha Graham declined an invitation to attend because she disapproved of Nazi persecution of Jewish dancers.) The competition emphasized dances of a folk-national character, although the German entries (from Palucca, Wigman, Maudrik, Gunther, Kreutzberg, and Kolling) displayed almost no connection to folk-dance forms. Laban promoted the lay movement choir concept as a modern form of folk dance, and he planned a large, four-part “choric consecration play,” Vom Tauwind und der neuen Freude, involving 1,000 lay persons from thirty German cities, for performance in the new Dietrich-Eckart Amphitheatre. The piece derived its inspiration from Nietzsche’s Also sprach Zarathustra. Harry Pierenkamper directed the first part, “Kampf,” employing choirs from Mannheim, Heidelberg, and Frankfurt; Albrecht Knust and Lotte Muller supervised the second part, “Freude,” with choirs from nine cities. Heide Woog directed choirs from the Ruhr area in the “Weihe” section, and Lotte Wernicke led the entire ensemble in “Besinnung.” As Marie Luise Lieschke, Laban’s chief assistant for lay movement education, explained: “We have
grown out of the I-and-You era into the We era—but not so that we are merely ‘masses’: we are a people’s community [Volksgemeinschaft], led by the Fuhrer, and our lay dance is education in this sense: to lead and become led” (Wir tanzen, 7). But when Goebbels, along with 20,000 others, attended a dress rehearsal of the production, he (apparently alone) expressed deep disappointment, regarding the piece as too “intellectual” and a dilettantish masquerade of Nazism that really had “nothing at all to do with us” (MS 166). He thus compelled the withdrawal from the competition of both the consecration play and Rogge’s Amazonen. From this point on, Laban’s relations with the regime became progressively colder, with Rudolf Bode rising to favor as the leader of movement education.
316 MASS DANCING At the Olympic Games themselves, Carl Diem, coordinator of the entire event, had arranged for the performance of a gigantic festival spectacular, Olympischer Jugend, following the 1 August 1936 opening ceremony, watched
by 100,000 persons. Directed by Hanns Niedecken-Gebhard, it was a nocturnal event in five scenes. It began with the tolling of the huge Olympic bell and the appearance of 2,500 girls, age ten to twelve, in white dresses, followed by goo young men in different-colored gymnastic uniforms, then
2,300 teenage girls. Under powerful spotlights these huge groups performed an immense round dance choreographed by Dorothee Gunther and Maja Lex to music by Carl Orff. Gunther and Lex juxtaposed large, marching phalanxes of dancers against flowering, swirling circles of girls.
The second scene, “Anmut der Madchen,” choreographed by Palucca, employed the teenage girls in a vast waltz, followed by a solo waltz, which Palucca danced herself. The music was again Orff’s, after Palucca decided she could not dance to the excessively modern piece offered by Werner Egk. In the third scene, male athletes marched with flags from many nations, cir-
cling around bonfires and singing hymns composed by Egk. The fourth scene drifted into a tragic mood, commemorating heroic struggle and sacrificial death for one’s country. For this scene, Kreutzberg designed a weapon dance for sixty male dancers carrying shields, all of whom “died” in
the end; Wigman followed with a lamentational dance for dead heroes involving about sixty female dancers. Again, Egk composed the music for these pieces. The final scene, “Olympischer Hymnus,” entailed the singing by everyone in the stadium of the “Ode to Joy” section of Beethoven’s Ninth Symphony while the great spotlights, introduced by Albert Speer, panned across the field and soared upward in a stunning colonnade to the heavens. None of this stirring spectacle appeared in Leni Riefenstahl’s film masterpiece, Olympische Spiele (1938), because she and her cameramen did not think they had enough light to shoot the scenes (Downing 83). Instead, she
inserted outdoor shots of nude female dancers, undulating “eurhythmically,” as she put it, under a cloud-dappled sky. These images of bacchanalian dancing bodies served as the transition from the mythic, male world of classical athletic competition to the lighting of the Olympic flame (Diem’s idea) in the twentieth-century stadium. This very mysterious effect dramatizes the unity of the athletic body to nature much more powerfully than the stadium spectacle. But Olympische Jugend dramatized far more vividly the integration of the athletic body into a vast image of community in which all bodies were minute compared to the great movement of the whole. The assumption persists that, because a fascist government endorsed and promoted Olympische Jugend, mass movement and dancing are inherently
expressions of totalitarian ideology (e.g., Manning, 195-201). However, the piece contained no Nazi iconography and glorified youth and Olympian
MASS DANCING 317 aspiration as the foundation of an international sense of community. Olympische Jugend treated athletic competition as a political ideology unto itself,
to which all other ideologies remained subordinate, if not altogether eclipsed. Still, the relation between mass movement and totalitarianism demands clarification, for the Nazis obviously adopted lay movement choir
techniques in the production of numerous propaganda spectacles, especially with the curious genre known as the Thingspiel, which flourished between 1933 and 1937. The Thingspiel derived its name from the Thing, or
outdoor judgment space, designated by pagan-Teutonic tribes to decide communal problems. However, the Thingspiel was an expressionistic, multimedia genre designed for open-air performance employing speech choirs,
movement choirs, singing choirs, narrators, and elaborate scenographic effects involving banners, marches, loudspeakers, spotlights, and projec-
tions. Although the Nazi Party sponsored nearly all performances of Thingspiele, the productions functioned at the civic-amateur level, often entailing thousands of performers supervised by SA and SS officials. The Thingspiel, “which frequently assumed the character of an oratorio,” was apparently a genuinely popular genre: the Nazis built amphitheatres to perform the works in 62 cities but could not accommodate the demand for nearly 500 (Eichberg 139). The texts for Thingspiele came from authors close to expressionism, including Richard Euringer, Eberhard Wolfgang Moller, Kurt Heynicke, Max Halbe, Heinrich Zerkaulen, Heinrich Lersch, Gustav Goes, Heinrich Harrer, Max Ziese. In the Thingspiel, the protagonist was always “the people” (embodied by choirs), who struggled, with simple, heroic pathos, against the evil inflicted by capitalism, bolshevism, Judaism, industrialization, unemployment, hunger, the “backstabbing” diplomats who contrived the Versailles Treaty, decadent intellectualism, gangsters, racial impurity, and the foolish, misguided administrators of democracy in the Weimar Republic. The salvation of the people depended on the emergence of the Fuhrer, representatives of the SA or SS, or potent symbols of Germanic or Aryan heritage. Menz (340) contends that the Thingspiel represented the “revolutionary” phase of the Third Reich, which emphasized the socialism in National Socialism (although a faction around Alfred Rosenberg and opposed by Goebbels stressed reactionary glorification of archaic Teutonic mythology). The revolutionary phase came to an end with the production of Olympische Jugend. From that point on the party ceased to sponsor Thingspiele and drastically curtailed its authorization of independent productions, although Hans Baumann’s Passauer Niebelungenspiel appeared as late as 1939. The reason for the policy change remains obscure, but apparently Goebbels felt the party could not maintain sufficient control over the utopian dreams ignited by these productions and over the large measure
318 MASS DANCING
of improvisation that prevailed within them (Eichberg 147). Such performances did not adequately prepare the people for the impending reality of war.
The Thingspiel was hardly a uniquely Nazi innovation. Menz (332-333)
identifies numerous models for the genre, including Greek tragedy, medieval mystery plays, and the grandiose spectacles of Max Reinhardt; Eberhard Wolfgang Moller claimed that Brecht’s Lehrstiucke provided superb models for Thingspiele texts. But Eichberg points to more immediate prece-
dents in the mass theatre of the Social Democrats in the Weimar Republic. Festival or “sacramental” plays, often on a huge scale, appeared at mass events sponsored by labor and socialist organizations in the early 1920s,
with Leipzig (1920-1924) being an especially fertile site of innovation (Pfutzner). Bertha Lask’s Die Toten rufen (1923) and Gustav von Wangen-
heim’s Chor der Arbeit (1923) and 7000 (1924) were notable examples before the First International Workers’ Olympics in Frankfurt in 1925, which saw a vast production of Alfred Auerbach’s Kampf um die Erde. A work-
ers’ festival of gymnastics in Nuremburg (1929) featured Mach dich frei! involving 60,000 persons in the spectacular drama of a great proletarian storm troop that “takes up the fight to free all intellectually, economically, socially, and politically enslaved people from their bondage.” Yet another
festival play, created by Robert Ehrenzweig for the Second Workers’ Olympics in Vienna (1931), used 5,000 performers and dramatized the “revolutionary awakening” of the proletariat against “the oppressive ages of industrial servitude.” In the final “storm of enthusiasm uniting the masses, the golden idol [of capitalism] sinks away, and from the platform come the lanterns of freedom—at first single torches in a chorus of joy, then bands and streams of light, which surround the high circle and expand and swell
through the marathon gate to the accompaniment of the Internationale sung by 65,000. The torch procession, through the Prater to city hall, is joined by the audience” (Eichberg 143-144). All these productions plainly resembled the Thingspiel in their open-air deployment of marches, flags, loudspeakers, speech and movement choirs, narrators, generic identities, expressionistic language of pathos and euphoria, torches, gigantic emblems, protagonization of “the people,” audience participation, and narratives focused on the struggle of the masses to overcome abiding indignities (Ruhle 35-40; Bartetzko, 133-143). On the formal level, then, the Thingspiel was scarcely revolutionary. But even after it waned, around 1936, the Nazis continued to stage vast mass spectacles similar to the awesome 1934 party rally documented so ominously in Riefenstahl’s famous film Triumph of the Will (1935). With the success of Olympische
Jugend, Niedecken-Gebhard, still busy staging Handel operas, became probably the most significant director of mass spectacles in the Reich, supervising the gigantic nocturnal Olympic Stadium celebration (1937) of Berlin’s
MASS DANCING 319 seven hundredth anniversary. This event involved 5,000 schoolchildren and 7,000 members of the army, Gestapo, Labor Service, SS, Nazi women’s aux-
iliary groups, and Hitler Youth, along with 360 dancers performing folk dances, death dances, waltzes, sword dances, harvest dances, and soldier dances choreographed by such people as Berthe Trumpy, Marianne Vogel-
sang, and Reich folk dance expert Erich Janietz (Figure 66). In 1938, Niedecken-Gebhard produced Volk in Leibestibungen for an athletic festival
in Breslau, this time calling on Dorothee Gunther, Marta Welsen, Berthe Trumpy, and Gunther Hess to handle choreographic assignments; the piece
concluded with a triumphant entry march of flag-bearing army troops under an immense dome of light. Glickloches Volk (1938), presented at the Berlin stadium, showed an idealized, Biedermeier world of graceful, waltzing women (300 of them) protected by an ever-vigilant, heroically disciplined military. Triumph des Lebens (1939), the last of the mass spectacles,
was staged in a Munich stadium and again paired “manly strength” and “womanly grace” in gigantic folk dances and marches involving 1,000 girls and several thousand uniformed men. The pieces were choreographed by Gunther, Peters-Pawlinin, Trumpy, and instructors from the Elisabeth Dun-
can school; Maja Lex and Harald Kreutzberg performed solos, and, as usual, the thing concluded with a monumental hymnic surge of humanity toward the swastika (MS 146-149). Goebbels favored these productions because they adopted the model of the 1934 party rally in Nuremburg, which in itself was an enormous elabo-
ration of the Nazi performance aesthetic before 1933. This aesthetic did not tell stories of struggle and revolution but stressed the reality of the moment. ‘The mass spectacle did not merely imagine utopia but embodied it
through manifestations of power and perfection embedded in, rather than signified by, the act of performance: the mystic figure of the leader, gigantic emblems (eagle and swastika), torches, bonfires, spotlights, flags and
drums, loudspeakers, dramatic uniforms, the continuous movement of countless bodies across a vast space, and sudden moments of reverential stillness. Individual bodily movements were simple (march-step, salute), synchronized, and unisonal yet nevertheless capable of creating complex designs, such as an enormous, swirling swastika produced by streams of torch-bearing columns. But on a formal level, mass movement on this scale did not differ significantly from the lay movement choirs of Laban and Gleisner. The appeal of mass movement lay in its power to turn simple
action into a large-scale, transformative end in itself, a destiny rather than a referent of an imaginary existence. Laban’s improvisations with movement choirs shared this reverence for action with the militarized, machine-precise synchronizations of the Nazi mass performance aesthetic, for action in this sense strengthened and ultimately expanded the identity of any group. The totalitarian identity of mass movement therefore does
320 MASS DANCING not reside inherently in the formal qualities of such movement in itself but in the content of the movement, in those symbols and emblems imposed upon the movement that identify action with a “total” vision of community; the symbol, not the movement, subsumes all difference. The same mass movement devices can make a swastika or a Star; totalitarianism is not inherent in either. However, the swastika rather than the star became a totalitarian symbol because it urged people to act on behalf of a community that invariably valued sameness over difference.
Ser SEE Me eecea : OUEST ett rt : LESS BOER SS Osos wn ee Sacer aS Se IN SENS ROS SNH SE REIN He eee Poh ee fheEES *Se - spyWISIN aTER seerereney : ES neared eae mere eeelee RESSUIS -, tea . ,OOS Doty aEs a reees CST RGU eS ALS U8asce, |
- | . | | oe o 7 ; op Pes | Peed ree ~/ SaRSe sritsoeiersenaaeaeeeieerestectoooene acee, Ninceenienecheranee meine sriatacecerseatelecenstovecorstorelscatotetaterstptaceretetat'e se rathterececalasscetatecerecaresecysscaceentelwrelersceretarer acetals
os ' on Pry i Teel . a“ 1 . ee eee : . 1 * Se a apts . ’ ars . Farge three OR RRR Oe ee eno or ener ans saga fetototetegnsryets « etatetatstatstahteta’y area aavarh tenet SS SKE saratatatatetnatet fates © Spagherae ee a nae a lereratetece’ssese’ate ces Sasetatat stat tate Soe 2. ‘Loe oe POS Q oeyan7 ' fe ra eselaten Bera Oita. tition ae: retetatatetahats esetetoteetosacteertencetoisenrraeerene eoeeeeher eee satninaeehenemneenee ener enn atescacacececscacecececscarnce mmeaeaereraenee eae Doosan Poth iat : telltale : te crrantuae vein te etatatstyentctat sett tahet sche srasatanclanasctstanstaritvraseeeteNstetetotat tath tc Petrtr Nt at anatotetatetatstatanitntcnetotntatenetetctcncactatstoteen sithecrtirneserncney 'veSEES vanesntoaon .: wel TI ;TIRES SS ER ey CAGtyatatatyegegtgtatctatytaketaPatsPoMGte erofatatatahetetatatetatatetan SRhet! eSSoeetatatatetetatetatabats EN NaNO ieosnrecstotevaterecetatecatetoceiatecstetetanteceoeraretacetatatase rorpceracerecaraceTetevectos eeacececatetecare saree”
TL Sh Mine ek Sain lees;Posessatetatatsecatetebotenvioteratatateeatctatet , geme PEE wo asin UNG uch) SL GU Se ee B Wl| | Mag nein a Coe TTS wee TeTE Be Rotatens eh [EIS Sa eeeee atta uuuncenaaeene remanent One LARSSON SOURas RReteet en - a | : , DO | a a SE ee SPS aR peseseeeStitatstotrtatatonstetatotatatat atataetetotans esratatatateratetaeetatarorntatatat tater tateretatatansssciats
Oe a Hees a i et nate nee.rs es . a See ee a aezB ee Zohnconuemnn a raierse naman SCRE RS aRaan Suamaeenrsnnemennnem ee tomes ee ae PE reper SE: eR eee ee ed eS a me | _eeee Ree ES enaRRR Bee Bo SC uceagCT ae oe -, Hoke oneiCS aSpete Sins eee CORRS Sobactaaaes ORE nt ec acnanar ne : : ne | oo . : | a paeteppninsa a canta sratbcocneeaieseecereseaoureeneettet Case a eS sectekatatett RE SER nateresorecene Pincers ano aces ea ene asec e Oe abet etatavetetataratetetatatet stata Se eat NS ORE
Recetas ee sane Po See e "DEST RRS oe ie mo Lt : a . : PRNRRNS ORES RRR DERE R RT DAR RLSM ER EAS ececeens aera anaes ES av SR ERN EMER ARORA RES eteeaietetst tobtesactetemacteesteteteeteeee Sor RE aS
foah eee eS :meth! ICCD nner cana amesratretaeateneret .ent.ta:tea.a. eeee| oe ee " ee PeSSO nanny Re ceuehen aerationongunarat teres ceceeeteettiens SN ea ES A es ca SOY STE i BEDE oe ote ae 1 a : ; RTS Oe ee ae SAN hance OMRON, seetairhansterenanetetecatetne tate sogetbetenetsensncrecnieecissataceey AR ARR NES ESE Simieceniercermere eer a apgnaeiaetate pinnae ee fete eo eo CSS ae ae seas nce: Ee ee eee San CCL cee : .Aracos . OOS * SEED EES eS ee eee scott RON Peano See eeoe ae: nce= tits sag Eee Rayen PERS RENO ig ne .natn wey Jpnnnaneunenensn Shee 2mapas sain catvaeeain ti eearean oe sehtecetae erees ee eee a ee ee rages nag eS CoS ee ere SRRNRR esiat a . ds IE ttt seeate . Nseee eavitanthinyansenresntien SStam Raeeem SESS, re mess Se eoutte OR Pee Ber SEE ScSe GRRE eetrent ‘pernaanataene ; |ements TIE ES :ewan ESSA RIBS Saunders anne ES none
EE eg IS DT PT en ‘Bireornter Se Rene SN eee ater : RRSP R HANSEN SN CRESS Se RES aatatatatatatetetatetesteratetrtstete secrescent: Snatch totctetatnatecateseintstren setantatnunamen cn nana annnanag esc
PE LES eis foOU eR aices ran thle IRE EE aens ec nos ae ehasattats ter eceaneN eetateeee esatelasaceseeeennen weaning a I UERRA ah Di ggSDT oanSST Bieeats rr bh ROOTES ists (Dttata it hatata See Sut an ESEcontac In UES oe cS ese creteeet taenuianeannganrsretuaann SSS ee a
ladys . folie, ‘ Es ee wee ee Legge I cle lee DDT le eee Sela lentes arr MER MRER ERNE E RE RAE NIC CR ox Se > saatsanerareatate eet itera ARO nesatotatatatatet Pena aia merc nenctnngnecnenanee aime noe DEEL a wn re Dy ae el ea a sleep ale Pentel. : wb is DUDES ep titannrieieeay et ghatahetstatctatetata tet oS shctatal ae se atatatnecnonen tanta teh raeseernneteeies SO as in ee Rea ein oe ee eae eS SRP aoa
BN pee ee CEE LY REDCAR RS DSS IRR EES sen RS SO re {SEES os SEER RS Biecieacnaecnideenaemeuanrca rumen mei e
ree Se Sine cates ae wee oe rn arr Se eS BR ee ee
SLE ARS RED ies oe ES SIEETSIRSETETESITSSPaSS AR. SR eR 2S ais a aaa ER saan Ea ve SSR atanemaneeaane © Sapa Se tare a SU eatehentre cr RMR aie nuMT Re Soa Oe ae ne phe Eas tatt erate reentertoate ee SER RRrents Rese ;nretatecerssernces Pentium RAEN we)me “ reoe aa Hn MBER ceER te . Cee a . . : aES cS LSISErerastaeelitcaseteretacasateconetetebeteren 8 SMS Roeacetate ers i Be 3ees esatacnrenecearane asbaetecesecacenetacecececeseemcarte sedede taaasUeareettneettreeen rete,
ana Be ; ote oe: no: OSE te ue a: eas BTCA Os eee PagSete ee a aesbi ee wet -aennatitiiinen: te . ne vy EEE picasa Ra RAR ORK SRNeee co RRS Sunnemnnnerenmee ncn cre SASL Boe o . Cp aeons ‘ERAS 7 was . >” es “LEER iagiineiingsenennea en SRK ENON Re Crs eS SRS ee: See A NAAN ENN SRLS RAS SRNR R SRR AEN RN MON RUINS erence
REET GN on ho ve WER os os So aeaaa eepoet a “EE eeERR ra See Soars Scene ne ee ne RESTS Ue ES oc neRRR age RRR Fe oooh : Ecce cena enema eo ees Shane nneiausaned daeameunuenetecnteertenene awe wed fa Oe Sg | $2 Lok ve enhremcneua Guiana Seca en sens neeeee rneereerten ee on rs ee ee Pe dP SEMEN ea “ECT es cae [Bk ch nase Oa RR we : : : a : noo hen SERS ee iia ce ote ; 3 tee . wr, Siecereieretbtaretetetetacaetatneete cap eS eee ee CORRES ON ER! : an Un ar : Dates doastregiecareeneaitig ts wtariece teeta aac Wn. en A Bye Sg ae Beg SON cceeseet oo 2 Daa 2 Basnean assay So as 3 Fe Ree re te: on Eel a whet ms : es ez. S| RRR RRR SC oo CSOSA ih foo ES ae TERRE CRUE te eas RS RRR RNAP ot hn SUIS Lote ty tee . RRR RRA RRA SER ERE RRR ERE ear prota? “ees . : ree ance ieee as ro iat nt ae ae es a ae See te : THERE eee een eS Ss, me ROR se: ee . wees a (a Oa a Cee CO aan . “ scngusentaauncnenes OES Sad PanAe SennLa 00> a Seees an Sc ABESean SEN eeae : : om UREUe CERES RRNA } *euros inet: we:sonevensereemmeemeneneeeees ORO DRA OS atuninnneinuninosceuenannin aes .so:nO, ape e pe eaESSE PS IRS ReRU RNS Buubinnnew
cone Coste Aye ose” RRR 3 ee ate SEE ae aaa atin oe Sarena MEMES a gettnarennennntts : TARE ee£kee ee3 Esco ecmmne enna: 3 . Le woe ’ Etat ttn*areata? .Sn toe onSMe ro5ettaaibetateteee ne weeaORrSEneS MD ot eeoasehae oS en SORE! a Dceg , :et aeRate esoA oenoe ‘SRE coe mee es sce aa Jaen’ .cane +e aan CS oP: cman! ar Sa acer ty «PRISM Cae es Bohs OS >| cecbtetareterster .Poiana o) 1 BORER IMO Ss Septic Sian wtp CEng! SE Bee atten eg, Siaterr tanner ‘| ee See sehen aBeets: Steere neces =otote .a.eet :Me TERRE von no ,TLR, enoParsta aa aae Mee 3RRS ee : :sete ate otter EMR LR pgg. eter wer no Do opene aeons ea COC ome hes “ tn a sept eeRSs RINDal OUT sale eee oe et a Bes tere cecatecaratets” ue . ae ae “ae Bee eines zIsrecetete et iRES caeaanenitees osne fieea Se eas aos roa Sane an oe : oe oe co pe RR z : aaa SERIES OREN a Maat ke ag Et Sicurrn a See ea ae Sig 0 ee Sa ME TRS oeSUNS | eS “ = | ue § eee 3 oo SSS Si Sa og Coa EE I MO cee, Sa tn vara ee aa Scacececeiscacetere, OO SE SSeS oS Re SEEEEEESESLEEL zz, ' a SURE Re nece nn tees aN a OTE Bales Oo, OU Sen en aS an — DOES Shoo tage, SRS
:ee 3 “| ;ae:asQ .est : .as Qpees ; |Cag Ss .RCE . . bunnene . ZO Sree : EBON etete |. RR serene enn esEe Aaanace . ea . ieJO StUBREARE ata sent . agege = cece vee PR A sats? ‘ aestste Poa . Jiea Roe OCR aS0d eeeue yg3 Boe :aIPah teem eae,NR oT ae PRE NEI ete Re meer “ .al na tt!me Bsns Rovsracaceretacacnt CEM :esWes ong SEER” Sovess ERR : pos OA a ea iaig aa SO LARS Da Lot eS RRC ee ene (re ot: BSNS SRC EE ye teeeSE RS nesSN, Moet wes ee Ib Sn RE Bien ee te } te 2 OR aetieegreeteter nti) IE fon Se Sal SDE aE apTo apen Roe SU Lane Se 3 u a, . aSige Me BTcers te heen Press
Tele Tee fUN 2k,ERR: Se eeBBR ee ngSigs Renamer gc 7 . atene PenaaR NS te atck mm nea ee ag an airs s RO Oicchaenecnr : oo . SS gees ee eeeee ak 2oea:_38 iyee esa aoo Sce :So we48, ae LOS SS SRC. Se 3aecicm : Saas A eee ras . Socuunuennnneemeareeeucenes Be a Cppeeig e gg ere CE UE wore Ee RM SM Of Reece on ; et EDS cata cena SC Oo Gen ea | ares ae oo SRR CLL | “foe Sees eigen AOS Lt ERs ns REARS go oe ee ce a Me ee Ca ge AE Sees SE: Soe oa a ane JUSS ee a nr Boe re er ie : LS Ss SRR a Ce BAR RE . eo A a nT SE es re EE Oe a Sa gy oe S lesen REM OR ES EO wollte be ee Se ee oT it ae WRB we oan . ney my lobe. RRMMARREN RRR SR HN See 5 2 NO ea a Ca . ero Tah te weet. Pe ae RR ge Se ig. PRR ETMNRIOIN orere he
| TESS oe neh : eee ee : a sstotatarececunarerstocetecetaretenecetatecereteretecnt eal tte LON rae By eR a RT ae . aan . nCAAN eee, RN RK on sane’ offr i ae . ma Joe 2 Cee Uae eigen SON RRS oe a . . . an AINTAECOTELEGBECETOLICEC Coereaer Orta iRaaven ets eM, fate o acne, I ot Cee se een fs OMRON NAA C8,S, ate
eae as 2ees AMeee SEES REESE Sune clShy oe Bees nae Pere lee ia cae er Bee te Eu raw Mt oye EES EEL tienes Ne Seg eSEe nets moe ng 7 OM ag oe cee a Re ee|oe 8 Tecan ve ve SOL yee OS ee SOPoe a wy etB® Tg Og “ge SSSR Se : csmony . eae oesoSaas Be -BE ay eee MEE Ss Coote REE BP OR ES Se
ree~hates asSee MERC SS 025)R$ Sr.SOS Sie Garon SCok : : Sons pice ncee cryPeas ie $ eee Seisee Sethe ge ER gos SEER seceeans an,P a3pea eae Meu wee PESSEES aa ea atieerrnts ORS RS EERE SRSRAK iSe et ee 2 isie oe bes Sete neSe eeey ee eeenen On Ve ge estes SOP aE Be :oe Leal) oe23|IRete ek Soe Ee ISRR gee on; ..oe SIEno een cebenebneee Societies sta aeTES ear el vo Be RRB LESS Sate Se Fe’ ORieiencinenmenreeeie Ses ae SEO 2a we See a ge 4SNH gO CR
POOALESI COE RRR Biappa S ECR eos , ve : SCRE ee a ee SEEPS ELENA RN BE a a Eixaneescies AER SE ASO SE RRS a Bo ee i5RRR Re iSiaeueneg i eee ar: . BS core = SECA s Sasspeer Rese Sc Sr —" Peseinen aii amore oe _Ce eeSR ees Bae ae RS wae [ESTEE ASSSERS canaaes =h9 ERR RE . vet Rio wt Se RISER us 0aCIEE RRR IS: : thnttt 4 Rana RP ERE SNES RRRRY ERIN sReutrommmrprorianes etn etatsRRR SNS OO By,cisamn ERR RULER aaa On SR SS : ,. ae . |1me [= iaee ere NT RCS AN RESO cee Seah SESEE Rech Prseen rieisibesureeentereesrescenstrects
SESSoo BREE a wee et 2.ERRORS: Sh Renee a .Poses [EERE SSR RRR Meee ise 2 alate ENS RSET RRR a Tee PIERaan MPEGS SROES - ee “BR ae ao RRSceteecacere NN SR RON aR hai RE CERES Coen Oe a nt Oe ST BPPLate NES wraantonennenennieaenereren treesSe
2 : | oe es . Borcmmnenuns Senso Cae x SRE ae aes CESSES RSE Re arteaeicra
Len eh UEcoe SR Sa Reegee BBR SSR cteshtaatcrtty tte a:: Si eas PaReeRoe ROS SERRE CaN ee SRR es ea patent wiles ER e Spiinonirese Ue res RNS SE SERRA CUECEEEER ee Ree ee einansirrccciierceeeors eaeareas Be“ aeakeP SERS ALAS a cenit ce ae Bee eeCo oy RRR - ROL RePeEBOINE es ‘ a oo . TSoelapesesecerecasetarapemaperaterereree - : SE A tS Eo a a : earnest seater reneeenteess Sor ios: ‘Cees 03s ena SEARS ARR Sane ne SEEEERESEE ek huis 2 ak eaneater nenahate Repairs Nee
282 RE LR TE er SR RRR onto or Rencontre anya aan OCR SRC _ a Se
| as ORE ae RR ox: a MS BR erscaecceeeceeene gy . vo - wanton nla citenchreenennmeoeete SRA is sae ae eka tate CY SE a neat e a Fria ate eS SAatagecenerervtoracateca’ sitet ereareenear ater ceatar oN ateras saleraretererssesereneraneet,
ae See oe Lee : Teliciasnetonseensenneress ee SSN ORRaeeenennen coe ROR satan SERS SRO SAREE aoe oR R NY REPU RE RESROO RR ; as SER ee Pere SCRESoeRe RS eee SERRE RE DRA CAPR eeOER eeoo iks2..es aae -ORES |A BY Serena ccnp hin RRR CULARREECS. CARERS ear BR I CS SI ERG cececacarnseterenerece
:oe;| -7a .A:1ee 4Ao oe RR i Sa Boos oNecaniaene pene |ON, Recrerae niece a a na PER eee iii SEEEEES. cepa FsDapeng) RNsee eas atacegusoneeetscsesecintgie ese any BySe PERSE aRRe RRR >.oe3-|a|7-|.oe : a"SURE eat en Sanam see SINNER CESiekce. Soe Sa a Upset taste eons seacasncncertonaereterspecececretarseeen CRnD Ra Ww) ie *Eanes oo Peas ar ran Soe eee Bac RE peas BRS ee jpe p ‘OF [EERRR Pande neas ote RANE BRCM Demmi. #0801880 0See 206-8. 8 nace Boe SNS a TO a sedatatePatetcefada Ee RE Ra ge por i‘ ne |piatinatetotnaese Rr en ee eearecarasorsterataret CURIE RRR errctarttnetenntaeageerenetg rteennturnmeetAmtecteetter ntee pean :|:Seite Re Cee E RARE RAD oyentn al nace Seams ase aiaR ery eaatahet at tatetetnt tae car tratereataceeniere RABE RAD RNC NAMES elevatececersce x- oe S(2en : : | , EE SRO ane te 1 SEintrt on RSS ROR oe RRO ee RRR RIS aretarecerenesece :B:|ace | aed :ae es :oe ::-:Met: |ao | :ore .“SASS ES eee sae eSBEES oa a See ee Be eSee Bo) aeoe 2el Bos haehie ote’ alaterateteratetatnterntatersta entire ERAN EMR RLS rast cererecerend, IEEE AEP OGRE et Bg See Le ; we : Se lee attest RR Se Sent 0 CC RUn nen es Rasen acs ean cana aCe BS i:Ce oe . S mores “iigenuaeicuaecenmemnneann ans Pants Pat ae RN, siete) eae RARER SENS RR enishsntenenn aun ean A soetetrastrtenstestieaeietetssoenace a Stetatate! | ae i Be “ Cyn Be: ee Sean eens am Sn Sree Sein crane rates RRS
cos | pe : a , ee ERE Be es es ae , -_ ee Ce i Se
a :|7aaa peeeesSF Beente Sy SSEEERECEEES nee eneeae PENS na a RS salient:S Steleataety omens.anaes AORieieieienrgteteneteiee snareLigier Sea enna rie ee ie ae aBOE a | .ae TNE SRS meNese etea eceaeatelenecatess shoctteleatecer :eo a:oo, pe Ss aag.a:aUeRet7SiSTu.ypee Le eee ON Daigenr CooeTes AaB oe Ua : eotrarararencaracereK : : es . . TSLD Ieee 7s Bos: SESE eeERE ansERSRAM rt AOR REERS SSANSE reattsitn re a . 2S Ce :deve RES Ea EE . BD COC Te tauhutennennccnenenes PCE ERR EA AN SR RR RAS ME SSSR SERENE TLRS eRSeater Ea! ce Doo Le ee Mee atte te Bo lee ri a no ee as . Saree EEISESEEC Sc chah ea e eeet ne Ree RRR RE a) Selec RU atetetete hatte asetaretecaectonstrecasacecetpeentensrerane ORE NS SRR ESS RA
-7. | ee poe | | Se Beare ace Raber ag year BSS cs ees ane Siar a assun ae UR :ee |is gE Siac ose criostisas ernest: |— | ; = e(a hed— |ene , i ay|es TED SSE ee PURER RRReae i et Berens roefae Ee Ce ani neste ceesetes TESS RRSsis AESEN DBRS tcicscerasssactbocecesessceces wee aTgDe Se, : ORs. : Be Soe SGIOR ona coi RSS SER ene cee , | SDe | | - =OE ; , esUR “hierar tsA aos SUBEE Ehtlonncacer QOScane Sachicicoanep Setatatotetetatety srtongtetatatatgtatatatetetatctetetatyeree redetelecatetetetercteretetes, ar: :BEES eeSeen onseen {2ERE SUA eee eae SEatari CO eaneae eee ade aR SORE CE riteaGE. aa aateniaben aetna cri
‘.
oe Peete fe oe ee SRR pee| ee ee SSaPenaeus SeeS a a Screen: Ee iim Feeae. ESO SRRaeSaree ! - . . : : a oe ess . ves o i” - LE DOSER SRC SERRE HOE aleleta late ete tafe alate ates etna ROAR T OS eee SERN. Ss sce'a se: SCR AsTe ATR Torm Bake rene ate Sottp'atn"ate’s'erenssess's. seagenanayanarers ev acorarard scecrcetuce’ a pteTecacatrteerlenteney Kee netenetaa*araraverenaTaray
: ai CEL een tote reSed : Poa aa as ee a areecae ni tu nanerasueatnevarertay earermemeceprtetee Sey: ules iesoars ee roeeePence nea tt obientuverutiecddcscr eam :c RRR Re
- Poe eeUUCres loos. oe ena ana: See HechkSohU Maer eee ee seciicre eR SRESOSNRE SINSS. Ss. Sai ae ese ae seeegoon DISS aS Tn SoS EDS Sa SEEDS.Sots ane.2 Pe EIR EN : OOOO OOOO CORNER OOS nod ahaa arages dn Ae OI anata ane oan aniaaman. ORESarn TEREREO See tae aioguwbnreae erie sqarennenennmemr Ges eka keac eee oe ee: ocrsnaco RSE. oeoeeee ee Teepe eee (DEESSo EES ge ad he uathcatges Bk. a7 a wugecnsuctens Sy ae STIS Pongiupier naam ees, SNDU - eS SERS SO ENR SO adunce cuigencn ooncast Sonemae at “LLSRneankeaine TORIES SS Se ea Sea ok ane ete teeee ieRRR TotSe CReNaDENe saan ei odd SOaee aeoe RO So eo ie . eiieene IS OE uhCe peste Satie sear CRS ER Scoiiendhiseuun antannentey . ahneman TENE RRE sSa 1Saweaneceh ceae farsa 8ee"
pace eici en heweace —— —“( CLC : Reo nas oe$eneoe ea RE Ra DEEL eee ek earreny sedtenseoncncarmrte naaahaag RAN RMN ER RENE NER KD fear wae
.21, an laandfrom IElia 1 C1AJ Left:unknown, Figure 47. Mila 935.7Photograph er | eet , ° . : re gure 48. Niddy Impekoven D :1919. Pho ight: Figure 48. Ni gefangperforming ogel, Ca. tograph by Hanns Holdt, Munich, f HB " Mr cas 1929. s
per orming Tentation, Pari
, plate go. ,
Sees Ne eeNateOe oon . OTTERSCAM tr Init eet ttre Scien GMI ES LS oe ita eas cuttetenennentee
cee een eee eee Eee ta tose t SHCA ANNNDEETTE Seats Tt MEDHUMTE SSM ATUCOPD aD QUOTEESSELEI’S @UEEMHNE wthtgtyels cteglanenauittel fe .
eR Pa RAD a eR 8, Fst SRR RNR ERO ROAR M ASRS SIS BSS CT SIT TR Ga
9 IES NAD nearer seus coraceccsletececetr ptaterececeterelatacaterecaictasstetatatatatatetataceteretateteranatnratiecctarecetstey pete Lae
DEER MEN naa aTaaT a 0’ nt REE DR RRR ERR RRR RR REESE SS SS CRC MTELONLS'', |, “ONO SE aa
NMA RP RASA RARER ARDY .9.0
Becca ele aac acetate! CONS SNS SP REE N ERENCE SE De oe Or gets SERRE ENR RAR EK RRR REN ICE
‘garage maniarecesinharelacassrecesoeuassstenracscseeverteasssottercorseespepeasern et acaet’ 4s SOMO MRS etatatetatsts'atyPatetetareta’rnytarareieretatriatitatsteterstscoreletiiats Barheaaiiitormaneeretcteretossestetstacctoectctrsstetetsatssstitysatytctstatsestsecenestcteeohihct tot COMMA DBRY estas, TY carenecerartrececnrececnecececicmeniegusainaietiec saat oer ea ese ORAS otaselatatetetotiorsratetetatatoratetetetatetetetatetal Se RA Pleats 2 SEAS RRS RR AN oa MASON RR
SPER N osecesecelasacecececoselocecasecacerastyase lec trerarecestoer91e,0,90) 010-0 0008, 00006 REISS. CRE Ae) PER ICR RE I I aI I
“RRR RRS RRR REN OR ARERR RRA RR RRR RRERRRRRRRE RRS oo NRE o's noth AREA ARES ERR E RE RRA E RRR R SRE RARE
Meee ecerecrrananneneseestoeneenteretenscneteresseeeeeatetctetetptnatshrheatst hc ROY AUMMMBRUNES ater seccecaacereaceterenietensiencrtser eerie we a asuva tata stu sratsce a Teteretataatatetet etaters a aletaracetee’ ie” oie PAPaectacenecparere-seerrasararocesocorrsrasateoneeeetermacaeeacieeciee SAI boaresa a natire aerate n sts vars a brats atateatste’atanath ete cnet ens RR se aESate EN tar eeatetetstiethtycarenacherernrerreetecetratinerenreetetnestsetettte RRM MMM
SRO clererersiaieen README RE RES RREE MERE ROR REN SN RENE a" ov ae te RRR ENN ORION ISL Na eT ¢ e Tee Riaeaiarerenitanaectatorotitererenetpttanatreeletyttetatatstatefetettateta'ees's eM ORD ct atatceceetatccneetotercentotonrtesnentireeieeecsceynatieeenes
saat ned Sean ots rat eteheneeate nse ecta te tate este teeth tet LP O88 Sect 88.9, ee RL => * + YC SEDI
Bt reereveSe"cTorn nie ete ce tr cetelatatetetatatetatetegeenzer lo Te eles h ib DD OTT EDT Pte ae nel SO: SPREE» ORS, ROSE a aa eC ag SONNE ORI ED 0 CEE SOE St ESE SR SSO CESS ICSE RLS’ SCREEN 7°, "0's CUE SOT RRR gs ee etal elaee preheater tcoteceteters cote etitenatscatetenenateteteteneg DIO TION IPT aL Ii Ss : . Scena HRCSESES © Soe: DISD age eT a eS BN ten es et en Sea LINEN TnL Ea LICE CO COUSE DECALS SRCEIRECEESCANS., °-- SALSON”..'. 5 MCE OSSD AR ROARIISSIERIGEL DS °.°-->-.-,- GER SESE OS aD ae Boerne 8 ck als lel nea sree electstabil! ree araterale ol CDN ye eslneice Telleta se ee elleSEAS. ese Ue INSS nnsnRNA Tae RD nmeCOREE De a tyCSCI oot .EEOC . . MTS : Panes ee SSSI IC SEDO SECEREESCOSSEOSBESREN.°, SP EEREESREIDERELISO SCR»“© «SPOTS S. 5-«ure “nc> at rts CRESS aR SR "= ID.Sac *-° Sam foe iis’ TD sSoteEaRREnEe ey) -"-"0°~"~9-*2 94%." ,° SIRI ert Sn©en Penna |-°-.~.-) See seoes thee Ts EPCRA: - . » Dee -*CORI CII Iara IRR arR eae arParererar ha See ree ite Ce En nea RESERRAMPEEN? SOMLERIREGS SERRE CARRERE SS Mel SON: - SSEERCRIPEMMEERS >> MBRSUBIIMBER 90-07 -o7070 "0c ono Nees a °,ve , S. R otalsee ce Snr « aRik mCe+) ERED ,°-*RCRD SHCSRRLROLS SUCHIN |BR EO Sena hes eae ae RR te : Be, aoe eae a1°. “aEU 8:5,. wae aR S.-i Te ae9 nn8ORR NR ow vel. “ateta .0 .0IOEaCORCRCREDINC wee eae CAE 0” > EEC raSEE COP NTN tae AE SOME i StS? 0 ate a . ortee Ceo ss OC etete ASE 6 wd eTRR ee ve . 0-0oe 7 OK + .ge el Tet eeORR ORIG" 8-8. 3's 0kERR OS sees oe eae . en “ SIMMER eee tates lon + * aE ON”, -, COCHEDENARRED, -_ CONNER catSRPSI ce ecesecepe are ERNE tele ara rr elec acaeasyamateecect es rele lille enleTelehealth Tee NB TS ODtele. i RE Sg Tg anCR : , ©CO RSID ----+. ---« «Se DESO RLAL ERR OR REDREE SERIES ICGPEDRRSEIOICY 0000 0 9s 05.. ERRERES 5-0*EE CSS. Oa : me ane MEN ge oafiete ee SOON MOTE ree *. .. ps eee eeessececeelotecrceteresecce eeeerere eae CnC”. *.< Oe pelt SPR 8we 9.1 LICR, NSS SO aeDS,” an ON iPee pl: ets TERA Tiger : Se .os oa Deena ’Retacer ss steele TotaeR tate . PRERCnea Y= : annecet SORMEPIG #007"a's Oana bc 00,009.00 10°.'-0-2 0,7 US SSO RRSRRMESORRDE SRR ee .:oe aera MO VTATCS pele a lees are oilafice, . . an . Sot nt BON enaceret areare eee, a an TS SETERSCS 93-30 DUC. Dt rece SERS” ‘e ROC IERSG6°n7a"s"0-8 CRISSURDRICER Af ee alae 5 Cee eeebatten .Le AMR ee ee : ait coe Breatiste ferent eget “ty SENG.
SN : ere cn or. COO oSSS Poti te nits «ORME ace. ORRCCOnNTWT RRR RRR fencer tnaecrsseetenete ::. .Othe, wie onl. bagany Nome ‘. ‘wo Bigees Lotte LON pea hash eae Dae wtee a:Sea RRR IEROOCROE Ae 2 ns 5RRR - RR SUE ETseYs TD ae corece o)SORES : PPK - : Dhhi Saas. Sas see sie .a we CRED ast BN clare ec504 ee eer ecRR ST rn‘ascecocesererectotsaiece TDL SSR CS ceca ace tac Ge esors tite eaters oe Ne cae DURES SHOCKS NGF BN COC wa ,CQ Did bat tse calle eset RIOR RC 9/1 RTa*MOE -Staten : ve :: 2°, Saeteaaeeenana io: ae aoat fate . EMDR : . eve ot aEDS eae
RRR ERR een Wate RRR te SSPE REIS EMEA SEREEEIEAES” 0c s"0-0" COENEN 9-0 0-07 ¢70"8Ta Ocereco 8s Ta-eht-4, OSORIO oeaeIRahasBrin; calls . Fee . .ten a rieren eaten °6°20s"DMR see eleley atettetely iste reelecslereterelno.-B"r > + aneRe :3x2Byahs aaSS : CMC ‘ REMC RRR Srnec cect: WMA. co)ee:aTorte .*:oF Oe. sce De aTerecetete’stetateretatetatatets tite amare a5.;q4.‘t 1 cf EER .aceace ndsg BS MNL ENS syPatcectctctotatse.sase,? ene eet ore AEE BoA UOMO Dac str*stocasaracecererecs'ats eke ners Boe BR. POATES: Br Seats soarete‘e’srarereceersres Me LEW ONC aoe 3: Mee lela”. RE”ceRS TSRssay oe Bic Sheree o's-s Sh MMMM sce ecect“avetese‘s's, Sta.Beet oe is eee wey Spsteesititasssrstttev, rete ree . z’f 4%34¥Sec CERI a ERE “ee vue RUT EE RRS SCR on ee RR ER oo a id vo atnvsereseres PRRs sea'osessts cele =S SuepOR eRe Tope cRaRR RRR eea.+: oe wo. Bers sc-n-a'ss-s SMR RRO cease aeISIRI ae a SDR :ositet os RCS ee . we Ee Bi ie a LOMAS re. . poe. an ¥ yee te nab 2 i ; SRNR Ee: aapenes.” Mate old a { 4; oh SR meg ore, os I Be GRIN 1 a Sons ee ‘g se AR OM 8 “ ; wea seeettettoraraneteMatetrtetesetatctantfatee EE ae a Owe cent .,.Bin Ste ee : on erat RRR ERR ARRRR ERR. oe eas 7” ee 4 reeennenanae tatatoletytacatatetetatatitatetstatatetetatetsts GERBS Bne1.18 . : -R. . Osanna BERIRRARRR RANE RR RR RI, oaohe eos Lo .x:iene i 4 oe wet os ETS SE ONS HWM. + ees a Se Bees ee AN Rereccte eereatietrereriienenicanese aire is vente wich :eS ausae LANE : Br'ona'stacara’eSscena'statt oatetatetatatetatatetatstatntetetytetatetetrtytet anee Sea SEORKR ROSE RRRrtatbte’etatotatetatecetererm NR LONER ghragee, -giee” . legs ates a Ms Bek te BIDS ”we yc Bats cSatctesstaratstecatetecanctetatetatntetacatancantstear intecatatetans UPN one :on EE cates OD REM ARRE MEERA TENE BS oe Beg rh Iieace . cee ct eh ty itr 4
3 ee RRS ON, an REE SE ee, tee caer ve :
aaa reenter “geet : peerage eae vs EES SRC 4 ‘4 WCET 7 SOR. SSS Ra RN ER SS SR aan TRABEM Eo INS y5im Da ce URES... RRR RR RR RMN AD Foo ©lala 00 bE SRug RAE CT .Taran ENESRERRARS 1SRD ERR ERR IN ORK RR ARIK NNBRIN Serinse. SotiescelrcrasesnetrectensN NOS SST Te Taatael acta £5 atOGRE St a ©og «SRG SCO ROUSE OTS HR Pe IPN ESAT SESE 108 SG REBT OE SCR OR CE WOE TG ICT La Ge ea ER wr Se OE GC Ca Bae DUE TIED ES 8 ERIE SRE Oe DEE RIe CAD ELE CISC DO aT ISU ELUTE 6 RoE Pane TE WETS ROP aioe ep ge DT Den ely Ne ene . toe . Pe:
MORES D SE LONESOME COCHIN AE A A TREATED ALS LCST TD0 SOCAL STE TDPRI VTS I CSA SO CCE ETSIea DM tee na alenttteeen cat sod . rs.oa tee : a Bc Be ae aa eae neOSE DlgTDD Tee TS Dea ala Tae SSAaT Te tle STE eeCARR nha SEL De CTT Ce Teale AeTR aA DE A ETAT St la SATE CAAGRU MEA gaDesa Ly Tee obTey leisaywea!teow veaenoe Bese CAIRO E WD DCS BE Bele dE LERNER O ETE ARETE BEE EDP TATALGC ED CRE TURES AE ESLUCOTOS LADO A LE OTOMCUAURSR BT AEREATMLELATSTETE Ta, GATS GT A WENT ete lae ag, TLS ALALWTACW AWARD I PIATRA ORTHCA ACS OOD, OSLBTOTE TE ACERT OTRAS AED RICE ORL STOEL CALE PATIO RE ELUENT QOS QT nella Le LIE Ge eT se . B:
Be sceceletscsteletetatels a ALC ge Dealt ely te atelier ett S abet letaa lees ane le Da aa ee Lee eA CE RRS OTE Mea as ea wala ea ata aa a RE A eS tate te abel tate te se le rises terete a ate ote tg a alee ele ce ete teen ela Tee eee eae pre EO tal ates ina. ‘ : eons a.
| ERIS sea Serer case sae ap eSceeaE OTe CMIOOSRSCIECINSC EE SESL ESTES SOME RIG NODE SOICAESRRC RR FORRES SESOSESEIRS. RO. 9 TRICOMEOS © | MIL Se ROSES ER SAMENESS EEO SOE IL IELEETR CSE SE SOE ESTER LE TEE RN RCN PRU R LAMAN AY ORR EE RNR RS APR RES RNC REE bo ten Be he ceca Jating he th wo wee :
'ZERMES DEERE E Eee NER eee REE RARER NER HSS Re SiMe TUS MRRRES AUNT NSO URERS «CRUE CERES Tea ERES oy SEMAN ELEM SREY UNE RE REMM NE REC eS EMER EE MEMES N NS CRESS RES RERER RES Ce ens eS te SR ee CRO celal Te eb le ele ce tee ae an . . . ‘a Reviecelacetalyelolelace tel el ealetet ele loots at esta elec ieteeteta lets setae aece later et ety ee Sia etre eae eatetetete tats cage a eae es le cle etptetaatca scatatal ceo) le aie ela etal a ele a elet ters ety alee Cea aye acy eae of Tag letetate state stele iyatatels cstatee ete ees! feels ok te dea Lape nt a at eee fey sete le aps or . : eee ooo Pee iteRa rnerle ot tenets sete Seva Ieetac ACCSecSieh OISTOSRRR 15 Soot SoaN NDEI " .Sa ‘SSR ane RRR ES RNS RN Ae RESPact RENEE SW et outaARDIS RSME ESRC RE RSASSSODS SEAN SESMERSIB 1s 1-0'0-0.0 RORY BOSC SSE OISSRC SO OEE +» CRS ICTR NORE EERESEAESSEIEDS RIES iS SCN SRE SCE SSESO SESE RSSIERO CNSRSDE SRSNOISIER Ne SCRESeo SROSC SERED ESE OMIEC SOSSDS 8 nS fesse Cele ta~ ce i ..:an : :3
“Pere ago aE ie OTIS SESE OR Te RE OR COGRRGEELS OR TORASSESIES ER EERO CS 5 Not '0 NORE, RO DRESDEN cE RMS EEO OR NERROE ROR ESPRESSO eRe SU NTR SOOO ORTO TS OCD OT CES CREUSET TCOR ENC «1 Sere ES EE SI : toe ra ees tees ‘ “SERIRSSORD seen an Ds ISAT SS I Sn DIE aOR DEESDEBEN, © 1 SEIN nn REDD SOE SCRRSUERSSSEGEDC* SCREEN" SAR. RARBG BIRSSRERS RNSSIERRRESL NG © : Sie Nai tonne Se IC SEILER DRCOG COCISRERSISIES OD YCICN SOLER RN RR SCRSIRAL | Seis a a TARR CECE EO USE On 00 0 CE I OU RETO OCA TREO GUE EES TIE CERNE BURA SG EG I fF CECE Le ARES UR RRS SGRREE PEE OS OSCE a ORSON 8 at ‘ , coe 3
See ARS eeRis Sel oeREO ea RSS, * oS RECaSO REE ROE SS reMSGC Bisa ce EMER eleTaleteale ole LsMSPS alsa Teeatat arabe ta eee lalncely ve Ta ereSRR lv aSC gaan ea ela Tels WTF Cole setae Eg ee SSSSena erase SaLCS Sanka SeeEea OS SEED seanSER Oe aleROR cae aEitw % MSS ee PRISE array ete ee ace . OSPR IRRS aeRE aEEe SITS CS OLEEE CEASE ESCO ESE EENGINES "0 cwYSPREE R Ss TSs's,¢ PERSO SEES SPge ERED 0c“ a ERED DOaaSDSS OSE aneRM aE aRE SOIC NOSE RC GE i Oot TaLER CR Dioce esaa os oRafo i sae Beets SERRE RMSE OES MORNNSBR No POM RSH RS 0. RNR MSRM SRN RR MRY CNOR MSWRN RRONMMMEMEE CCw¢ 1: CC Re ae eR) onesie ee 5-1.) SARE RE RRR *--..") Sane R See RR CaN Ree CA RR SERN REM MES AE RNS Aah OAS ese RMA RoI DURE SLSR OO ce 9: ee a ett Oe ee toes or er.
CANN ORNS oT CRIS RCS ECSEIS © 2 s\1-e 0s RNASE ORRIN SH OW MIR OG SLE nn RIO Ce AM REOSESEO Svs v0, + RODE DCRR BOE A COON CR CSSD ORES ER OG SOE SR RBCS EES OS ORL A OR “seer cette: et tat tbe ne , “ot - Ce -
greenness RI annoER aSEE GRE SEOESSSSOSSEOUICOSUSSES =~.” SOSEARRESLOERCREERSE RIOR RERSSEEIREELc-”-OSCGEDY-SSRBSOE RSE UISGEISE CASS ESSSEEERC >.SeeCRESTS HRI EOS SOROS ete itn 7 ae : ae PARRA ROSE ERR SRR REM EERONDE RMEREREEESRM ONS. ee RRR EERERAK CRESS. ORR AEREMEE SERRE REST SERMER | '- OEneSC . ta ot : “g. -¥ SERRE AR ERR N IERSH SE EROS.ES’-*1.7'.-.. )-«- RRM SANKAR EONMMES TERMS REND MERCH Y vr SMRRKRT. + SS WRAS 6. CRMIRRRE ©) 0OCKs SSS RSENS HSE I RHR ESSIEN eee RC Steen aed eS CET eR oe PERN le re REMY RIARAREE RRNA OR EMMEE : |): ORR Re Re eee RS cS Se eS MRS ERM CRN NRE RMR SRR LEMME MEN EIMS ©, SBM RONSON ISOS AEROS ECE SORE BONO DSO OEOT SARIN ESE SOL SRSROSIS DCSE MERRIER O17 AOC ACB De I a San ne : Dit RANE RE MSOEREEREMMARE MADER... 1): MERE OOE RENN SESE See Cn RA aE RENE aR RE SOCRRE ORS SR EMRE S EOS A NMED EOE BM ER ERE M RESTS SLIS C5 S03 FESR ROR RSRSESESOSCSCIEN 27. SENSES RSS SSL EE EEOC SES POSS CR CE” OO SC oe . : 3 SONAR CITRIC SEER -taie’ "eos: ERs «- oS RG RNa a anc aa SEO Pa mR S aO NPD u EO UTS cn SSE REE ASN 9 ES UE on ORGS PE as UE SESE US EPSPS « SEER CERACIE Os OTROS OT TIES OPEC UEOESDUESEEODS® «S'S 5/5 CORED EER DE RRO” SU URETOC GE SEEDED CEO SE CO
Rat en Neen SaaS SIP REND Ces”. YR -----.-1”. SPS IRt RTs Sa DEG 5 a nna SSE SSRI E SIRES. -- SSAA SL RME RIES ERC SERIE UBS AESRSGSSSINDEY 68 HS RN CRE, Se EEE RAEeaaS papain ranEaTES SITIES SS EDEAEOSESSSSIE 9 -5 Ai YASIR te Tor a BERD SR ERE NSN AREER"). MR CRM RR RRRITION Rees BEDE AEE Ne ca ToD OB Te ete ia tiatetalegegehahgegeeretet 25 EDD DCE NU SELES EL EN EEE Gs
Ba SS est ns OO ORR eet SOD Ans oR RRS: sn ae ae RAS: CRM SR OER UES eS ey a SDSS ee Pacetacecacaters eMC Sts oleae TUE Do Woleretgtetatatately etgene ec) SCID GUD TD Ua vel ie ess
Be on Nie RIESE MICE rose NS Sle ENT a RENDER tna *sASSEaS 0 he a RE ORRIE SAP SRBD.!* SRR MN SAD 1 SAE RMD UKE R ER ERRERE LAREDO RRR + SEROMA RR hae eee ee RRR eC fester TEI ET ESE EEE SES) UST es
Rrstneele se as : vate deen cere eR RR AIEEE SLES OTT SERRA SSRIS ABD OR et aes soc RRR ets cce rect eggtetesgeeeneeerettr ese ROARS... eae ae 1 Sea Se SRR OU TE EO GNU eens ees he el RRR SRN ea ONO RCAC ARERR SRE MS ad sae SRN SERRE Cn chs RR ORR OR SRY seatatee tah ASPECT 9 oye Laat ea aac acec eer aca ene ea Tee Te De ct eal boy
Saree . TPS PUR IIT SOI SIREIRI IIS e009 sa Si wo CES COI EDEN UMN ONCE CORED, .N. -, MONSNIN #00 RR eae CRMC ae feos ee 7 et IPS nso SRE COER OC SCOR OR ST ob oe RP Sa aE, 5,» SOD OS DG I IO OC Bosc a ls wpe : SEER IORdeSCS a.
ISIS * iOo ee NS Se alela icici ae RE nnerSSO ier arES etySERS erate ne nC GIGI Sea aaa eae 8. RCW. Tera as kaaSetatate aT sere a eee we seafeaasta eo ae RO aaaelalaT el eas) os ao i ie Bn ae Oe OOeee at Oe OdRa Bae Oe elelsleyegan . 1eyetet Tana Walaa..”.” lel alaeaaa reSIDS e 8ULL areaaCR alela gySSE 101400 I IeOCR eI eben Bane! x ae asia an ROSE ROC ~ ETAT | RESET aeOO SOP RUE DOL aCe Iaaa eae CON Te SUCARRSESESSSEEESDSS can| ‘wlaleleTstalale rss, 1 a RE eeeySCOR PN IPENS ENSana ROR IAMISEE TAS IANT AAT TARERnEEE ooo): a Ee RIT aCOREO aT SiOe er ae OR ieeat eat
en ita EMRE WW One SEED MODERN ERO a Ohenesna ys iere sie sorter ccs ee M2id.!.' SER RRR E SAN ER ORR RS See eae Eee SERRE AS A NSM KR MOD 80K RIN VCC RENE Be SRSEEE Se IR NCSS DOSES ESERIES «057395 8,8-2 9 P88 ESOC NIETN Ce areca ace Colac ec a alee ecelae lalelalecaletacassiele ec atace Hees wate . TO a EET TTT re TROL OR eS I RE Ba ee are ata’a a" p"e"e*atatety sa", ee Bieae ee See een ae) een Sst lale sTaMnreTaee7e’ CE RE 2k TR oe EE ESE, St EEOC MMAR OER ene" 0 "98" pss" eo e"e°a“n peeve piece are BO a e's ele OMe tp ace ee eee een Ee Ree ett wig ttge oy aD “ COBRA ge Cag SO SC UCI CLIC CCS aR ee AN TELE CORN ES EE COREE TES SE ERM Tee TTL Besser. hsaae an ns x ea es ORR NaNO ONS EEO ERROR E IEDM OGUNSERGMES -6_ 1s" RECO ORS NS SC SC SP RII WOO Wen a MAE SNR ON ee RRS _-ES ° -SOeOcue es: SEE EOE TE EAE SHER TC a TELE DT ORE DE NET ot EI St NE BP SORPAE BPa Tar a6 a NC ie ae Spree eneenenrar apne nr enna an tyr." "8.7471. "27. ultnv stu Pma ark eee ee heer 8 oe. Sene ates eametg®, ele *, . - *, q
Saeateep eae. sn'n sa RR REE ER OER MRR MEM ERMAN ERMA TRE MERE EE RRR RMR DR ERR EOE AMER NIORTAI rotor cea RE RIDE SEL ERTIAL SSRIS IRIS MC SIC EMAC SSRI See Sts ERE SESS -
* "SERS SSRs at se URS RSS SRS Sasa SOS ESSE AS SERINE SSE Sr eRSSSSRSERESNSSRSES SSRIS ORE RSS SRST SRRSRTEIC Ass iL SRO ROSES SSE Se SCRE SORENESS
toa rte 6! Ce Se ee See ee CORSE RCN ROM ROE Se OE Se ROE ee eS ee ee eR ee eee eee _ Cs Cy ¥ a o OIC a OKA A a8 a kn
Boone ae neta tara gearetabacetaeatatecniecnsegopatbetitanatasatesatenececatacetated matetaloSeeceatataectateretaeee fer eetctaytanes st afat eetate eta tihae atee tates A RRR RRURRAKI RRR RR RARER ERE RARE RE MERE RRA EO Ans) HARARE RRR REE PE REMEBER ARERR AS
ROOTS OOD OO RIC EE RRR Soe ELE EEE EEL ELtOUe TE ELUGELEO FEE RRRALE OA Nae ERAN EN RRA NENA HERE REAR RED NACE AS LAKE ENE SRR ERE REN ERR ARES
Bese nes tae RIN RR aga arnt aor ach RR RRR AR ee OR RRR A RR OC RR RRR SERN tens oe REL SERED at SST
RASA aieScPRAKER RSEWN R ttORE RIN TARAS E ERNE SRE RARE IE AERA MOET 6.0 00-0eTal PRR EER MEMcal SERB tals ADD A MRAM RRR A Hecatcacacerece SE4 Ta aesNhe PUN EE RRR RR RES ERAS “4 “at ee Sak DT a 5759 aa te aaa ate Wattage ta, oo RRA a GT OEE eetER a stata lelaRRA tdtetetyee in| ar, ra 8NE NnON SAPP gM. 4748sTs 0a sienetgathd a enor a anneER gra RRR wa ataRR Bain cect ata ean eam area eeaed sceeeeeacrtacrceia tio..*teeee PRA RS AR Ce TE ere teIETS eects. ORSraORR EER RRlala ERn tay EE SSalate RENEE RES RS RRR ECS Nantes UT SSNS SORPMN tt RE RPRE ERENT RR REE ene heny taL tare eee ereera neeae,nen nee nee set ee rues near are uiessielrtete ettysclnieresbertetetdsiseatteee ema RRR EAU RRR RBA At Heiss PRE RL PREM ERORRRE ROR RASTER ME REME REEL CARNE ERICA ROE RRR UREA ERY Para EERE eR RE
; Bastarache rena Noe Cnr RRR RRO DR RARER BATA RR TAR URNA ERE Et a PARR RRR TTR eRe Le RC UR RDNA TCA he aah RRR R ERE HER RRR AM BT RRR RE REL ER MARANA BERRA REDS RE RR RESETS
eR RRR RRR RARE RR CR ET RS CoOL RAR oe Seo RRRRER ARERR RENT BER AR ERNE LEER DS Ob KOR CREE ERROR ore RNS Set eee RR ibeiaresecece cect REHEREREE RES AMER ER ER EONAR RRR ERE ERE K EMER SOS ER seateetetettesecaltatetrietatercieernserteyst Oem RR RR ARR rer eat bee ee tet ereecenegemeresterrecceeea nearest ste ene eat Srrenresersees Reman Sverre retresieerespeacavereceretecasactuernverrate-geqcenteartaersstetteetageestrecr sitiscarersepepeateteestetieverencesastrectetrecseaiats WEIS a ulddateceitereestecstrcssstetersteted ielatetatitetebasetetecstrrsereetecettavecacatteoathcheteceticccaypelecter ieee ects batntumitanrmeeneecurraceeerarertcersenenrerneremieerciteriaetninstststeprennegeeetetet artetetetetenetecseensetetetesrs seeeieeetiiciclsiciee sted teeieiannhinenenn
RRNRKKRRK NMR K RK KERR RRM RMR RRL RRS NN NR ee eS Mee ee ER SMES ION SR A ahs A AE OK eet « Rae ate ERRNO ARRON. Fre. : SERENE SEMEN MCR MMS UREN RENEE M REMAN RN MM NERS ELE ee SERRE RMRARE MRE MY Sa eR NEN MS MEEK TRUM MRAM ENE RATNER EN EMAAR EK URKEK MERCH RCE EERE AEM SE RER ERE RE TASER RAMEE MMR RR ERNE EO 88s ORC OMENS EC 1 TRESS ORE SRRRA EN | RNR Ee cuts CaM PRREM MEN RRC RMIT C0 030
TRUER AES RCN E RRS Re SNE R RR RES Rate hee EE eee ENE N eN Gann e RENEE REM HERMES SOUR MAME RA SENN SERB EM ENTRAR M REMY MENS S MON RAMEN ERE NS RENE ROAR EEN SSN Se MMSMN ESS ('-oc-c.uaeett RRR (WSN! CRMMUNM ARI 0 ORR on 107". SMM MUMRRM ERI OM SrA v-0'-"/eR.
“SSRN ACROSS SSIES STONES RSS SOSE ESOS SSSR RSS ESSER SSS SESS ER ASSN LS RENO ENNCRES SEU TORU NOS SE ERR RRS RE MRE MTEL ANS ENON. ERA DORON ODOR "SURE “SMG” “Se ROR ses". SOREN So 6S
SESRSOReRRPR In CROCE DaU Ea RUSE SOC Ogee oa Me cerca TS RR UST RRO SRS SRS SE SRR sh tS RR Oa SNR NEA... SRNODE TED SSSR SLON USSR SSeS ASSESSORS SSE SES LSS SEHA ESBS ORR MOEN SNcTsT WRN GARI SMG Nara T tre atate ar eTar eat erat Sean eR RED SR ARE: CUP ASR ARIE Et SON EM DR SRSE tsa aa RO RRA NSC. | eh SRDS RR SLSR at
SOCOM A Rh 8 eM MMe ee ee oe eM ee Se OOS RO WI WOO NEA ey ee ee COLBERT RARE EE SAR AMR ER ES SKIS AK s ee ae RRR KEARSE RAI eee! RRS en 9 Oe a WN M9 0.6 6.)°> RR RON SCN ID. 010,>. 6.) a OR eR eR a” eS BAR! eee aR Sen Ea a tear etace arate etre ateteeuagele i iepefele igibeusbenetal toleho tleralies Gh einfateiet Late t tse SAMAR RNA SS RAR ERASE RARER AR ARR RARER RB ARNE RAR MMM SRE BERS Wan Cn One u SN eciies SE eee cect tO TELE TNE ROR OR RRBRI 8280020060 OD rEgits (CT ORES ey. OR ae SoA: RAEN SNE aR aE MAES SN SS BREEN ORME Nee entire ticensrerect iter arent scinecte sertacicnttiects cteareccienisstsrsctoteietceeteererseetett ee eteter etree eee MER MIR OOO RRS: S GCRRD SRSA: *- SR RSENS ERS ara OE SEDER Oo MECH RE REE MIeeMICK MIN MEMS RECS SES MI IMM ottetS31 52a P RENAE LRA EAE RRL R RRR REtearRRR ARERR RR RM CR CK RTCeRsET IN RR IKDET A Weil Rea SOCCER 2 2) RONG. ER8.8ROE 1 CE {SEER RN MRK DCD 9RENE OSIRIS tMMRR SSSI RDM Se SEE ROA IRR MSN HSM GMI MM IE SALE Pe aecel eel tonmcel,erocecve circtreectaneemi retorts teterettatrects Surat tetRETR vatetens eats febe tees Pete cAsM tens ToRLeePLeDteaLecdaeasBOLBGN MAPA DLOCe Ace COE ARMS CRN. SRR ERE St 10!1. CR RRR6s EoAt 80 CRN CREECRE ERAR RRS CREOe OIDso CESere
ee erase)
Be sas 7s Da Taye TA SLA Rea WR Lena aaa aA AAA ATH Loa ALA 9 SES TAS ABTS LALO RIES BS 9 Dea) T6 AAT A AAT AT A888 690900 RI I SR OO Oe ER EN Me OR In CN SC RK MN ANI AA KKM MAS 999 ao E889 8 a4 RRR 169 0a IR ORE #8 EIR 88 ts 8 CC A 8 CR Le ARC een ne Ce nee nene nce vee Cn eee CLeCes eee CL LeeLee eee aoe aE RRR RSENS SER Ree Ree Re RRR ARR AURA EDA REO RR RRR RMR A RED RICE MERE MORSE RICRRRSES60.0,00950 0000-88 ORR HEN RS ROCCO RRS CENCE CINCH 2
Tere RRR REITSS. RE RSE Rinne SIO a RRR ORES SE aS LR RRR ROSSA ecrarnestiececjretanrareeegrerstersperecctettyrercnvtr-creencnieysmaraecenere neg se rseesec tetetees noperetetecicactateeeetetievenea iene neeeriraggr renee rest sraenaneTU nine ceeaeteRORRMe! S07 SOO t " c SOeSIRRR RR o O RRR ene s2 Sens ego's “eRe SN ERRNO SORE ORES EAE EAM ATA LeRPCE EEE oSOSROLE C9 Bene BRN !- ORR MMMM SRT SOGSOOO eet a Cite Ore ener 0 aC Oeat Star i 3t St SE OL Oe Be Pee ee See ate iptatacetecatatntate tata aeetetetatecetr eter etn tacatavetatetet estat gmtenitetete cate etree te ere ta teat es eee eae Kertacetateta’pttetatetatetacete ei atat ean aera RS Staaten” 3 Mahia? 324°.” cn Fatin Rey.” .*s' - Saar ten a NR ooo eT Le NN ae,
Bec5505s" Sha See eTaehear eie iy eid cs cae RRR RES EAS RS RRR SBM LEER RRRgets S ES SR SRNR SESE REA RE hers SSPSARAEL ERE SG CTERR MB SRR tectih Oe eMRESae6 ssSRE corer tee RSIS Ran OR NS inn ERRORS s c= creccectreeseccersterecssecte st ytoaedesesscrersrstereieetiantesersttsserttcectg tana teetectseatsseeyeendrorssne ereasbererLtt LLGcts CORN Nee Spacer aOR RRR atd eCRR UMS RRR ORR SRR AR. RRS eT CED RMS SECRET SE®,eigen
bet
PeneeCR cece ICeee ESIC Se ee2 ee SL at RNY RARER RRR“aoa AN Aa:saa S. Cares CECE .CREE RAY 8 EERE ND. | 60 s-< SE MRR MRR A ERE* CRES.-| .-1,teen MURR A RASA | ARS SE OLE RRA ee 2d.ReCN SCeSOe ee REE RCEa!Wad ENRRS MCRSS MEMARR PD 2 “iTYa al OS a a 8SEER Cs Wee ay E ryRR "a"RRR CreerERR es ae ery eoERR Ag Mo Moe = + OTTEES "SERGI, .” 1". AURA OERIE,, EERGROOS. 's”. RICRSEE . Saat e aa©. amas inaneEar aninaneunae “SiERSP eon a's! SSG Sag RSE RRS SER MERGE ccna scecessheergriassiee‘eMtetySicetirte staircase teaser betes OO et at A CcCAUORBRDA CAN cere ce geaenr NORE RR EE | See te ee RO ROTA REDE SaY NORE MMSE.” NERDY SRR. We ROMER SRM ERR 8 eee RE OS ieee rR RR RR RSE RR RSID ISRDEDS OOUERSDERRSCs arsesresSetsctehragerntotitetolmerotieetcrtatctensteototevartr irene. tear hee gumBBr- erintit suetoeerstenctenerareisaatorieteter sete MRO sna aes ce Nee RIES RR Rc PME RS RRR te SOS RRR AR Re IN
“DEERE i RRR OE OR RR eR ERR REM RE BR EAR MRRRERRS. ec cco-sesciceaetcecn ecerecelegmmcecelelecelectceleleceeleeech echt OCR OO tetera eaters at's aielnlalele eee ene teeter ee aca ns SRO 88a pre ES RRC 6c ee eR Oe ORR Et RRR mR eS CRICK
“eR Seta Nc RON RS EO RNAS ESIO SS MSRRRRIED: MAGA CCSESSSeS SU AECELLATO MERE tctatatstsasbs es tfot fot tatat et este tet ARONA Ot RMEMMDRRN Te! Set dct tatateteneteta Betotatet tats tctetet te fets sett ORE URS.” GREER SERMON.” SABRC OMB) RRS t-0-050-1 RRA. SR REA, | CSR RS RRO RR
SCRE Saat ROR RSS RRR RIRSNSSHE NRG ERRIISS- Sahai eect csrtittsncn enrages tote spien teat tet ets to RRR orneneetesgtetestitescotecr tet ttrssttatctists i aR Ps OS RES USES oR. "oC RDS ORL SRS SERN CT ESE oe aRea netsceSPSeUs OCR 838 COIR, CRIS -¢ mI 36.81 0.8.60 0-800 a'8 900720. 0° SERS a8 0.¥_0_0-9\nce-ae_0_0-0"0_6-8/01¥-8-0 CMD CRRA MMS! 270 6 0esIetse 9-0.0.0/8°m0767670 4,00. Osecer 0°00 0-0 9-0.0-0-0-0 CNRS.) 1 ¢EE OUR 2 oC MRR BS 0.07 Oe NECOR SRMRRM IR ICN, 8.0019 CUA 0-0 RCD.EDO. 8 CICS OCERK: IC ReKERR SOC MRE KR eR SER RNS RM OR. CORRRRISOs.fcrsasveeecerecec eSRin-tc000\000, SURED. breresforere. 00800CM CORREO AY RBDRR A inte ents We80ME AL sLesah Sts8-0 teesnce MeN EAR REM 2-1 RR SRRERA RD SRD M I Dc08-1. MORI RE 0. RRR Ie: 2a. Jne”: /1** i‘;
‘2:4I. . - an 7 . : ’ d . Jt fs — ° « aoggeLe ottom: ] sceneSok trom Ola 9 7é: 1Qg2!“ns un rtl . . ' ,iwure mes «4 :« »+ .we oYa ot. ~$s V2€vs» 3
A a- 4N G d AaGresy
wure OO ertruc OCeCHWICSCE S anon iIMASCRINE (1 Q2 10tograpn
aa
t ie
ee : Oeeee See pp 'n'pAca'm ace. . SUC Ce POI RR ER « aang ny - ; Le ABAPe®2,0,3,%8,2,9,8,8,, .
Beonccnsntoteesscentsesoreneccenrecntesatenecegeceregenetccenspeseaesegepeetae ta esas sneeaheegRCOES epeT Ne aencae BRS NUMSEOCLALISSNEAMOREEDSGEESDE OE SOU-acERDEGUREQIRSPSEUADE EDS HIWE-DSAESTSnnatonsayignenue SGATEGSGSUOURLIGOLSIAMLACOUCIAT CACHE STEATA OTA IO ALATA Cuca eneUb Dela ere, aa eae ap Uyeta elas ate sae ada esata fete ots Tee ated tate ede a Oa oa tetal ee lata ore eee ater east ag eee eset a lesa eM eR AN NTA ON VCR TONE TEEN NODES haanet nana a yen rate tata
SOO SNR RT ne aaa ae ti beta ar En T I Ear a LIT IGPDED SL CGIET SOPET LGD TnItehenecatatgratstotocaPeSiatgtatataltatelstatotetabercratstacc o> MLLNSOL SPRAY Lt GO CSET Or Siar Sars ROn Sar LG btfateh aU SRG SNC Ss TENy SRE A OCetSCO are te ADSL Tale ATES et Te eteTALIS lelete alee te atest) a ae ea Ape IN Ae OR ame ser ene best senr ees op Ears eta alple tra Tetalatatet lelste ls aletalvls tele etst tet tatanersl yes FN Desatarelatataetatstatatatatetetecerecatataterstptatsiatetorstecaterecatetetetetatere? yt tatatedgtir anatet tet ttEOE tts Met RM E cesta, TD cele TEDL LesaDelelelalelslelsletaateta: aa aa ae ea ATT TDL «Lala AE aL I ERR RICO Moves teDatedatatatemat ed Tats cn cttal reat sepia cant le rcayetede ssteten alate argent renrtabegnaieegtenprangenesteebegmecatcaetgee PSeSe SP ier ae i tw Ot UO Ste ea NSE ate ROLeivlnsntnante Od MER RSE TS OC Betester SOCnays SAAR SOC SCEMee IOSama SD OE EOE ERE EC SE SO OCTET Geen cant GRE eamiesreet OTE os e arate ei reer SeuPnPESE SSSR areaSaar RST Tana SRS SSaRIED SAID ESUT is IRENE CNLSE SESS REELO SERS ICSC R ROSTERS. Te ON SRO Wc AC aN irSNP aR CR OU ar aarti CIEE SE le Stata NEOs SEL ae Rea RE SER SERED SER EMSRS SA SDSS ESRD DE Petre t let Potente tat rtaratclara stare natstaer telenereney nec ta ceties geet eneneae‘einRe enema med ta eee er ngt Beene ele nt Sele lala Sees Pac aiae EPSOaE OSE SPD STSIST wr SPEI Sona TE SIGE Sx SBGEaT St EUR GE STOE SUGGEST EDGE st CODE NESE DOSE nL Os EERE eS ORCSae SESEE SR SPR EC OSES REY Ue eM EEC EE OL MORSE HE ERE RD MM RN RCM SOOO ICN DREN Nt nas Dt SeNEOUS eee Oe saeSCOURS es dom oeCree a eae + SSRI Ste eee se ea Remy ReSSE Sse SeLESTE cok ROEnsSS ow Rm OSes cle eeCED ee a PES Ge a aSTAs eeWiaeaN Sense eR ee eae SO ESC SEAT SSRIR SSSROCIOE aha d0 es nC OSL EOIRMN DEDEDE OOGENESIS EDSCe OCDE ICOOO OBE CEDURES CPOE CISO SP ERIES NESE SCDOTnoe tO SOses ICESS GDS SSE OSE OSL SEUSS SOOO RED EEG aN IT REMORSE ee te Ee SEER CMEEE RE REN EN EO SE YSOe EEEEES MR RENERECK YMEERE RUNS RSE RE EERE SME RCE E RT EE OBE EM
OS See eee een aT Lana Sat ised aT anna maT aaa Nt tani O ET G IOSD oa O nena EEE EE Ge na SE Oa Se el aa a GE ae GE SOD Sd SEG OOS LOE OS 0 OR SSeS TSE SEE ODES CE Os MAE PCS EE ESSE SENSE OLS TNE CRE RE RR ICR MMS ICRA MH SSNS EH CM SCSI ESCM SLSR SEMEN ORRICK MIR ICY
SSC a RPC De DED RUC RR SOREL DEE OCR AR DOO GIE St tS Dem DEEDS IODC ORO RIESIES aaa PEST aT ter arash Sonar. an Doel eee sitet i Bh Sener nner Soars a IRIE PaaiaEr oat eP Sean amLIET ESS aO TE ENR SED SEO LICO ST SESE LOLT AT RD aSSD PSI SPL UDI DCS Et SP SACRO OP ui Sat SOAs UIE 0 ate Grad Wt EE AGE ICDS SE RESIST Ot SENT SB SE CRORE BEE SESS ROSE SC SESE AE OT LESS tx TREE OE NORE Se CSR SEES SE a
"RS SCR SINE SE SO Wee Cobia te be ane el wey : wonton - a seagee ere Be IS : a RL ARSC ESUSS Ses eSCSESC SESE SCS OSE SOOOCOOOL DOES SOROS ISE NOSIS Be eceececyiatoreceecalelacelatslepeltts lee eet eletelel lel Theisen Dt el Usd Slt tele els aa sh et DDL oD Di moe : lt . ot tees . ee : sees see vee . wees SEER SENT Seat as Oe amt aE Oe EEE CREE SE SESE OC Sd DEERE TERE SOSA SG SERRE CR SOESC SESE NCES ON SED
SRA ROR Sead el EERO ED : Ce ant ee careers aa oo oe Pe eo en : : ftw ve TET ATE af qQaTh Lets erica ste aUetece le DaD AT TUBS ca ateca le a ce ee Ieee Re riecerene cane a er eee nant errno TEEN gistelete g 1 UG aes OD le . ee , . ote co oe oo i . aoe . ie : ia : Pai eek an Soar aaa arr Stn ie tor SESE at ar Sor SEG Wor ECO SPOT A Bienen ete OIC thet nec tenLO weesties rate. hel Malet In a. ie : : De Fae aay beet .- bene a . a Pe ae a vee ot on ont : SOMES 0 a teSEE tee See AT enegape setae atte,SEDC tat catetSCC) eta aah a§ “SSL IS I SS Tete tt . SS : my : .hls . . mo : : fone Sa SE Ot :SUE SESE SAREE EES SESEeatin. BODO SORES SEN eaten SESE IESE
TESS ASS SO a vot newee nous . .. wo :. :ae an nsirae Loon Senet “CRRA ETO RS ee ec oe aaa aEmt Rn Seine mo :: .:.a.BOP eee Sree tral See ite OT SL ae aS NTs elects oD tet :a: aeae a. .. Veiee .- atoe teeSe : sete feStat daiidtivehadreaatiy Bee re ete netgear ee ne aSUES UTI u TE TS atPON vo el: NADIE wt : hh .. MEL thee .: :. ‘SS :: -: Tn : “ et weaera leeSOUSA ne aama le VEEL had ab bh Le eiag Be acececeleleveitelnele eleleleeta leisils isla ected : .Se : tes Pana eited : :.:oe : .eee atl Sra SIONTOR STN RE bh SEES” Mrasstatesswiaraistutetetitatetci ttt leesDr teLUI Tl dri te eteee ens . ae nee 7 :Sa : :be‘08 Wolh eet, eel rs islenercentteteceneniistan
wl: earsAe arrEIEN POSE cones Batten Om . woos ollStS . .1aRe : . Sara woo .soe . SST on .:LS: . 0wa a DR PRRMMMMMMRRREENER Seoo nscesslececeteter e. 2a .ee on2:.-wi . .. .:eee - Seana * : ae entTe . ot voraaa poae a ay tare+7> SS 7) ee EIR "979906 “076° 0 "0" 9's Co a oS .: -: wo .eyne SCRESEIER
Me «ESO ees ear RIRIREEIEIISESS SS .: :.Ue on ::.a ae TERRES Saas sea ~ SRS eee Shece :an:aaa :Wat : .'a.: :7:neta Insc se aes cei SOIRMIESIRERGED.* .SR aye atte eas Loe IeL ce eaeeeleetes ce ater taLe te RAD aeee no ELIAS letie NU6 ae eat ie aoe SORE = RN : : we . BNE SSSCESEEAES,-, CORMRSSN SIRT RSLS SE SDREESSCOSS 5 SEECOEIESCH SO MURRELL SCORER ESC SRIED SLES, 2 OCMC” MCSD, SMES COERCS eee ea UD RDI 0s gga eae lence ay
CEOS 5-87-9. 355200 0.020 6.0-0 2 ORICON SR RN “ an slate ws.arate Ee, it. Satan a CERES: SRS ad RSEae SOSNED COShs SRR SESE ESE-t «aan OB zepara wD DM lo Sleee ag on SINE g eraes reSa el eoSPSEDERDS OE A, aR 800 827,908.90000. +RIeSSRS EOnAwet fot .State ren die’ SSE- -NOateeSO Bo Be >:“Cat aoe gcse Sean Sep ite 1ela IDS eRnate Raeyy Re asircteteatanten es 1G JoieD: ae cee Sern Re NSS. CRED agslelt SaiSe tM,i CARED, ,“SEMDSSOSISD SRBEDCOED, -, c' ERDN EINGy TERS-, Stoe eco ee cage aS.seen PAPERS: 8.7 6.5 8S. {GSO ADRS RS .ota :5viele ios :Tlaaiete an aa et om SEE pote reioy oa.-oo ens . ‘ .aternstagtet Cora. *. aan : ie noo occa elas Senet - So SC “aes, Cas Se ae wt ar :eh tate atestetas on :.asa! vn cee NR eeelke ol“eee ls :0StS rysfete terete’ etateate 6% eee 5OCERMEINE. ete aoeleltels cleletelge Tete =eSSEE oe GB eo OER as SEGRE Wie Vite.7'¢.0's:ee ce ea el ST RN OR eee Te aagngate spe ngtel SSeS raat aeTe hatCRIS ere . Sel y acmestsgesete EDT SRD ee eRThey ate es aoeetelnrets --+:1SStoNeags SRS Ricchee OG SERN one Deo Ce Ar DeLee al alale eee Be RNP CMR SMT Fate CaM 11s sae ey Sere 9age 1eeeewae .0SERN Sk CREME Si 0 ea at rates ARERR URN aa RR) CUES. Qeesto. onde 1S Tee wats |©Ba. ae Nae.” OO Bae Ane SEAR BIE steht Net eee Os2: apelin DISET! Oa ota +onBo. gue: :*,sae, CAINE Cee! Taare ween vera ace CAC Ars BT Sg s:.:aaa MRR SR co SE coneincncte be ¥*.0,9.0,9, 7.) SNe arn nn Vaasa Siena ae wee so ques ad oie : WSS Bate SodSERN Soret aSSW ee rate Bone eek. eet alg tg8ena year rate . .geo: Soon oeaaahesead releRR aesBe en eece o>: Cees AOS >.> aCe Ree eeoe I et RE aanag ae al aa bARINC OCR cere tone aitwalee :reas mecee Mes Dene :aante PERRIS oh RET RE Soar EISEN Ce SPEER IOME ST NCSC BRE Ie cere A ce SRR RINR on SR ao«SCOR, RD SOS ORR ae nan nnn KASAM RRO ee eee ae ERE 35 Sea Ea nentes ee a eee pepe RR tet eee eGOasentnAts Siar scenes : as ‘ In Dh i Biase er: “eee SEER ORR SRNR REE 2?RR NANO Sear Me eh erste et WNT e tes adage SD tenie sce Me a ahs ONE SOC a ss eect ES SS oe ce ee ERS, Pe ADS) Delgleleate aa os RE na
OR nN ADA +8.tng 2_°.° A, me eo rae . wo ThATADRRIN ons Oca we . Sais VE” Te IRE ne +res tateled STa ih B SPainray > cron". - CSREES” Seneca SR earner? =. fava...” Se*s: Ne! wich tell he PeeteaSSE cestecniaat crore a OR . 39:Te eer. press : om an ceet , STRaoe ore OEaea OREEN SERS RSEMEESEE' =aa cSCOE eh SSR -*s + QE 5”. aE ROR SSEe6” LSB AB aid a0", alae pare fa eo. aD neath . oe .0.oSNaTae fi . eget tare aeNala nbr ee, SS aCael an. En - «SAME» we ve Cee «sae? ot . Pad RNS. SSRSE so MSEe” OD «ee ss oD ssSis oe ae eR ‘SR A EOIOISESED: 9-2... RRR, « RESO ete aetotes :teBo ee :cematenn oat nh isn et eem Re ta«'sShts_: Maes teeee ROR atta ie»+SSsres RE SRE ONCE RR, A. SSaR ne TT RRR ol cantte ee See . i.PE ve wet Co ole FSS, ais.an aeGeena, SL EROS 1asaser, Re RIS oo ARNG POR: SRR ORR SRG SERS, St Carat SOC RED oP“SRSA = Tear tenOTE IN cage tae’ ade Nesean tle ad -SRN Palatal On ah Pa. RRL. SPEE, : Op IRISny 2 :MSC CSS" ERASERS. SHOE, 00 *- 2°°. MIRRRR T-1. URN GIES SACRE. !.” SOS. Sr! PER Sn amIa9 ORR. *. SAEED as DESDE DEEE SD Dt ameeMARES Pavan FN HD ae) Pa. acre * ¢ aes aes: PRS RONRES 0: SCD ORR ORNS «REM #'ON 75DRRISIREERS SOR OSS ON CER RERR easecenc acess SOIC:aee ORIEL ODEERRL® Be ea IRN ate. Ss yenwih ne Tee te *aRESIDE. Peet. Ra! Sa : pe Re ~ :we Bend aeRe SORE. SA”. *-.SOMERS: SON" ORRIN" PONE”. ORM?” “ce SSSR a RR aN”. ooPES *oTaratc Rae a CREO a: nen Sana SIRES ee igeatelatalet Cuetec, Pears .: an pe:ean ee SM, BS RROREN RRO 0s. RRR GRR QRS SSRs ogee COS SIRI CU tO*-IE CRBS os ccecene "UOC Sree a 2s Oe as elle anenes aanner. S2ae8 ae ot Se oi atmatstgecute hn. . = % are.” es Bay oe” Daas atic rer naan RIES TI IRN a Ra «aR REO 6 274 0 ea OEE ‘RRR RRR RED RS nS DOEELig De Do IagnEe Dos SUD aed LORRI ogc MR sac eect | : . Se mE aie 90 : as a NE arias 0 RR IR ET a ne RS = 285 RS ROR Oia 2.1 SOR EOC. aS" SEER * SRCRSRACI OR ORDER SCRERED. «CHEESE RES . sowie sists : nes oy spelet S Ry Pees rh aPaana See nt : : ° * mot oo : AC's - URC» OGRE SSP SEAEERS Oo RR TE, aOR Ta + eR SR SOR 3078.8 RSS [ERO pee nePS aaaeien's"9_-arEERS EERE. *..*-* EI RSTO“HER Sn Apein ISes Sonn .*.'---'GEESE Dera ies :. .ae. ceaeeae eng oe NASIR SeROSHONINS-. - SOROS SRR Wan. PSS AR SNCs 2Oe SOR +o ss RR ao 5Bin ava Rae aa «0-0 800 COREE REM * ec «OMNI 0 SOR SOROS IONER tet CR, ©ION 8) 0eee enna ,°,*Stic as .9_>.' .-reCORRE *SRR eT Saan fal sae) .SREE> Pot» qe - MERRION. SOO «|. SOMES +SSR, 5 Ss) 8 8RRIRSP 6Oona OB ¢ ePIC 2M Eesole MOE MRS CRR frre IOC oan AR UL + eC PE ce ae .aSNe She oteae vee Lel :a CERT b. iSRARBNY “Ey UTA PRES ioe RR ee aNR RR SR SRR Re TDS e228 2SS RRR” 2ese once! SRR SE ---*RRS, FOODS SRA 0See PUNY SMae ahee ont ‘ae :tes : .: .SRO cleus Ca stRe Oe:. .ROR. De ERC MEE es(Se CORR c+«ono URI eRMARNE SRI feo Dena vrerecere iets at SR RSA RSET a6 2020050 Ooo aRE SORES Tg lain Ko aeREREEN See RT TEINS Sa ase SPS naRIA IE SCS. ne ES OT ot RRO enc ooRRR nooreo PRIRRBRCaTos 83°45. 3700s BONO, oR ree RANE aoa| tee cera’ ROR 0CORT eles Loe TD NOES: AGED *LSSTRTETA) RMR MEEY Ree ARMIN ts oe eee vatetater DEMME. 8 ecee rote ORR ORION URE SRR AR RARER ea St04t SOROS casero tel aaa NENT aan ° .SOMME :::-Pot : :: :: es eae : cere |)TRE Re PN Fae We CRONIN 1c8> WES 8ON RR NS Bee NirSete UR eeec6c2 Bea eroROMO RE REAR RTE SOOO APRRERY-MOOO EM te ms : DEO : aaeare” aSARE esRTT RE RRP ERE SER SEDANS, SERENE, #1588, SN ins MI SE Ra cee artic ae SOSORERI nnn fat scooracecatacacah teak coer : xe nr erent eon a ea : : : . SORE AR ORSINI SOUP CORI. PIII Ents OPER ROOT ee CE tr ERE! A ROR PI OOS a es TR TTT : mosh es ne o vee SME RG SDN GMMRD:--s¥oe AION. «noe re areca NOT sees en cere aR Baesecescceseeeetenye OR nooo er eci seca on ot 6 a RIT CS ons Beso. fee BL it : : . re bea ee rr an REURED.: --0 OE RMEMEMED COCRRRRARES CRD ameRi pS ocricrencecaamee wessicicrecgmMmmeererertsrieencsine
Bs. Prt ARAM MR RI GSR MMR T oe. SRIRMNS eStats eatERERSEEEERR TN a aS Ls' oe .ANRC : toe L anEMER : Legs hin, remeIS piensa ‘ OE ag.one's ES, cL A on coPeer kr eS sete arerecetare. CCA neRAR Oe SEE SRC ieee ‘ ates 5 veAAI an wie booo bie : Wy I eenoe eet ce MONEE eRSO tanaa ine 3tsRe SE RRR RRR RRR toile) M LOT REE: ERROR PES Es od Meu nicer nee Lat : 2 an wo :1: :. :aleate aan wh PER DREN ERE SESSION ore ea Eitan scececerenscereseNcefe oreROOT 01s SRNR San eceRae sce socas cise se eranuehey erecta ones trer ele reneragecelelelegagenenh, CTRL ley gl .Delete : on : eoseal . whee eelRR ee nnA: SRE TTS ORESST IE: RIED + SRR + ION SNE,CI ”, a RRA SHES venienhgy caieeiutpanean yy ::ata 7:Pa,:cet :legalalelay . ::. :.eee .. :, .Webbed wie ole REPRO EIEN 842 ISSIR 2Es 2” RMN RRMA reese ocr Solel T TEES UE 2Alpes noe ‘ ee iol: :.SOME Ne tn hc GULcides aTele as RO ce SRR Net SERRE RRR SERRE Daa ecetaretcatetareratere’ Baa ONE eee nan ala . : : a Seno tetas ttle Und IO oI SRN Rt SD a TITER ce A Dt ty poe . u i. ele . : : vials tone eee COTE TEES UEP ACTER TATU STOTT TE SED ean aa RO ae Re RORY RR RS SECIS ei eee a Se a eae ey Teas Sota es . : : : in : . wot os Seta aT as REO EEN IC NES SE ESEMINAR NIN CN. ON,» 0 1K OK HS (Otitis: » “alain ee0°0-0d07e"0 RUBE BRSSSE KMRMR ARE MIO Efer EC se 4 Aen eats ane nal eelTen allele elaeelee celle eoRSET ao:satis 7 : .ree‘ERECT ve oo ONG panece eeeSALUTE PST os ERSwet tea TETAS ea+SE: iC ELOD DIN. ”- SSINAOAN HAAS RDN atevacesacea” RAR N aS iitece ne! lena woe .: ::Teal :Loot Doe CS SST STRADDLES LO LOR RCRD RR AS00° Sch carstalenceteretnereceterens ARENT IIE IC ROR see . :in:DT siete cePUEDE aN tele ated SOS RSET. 4 NMR ARMM MNT ScMMR strlat cee enrrreleyy Utcleen fen es Von :ote :vee ut : : :ne rn was Sates ae ES RS px sin ee TA On Dat MOMENI 3°sSataParctare c!s raat etatetaterats STEAD aaa lacie lalate oleate RRO cn ESTORS seteeinoe Celtiteles eesRET : Pe . :: :.cee ec:. .on ce me enna nn renee IEEE na SSE Fort Ce enn RSTate SE ARTES DAES OR RT
DIATerepe tet aceceretneeeiet Cesayncdsantst aOR ee a aaa a loshin vagyhn felis .:soles :: oe elas: whi . . fale :: tery : : PU ve paERERRN bbe SRRRMEREROUREBREREBR RARER RIAN CORT RCEeeremer McA cctceentet ce iae RRNMMRRREXARESBRERE Izea tester crete vais atRRL SND enae : LePARES ee:wells an a. .:.we o-ae ARNE M RRO PT SES RENN SOUR M AN MMR CS LeTelatataterede‘e OSEIRS TSS ells SISSY : RT ws toon. anEas mos ao fees fees Pee MRR EN MARR REN RNRNE Ci sctsss Rene Me ore cee ik ees ee, etits Uo Spiral eta One COC REN .ILLES . 5. SRE L .RUREN :SCH enSeNe te PS CAT OED BI eon sae a IM CRATE “ oS va ENED gracecaCavecececeteceee TINTS Tatath es relaceceteraceresece©4thta Teta:atetete OCR Sea : Lt 2o went : . . neESIe a -ie : Te a .nea SeaDer Sear eta Ra aaa ra DIOS SIRS Nes SeEND, NORD ID rah ahaatatacatesctsvoteteteterecs‘atstatersataterstatetwret BE SAA RE OREM RAR ARH tls ascent Teme anneat re IA vos aan :te- ae . .:Lees a :Pyats oebee SoTL MRED IC eeae HH ICOLR MA RRRess MORRIE * 8.8.0. 800 8.058 8.80 2888 testers tis taatye tae tctatetye sateen SUSIE TER cecareticaacer eretoy PSOE AR IDEN bh nos : : .Seie :atte : : Te : . Ppa PSN SEEDS! See a SESSION MG scotoseesSeaSetatatesstatstatatctetetatetetetstatetctatetstye
aR ORAM RIER ORTRe OSALCARI ceilWet ceiOrerste styrene Teen noe ele :fell 2 arove EEE et . :earee . . L.aIS ateaa wees fey MEE RUS te RNRENE RNReaMWR RI Rin eee eos sere cence cence seed RRR RT RTM Ree EN SLE ene cleletie eleean Te on vane te cee es: See : .an .oarehae aLa: Te RAR ONES *°.0.0.6.0.8.0,0.8 0, Cnet OCC eee elas ret ce eneteRNR ta cetacesate lee htaneta a7 cra om aeRO itase Rataae GPete ae atlee at tema ea ea Tee woe : a bas rae . . ts oweee tale NTE aTa eiol tel eee:len Uglete stele Te tele aba ate ete Tea INOS yee coe te tecca ee inleletelalalalelelileletetylete sR SAN hea ea na :ieee a.:C :.ew aaaR :ERNE :Be etBEIT oy :RS WUD LUNI SEO on eae LEEK TIM r ele on ee rar eT Le aeen a te :: Blase ot me. roe ann atts :a:te :are ee SRST et SSRIS Gs aleThing De a eaaaa aereeaee raed Net atatetatatat At SNev aCe Nant een :RRO Pits :aca :aavols aaeaaa abe. : :5 ee unc ene CUN RUSK Sanu REE KISTC OCR eR ERIS LER E NEE aSMN oetar eyRIIO eceatat tareee saeretsaeae ee eae alee elesrere ne es Did Sa he ns aaa Con i .Le lan Let STIS IS .eee OEE ene Ea SK cetATE regee grange reat gee nent LOT Occ s Date efetetelataletavaletn eat oO SRR ee aaa eee So : : ae : .cl.catetene : .¢wet: :vont Depts -etDri aeate!sarhate Sete SMe aT DSetah Saat Seep NUS Stn er erecatecelereleleteleneti [ale rele leTetetacetetst eTast ele] + 0 0 0 5 918,809, mee rer areraleleTaT elsea eae” or eels . on ee bd om ’eb 2 . ian, . ate : : Ltee -: softest tehEeat ate tateDey B ata Saha tnt SRE ental tnteTS at etal sce aaor aracevecavernons seta eretate Tet resect letelet Re So SenSD Soicscacecaracacertcecars 0 SCS Sea Oe“ve aepp : :avale tn : aa :ee‘ flv eee val teatwee Ca-onises: cee telite auea ete eee etete eae eee 1 ale SRE RSIS ST Leta ULES ne yaa SS Se eee Ces eare ot ORR 0 OC “SEES emg eres rl ty eins : 2S Lg STS tat ne ennaBLS Shitigitests soetton: ane BS IEE atoeaan : SEER UREN RON ERK Ss MEMES ME NRERMNMMNERREARX IND ccoaeles ere reece0oeee erea eLER ns ccen te
PR RRRRRGSMRAIS UT tarsi eerie cnn nega tellin stat fate yobs : mi : DS AD eIns ss. WERE SI SS MIME 0 GUE Ue UU De aa aT ON RETESTED OTA TRS Mee SER eT aaEe fae o eee tat torent oeogene ne Rare e caer a eT a FO rae to eee tae ale alee aie es a ae es ee ae ale ee ale ee el . Su Te ot eles POUNDED DSUs chs an pons SUING. SDM EED SSD METS EEE EG VEE U Seaton Sune SEID ENCE EISEDE NC SeT ESE ICSD EM SE IOR ON A MEIC NUR IM MER MMMMAS, 820006 006 100 ke are tale alee eee eee
‘steatateretateleterececatecsess eaten tetr ets tetete te etree I CGS GORE Ea eel ES ee gS IL PE CET tan JL USSD GU ns ch ont bh! WPT ENO SUE UD UES EEE DO EUCES ET, GIS aOR en CEE 2
I :. ,) S .d S |+
.
BORA RMR RPM MRM CN ctor cctlneee necacnnendanceceeeen geen eco PMeceSeee aeneseateeneetreataecteebcentne geneeeh tielen agnperneneielegeg tilt ies! Saino a am Sess Cit BED SED CREE ED CETOEIGE ISS GgaI NETO OD WOU ESI UNS ESRI COREST IED DO GIEDIN ET CATSIST OLED ETSESELTSDETAEOT PSST OLE SETE NDSD Cot aad Rata RSS TEC EA woe CED EEE OOS aE NO SUE EDN SLIT SIONS OER MMMM MMT RN AAS See elec rr eres Tes
NOE REM MAIR SP ECP ELESLEIE MATELALOCA AC CAS ADIN CALM TE ALE, TSU ee AI eTga aee eaa D eTP ees t wien Dl elegecelvialelegedee, Menon! sNastestelsten Tot DEE bo FRIPsI SST PreasEsSMDSISSST SDeTelalalecalelary NO EST ESSESESEONS SSGDDRE SRDS ELSE SIO ele TEsD SEARSUS SESS SESS ATUSISE SO SSOSSTIS SESele SPEC ESIOD NOS SERSare SPDR aT ENAare CURDS BDO SPW MESES TTR NSaafte ose cc cece cre ca erratic neracecsiectersetecacest ti rrenerste itoecececeseseeesecedangeeweesegtingSegeseGResmgeaagese, wele chhOsIeliceleyc 4 anealaletala [ice als e0eelele ala cece aca leyaiscoacecviarooael ye TSES wiscelecnteleDece 0 le leeleTelarelalecv a ataalalaelecelelaga tale are elelele palalelp ale Dele asel a aca a ate ate ceraTERCERA alata NTR ate lePRC ote State RXR AMHR SARE UN RENE CCE UO Earaie teetina te eae yen career rear nen rtecen edit geben ate agentes Ene yet Ir otegeseelapeleueanDelasersday os Te Io Ut en deen nerececee I odode soalede pe enoneSlee dapegepeenegegenagers Sugese ayeels TeLegaenr soralayRlals /EUpIALOSSAgALAGED EO LAGS LSUageverelapete LAlWag LasecAleCacas es ecelege, Ceca hoageds Lellace ofLaLegaabela UAIBUATele aCccelel 1 AL¥cecann en ATERDalel AC USTED EC ATA UI EALERTS ACRE ESA SO A eale tated a Ue ee OR SEEetteaepan PracEEnaa Si aanUU Tee PIS Oa On UN SL DCC OTTU a OL SS RSRC REESE SUD CSOD OESVOES SNEMUNN SER SIO REGRESS SLEOTO SIL NOSSGINCIUGROE HESS DOESCICSED Hz SOS EDIE SDESONY St MOE ROSIN ESCVAM RESDE ESRI IS I ISSERESC SENENE DERE OONESEEED ICNOH SESS N al MOC oe MONIC AUER a aTatate lal aTotare ela. era aaaSasa e at Ee EEUU LUM UE SCSI CUE NO TUNE CUE SG UN OC YT SC CEU UNSS UYOAL EHVDGC UU RCRA NTU UNUM VN GED UN VLU ENTE TONY UNO UU ADGA NM EVEN VYSIDES N VEN NNN VT SOUR M VAN VNU WOON SVAN N NAY TENT ANNE NNN MANNSERED MMV UNV VNPSE NUNN NUH NMG MNIAY VMN VEYINGNVV SNION aMr RISD VANSSRS AIM ST MaVAMINOr Mare SMM NCO ITB EMMCETI TO NONSENSE DNEMENEYRAISIN OME I A a a ea
RRRRERUM RMN EN RR MR OR SERRE RN ERM ERE NE NRA RCO MSR KR MR SMM SRN SoS RS NI RIO ROC MMSE MSE St Se SO IESE ES SSC SOLE RSE CC
SELLER ARAN ARR RAN SRR RMAC Nee OTN St MONS Dn RTS Og OS EE Ne SC BON DIS SIRS INNS SO SS OR SOR CM SSE TSS
Pasytacetatertetstesycatvferneytara erprespiecerelereetanrinegacetetery latpeetgres ots teonegateteie ctpbatety scat itaetetgtrtetene letra" atetataticatee a ytetstn is gecetet state ieieteatatetctet fateh ie SSCL tot ong tatatoratan tatateteia el tte ial et Ti eg + Sigheitieaioeeeaeeretna ester PSN SO SCION Se ACE NIAC SSE EOE SCARS RSCIC NLM IC SES CSCS OSS SSa DEN eN eIS Ca ROERE Fatt ete Rg aS ee Cen ccn nce n nn cee CR Oona an ry SMMC RTEEE ec RRUDORSE AE cecareren ae aon wort . sete CT BRAN RASRRERR NORNE MERRIE MRE RERS A Est NNROS N MORN MREtO ERREEE URD ODD AREM EMPe IR MH SRM SN MORO SMOG RED NN MESES ROSES SIN IH? sTalelelal - 6 SOND 200-5 RES ERR MO MM DOE ERE SO SEO DREW OOO EE EO ENO CO ODRotOe OeDIRS NeSEISTE nS SSRN wl alele el Ge “RRO Cae Nan A LS IA RC OS ASL RAL SRR ODS ICSSOREEDE NSS SSDS DaSDS SEL AL iS SECS SSG SSSI SSE BSI OSS IR DRESSES RgES ge SOS ES SPR SED aa aP ORAS C SION FSIS SR a aI ny Ee hhh’
e SERRRE Keanna RAM ARRRERR eS E ERIN CER ANRRN ARES RRARES AACR SERENE MERE R ESR REE EN ROE ARNE RRS SOSA ER RENEE CRO eR ARERR ER RE OREM ARSE SCORN ARERR a eS ee an 3 . 3 ‘SRR ORRRE RE SERED RRR ERLE RSE EARS ANAS ORME RRS RRR SERS AERESRE REecetataghitora MERERR RENE RES EE DRESDEN RR REMES SEEM GMMR EO Roan ORR RSD oe aN iteratastatntetatet« Poon Seen {SOONER PRCA ICa atateentas ITEP ICSE BESET ESM SSO SPa tee a SO StMELE ICGNU SG WPS GE NSERE ASTI ENE SRSEEeR Bee etasatetes ee NM ata tet eSrN gineESCHER ctetat ee trseret nt rtat ota tetetpr et toe cate t ane ptatd aPC Bn teat ght stot eat RTESIR NBLSONS AE RGR Sat Ace tye eoat ATBELA ADT CETSOR ALAASES EL LaSCE Maat Das DDRMT" RP MONS LO,tee 8 LiaeeDeeg og SREP MER ERR RRR EMER EROS SRE RR ee SER AU ROR ERR S REST SRE RRR EN AEE ER RR ENE RES ERR u ROM Me eRe N Re RA RRR EMA MARRERO 0.0 Pc0cc cen ee no Ce tn ee : ERSTE |
tacatetacetede cece ecereleae eg ecace ra eaterNEU deatlececyOL at alereceta a ata eee eta DAD LenaOne e ceeDEE Lee OO ge a Se CEaa TE3 CCCP TEE RRR Reremsct TTL ne ele Se SeaaS . SEN oat eae tS en ne ee Bk Se ET OE AE SEPos EEE Ot BO OLtte OEE BOULtet OE BOE Oelace SOOO DL ata OG SO rates ET WOE OREO ee eoSIE 8. PRAWN Era Re ee . ele ee a « ee RSS arti abate yt etal cafet ehT RE n ZU EEE MESO 0 OC EAE ELC ELE CAEL ESSTE CEC CET ORR easter SC
| ORR BERRIES eRSCR RRIKRRS Oe SER RMI ESSE OCISOE ORS i OS SCS ESCO ESERIES 080080 SRstig RR teehibls RIE ERM ICN OREN SM ER ERC RESCUE COCR CMEC NOES CCE MOEN SECOC SO CRIED een 09-0" r evs tn e'c Oe 8 Rett an feo . ce colt. 3
[SOIR aiertsRL SNe RED aSstaST I I PIERCE SPR OSPREY UEapt SSPE RIRstately So e'n'0 neCNEL 0-0NET 008RMR 6-0-0 ER : Dot... 3 Rr atetet tenet tecates etatic tpt tenSS ta latel ste USD lee cetghe nate hehe tet et ee geese atthe eR UBM ELELT TRY Wot MH s+ -sesvcvsesScecs crevice," eae Loe - TERS RRS Rien eS RR ea tytetecetetentctera SO IRS OSE RIS SRE ESCOOiSL aE IOSEMIS SR OIC ERIS 890000802000 0WROD voi Swthingd RR ARRAN EEE RENE RRR RN PRS SC RRR ICHER SR ICSE IC COT SPD IC NC SPEC ToT SESE IS TCSP REL SPOT Eat DE SEES COE EE RSET NESE Wo “oo! nh a'e'o'o' 58a c's CRE Wan {SMR RRR RR ee) Po RSPR IOae Sr Gt NO COCSE SE ESET SECO RESELL SON SOOT SE SRSE SLIT SEMA SUSR SR OED SLAC ST SCOE IE DT SEES SERB OEE BRSEDE SSPE SESE SE SOE IE EEO OEE MEMAMESCIE D4, 0-40 00,0 0-0_2°0' 6X SREY TR -
Pe etecaleteta cased ciel salar eee cegalae ogg tasent tegen eceenere a Calas vole el ge aia a atpegta eye Decade ae elect a aaa a eee eee Tea ec aS Ta eo RRR Pater eee . a ONES . , Brsntatitirete nt tetatent atest tte tate Ei i VETS AG OEM NOMI! SRCE NLC ERECTA LNA EERE S (AERC E EES 0 RRP RED 2 . : . Cony OS DSEE Sta SERN SRS SN SEN EIRENE SSRs Se AC SORE OER In EROS CREDO CORSO CES IE SEE SOE CSE STERIC COSEMRESED ©” "0's c'h-0,'8 00's te won Srp reeint Be vie ls"ateteraele"s eet Tare Ts rele ele eee waar ULAR TR ea eee slay neces sla talasateatetety Cael aly lala cate platalg arate’ ye iy Tete stale’ ale latent a Tata tatelpratats telat y oleate ls eles Cetatetale ly lelay eee Beers fees : i: SOEBRE RN SE RIESREESE BT SEN St OSE OO Ryans : SRR OS RSE IEP ELSE RRL ST SEAT OR ICSE NOE Nat OOSESS AE ET SEEN OO SkOER ESEWS A TERE OST aEOE SR SEO Sa aWOLTERS SEE SEETe EY "aOEE aN OES EeE OSTA ee oe OteeBresree on eel a PERERA ARREARS OER RE RIC RE RTE RICRISN OR TERE MICE IRE IRR ORGIES NTA R IRR RISIOR fer tever RE Cee NICE AM SMES : oan gg Sioa et Re PEEED TIE OS CORR TSE SPT tS ART SURES RID SPoSOT SPOONS ORT LEPC OR ODt Stg SPEE NODa TORT So DRRESRTSNS EE ICSDSDRD' 6°00 06 OOK cn le an Dolo datlasnle
. —_ RRSRSGSCOR Rrra eR OE CO OCI NIC OLR ERRNO SES N Oe OC ECS SE SERRE WOON SCE RCE SES, OC STS ECR CE EOC RMENE RY. fu ves aceatele"y. tv sve sae 0 pot ee . ee eer
Sie NS CARSON CERES SC SR ROSE RCE SC ORME RIC STSESEI STTEST AO HDSO OC DA SICA OE OC SESE SEER SER IS RRC 8- 0-0 nn cone cece eset kate ea an creme « ERR TRE RCE ECE MSGS MOLE SOC N CSE TCS SECON SR SP SEI ESE SENSED SOOT SPEC RECT SEECSP IG ON BSCR RSC "0 e“e"c oD nes" "070-e°n1s-0 CON OOM - eat ane ed
HBR eeu ae oS Ren PIC 28 2 gOS DRONE AEDES OI RS SOLON © EEO 9 SS I I BERR BE IRC EDOORDRRE ERY *=8geemtateare SSSR IORInetater totatats Sota OOS oieisttote etted tatatate tessmeu ct fetta tcP oN RMA tagortateet EE EP ecReree nt attag
RE et oe IESEE 88 Avera) 2+ 8 SORES a 479281869” ERR n°, 97816" 9!s 9-2” > TERRIER ACN EE 8.6.8.0 41s 2's.RRR 9 dM Sfoes SROSORREERS NDRRO” OIG ee eaSR CEES ORM aeS acoso toS01oa6o9os68808 E RRR ORRIN Rtas ROR eR 0020. oRAaa. I 89180 DE oce 1S OR
RRR SOR as RB sonsTEESE TOREeaats coe oi eRe acesceceteereteecric cag aorCNC scenester RE SO DREnace ORNS SEAR RRR oS cis Sle ARR caste cr sneer tie tntRRR egaptecrcicionc crane aggpetsRooe oe otRRRon ss RRR RO RRSnncstnenn OR RAISER NRE ees e-obeR iheROP nleestesncettesortest ue Reon atanetatertebgtaertte teins tercnartctcoetscteteoe tenho aR ROMO SAEED MERA ERSAS
REE
Beast snare SRST, RORRROESORSRRSRS ARERR cee ent tones RRSors RRiat! Ree ORR neces tosoR te aetivejanicesas a RR RRR eensiecaatich Session coe ett tea RRR RSI a25800 IRIS a RENCE. Hs! RB RRND ooo SU ore oS RNRNs ta 020." ORS ans AUN,sos eo MORRIS ae 5 he REroRRR 5-2-5 Entos ORES SSO RTS ORR ele RO RRNNR chr sci EAR:
BEES RR On ORES oe SRR SR SR io a Beene oe RRS EEE SIO cece RRR OaRRRSPET CT TILISHTATSIST © TOTSLCCOSSIIROSMT Tso Saas aR "0 600, > A 898. SOHSREN 895 OR ORDERS. 80 PP cat catatocatesatatetaertg otal aba deat te ceoBaPTtGt nH 8 Ltt ict URS ORR seer ertentacarceacelatecscnn?s-Trc0Cate0o23000 toate’ ORDERS oot oSeaete sss
TSAR nae ecesecitecesesecsssseces sc MIR acetecarecece tetecelecesetetessteraretetat ene cesc07e7 0800 rc Oo. *: |, Sa ae renee Taish ate aE RRO.” SRR RROD" SKS, CR RDRN RED RARER 0 RNS AY LX REE RRR SRR RRS RRR ROO CR PARE ROR Es 1.00804 108,059
Seana tetehcasscta-sctsatuerrancsnrennacitenseespeetesne ie eheraecTe ne eel eh 3TTR cee renee Ne teeara eeeSOLER Le NRSY, Age T0208 ORR esatphesotaceSeereteh i sataanttcecatette!cetelte tat tats! a aReee tareoat 8 RROD orc stern a I one care cernCO Mle ne eet rent Lelee ToT TeLtr AR Ce aORRRR o's "s TEER So! OES aSCHE ODS ONS, SEWN MUMIER BALA RIOR OC oces= "eso ier ssn 0 ORY Ces >- ORR RS aeons
RRO OTR, os SSR ts age = 2S OS RRR Set 2's ROR NTS NSS SORE SES IRE. NMSRU IDE Tc Ss ots Setet at atea ate ates ORD ret aster ee ate a! el a RD
SOROS RN ReROeoooaa ossSRR SEREREO a aocilshnen RRC Oc aieee SRR eo RM ORDERS ORE OR aaa asa ae Be RERR 3 OCR RRERRS nen ee Reococcscaceteteiotaceta a Moen RO to Seen cn a=o eeeBSR. ORRos--:.--S0 < BR: ORME RS oa SUES eeET... RESO” enna atteRRO oss ROR RR oss RRRcotta IALteKR nara fe ecscertns a “SOBRE RRR ERASERS 08 coenN taeeetitet EROS RO RE RENMEI SRRSECREME RESON nt RRE tte tttMORIR nt inst ert taste tee he. RR.
5FEAR SMR NSE REO RSI 22SORRap st Bie. OETA RRR RoETRR SRR ORR osCRO RO ORR RSeRIRENE RR RN SCE a , RRS oe Eh6.21 CER REMMNA>,-, RANE RERREE SAD ARERR 08ettere nero SR SORE RRRMeets NN Nd SRN SSS SERIES Reto as RE.aS _ RANNINSS NOD 6s HEIRMERE MICs PRE: ARE RENE RR RETRORE RS ERARDS CONTI MIT. eee crenata aloe tetotat aa AN t AMON, #.),SOR 50,0 ORME RRNA RA 8 909.8 «B+, a RRS RSSEEE o> : eo SSRs«|2a-KS SI ORR? "0c" vere "acs “nceracpretsatetetatecenata letetafelrretetatyt ciate tas eeece: NareteraceleletecaTerelares SOONER O es Lat RE DERI! 085".7 5° ohetatetass ct ctaha+c etal 40) at tL ol DoOO- SRE ROU IS», SGT - RRR iealelelnntatat rn nrateetacatmrsssece steties a SCC ea tt RSs: sss RNSartoes s8” CARR fees 0c 5998. y corsets! ogatatatotatciatata! RR REED stot RRR SRR atest CE rtet MCMC
SOSERRED ce REE | —. SSSR. RRR cineca RR ntact cts ORR, ORR OCR RRR RRR R02 os 0 SRR Ua
i SRNR RBA ROR NMEM ION See Reo RR. RRR Cae AS OR 8 cco UD SMT sv anncoSaretetenenatatiavetptetwtenntetptet teres ec ietatatctsiets a's ap REIS. ost ea rat ao oar eon. 6 ORR oer eh a ED -
Seo Ra aeoeneatea oa ea oR ie REE: SRR, SOON NRO I NOI Pe 8.8 RIN” RR RRS NS SRI cea Aa Oana aot oe 2S RRR ES BRS S
BRR TRORRR. LS: SERGE ORE SRReNotes Sa Se SRR AREER REARS ARRAN. RUMI SOUND EO RRR csc ittaetetatverahetcrtetctattseatts "2. OR RRR SN eR RR aera ec ROre I Lag STARR ISERIES SRS PE Ae Nines atte RROD RSOSSGES cto" 'o cao os coracecacatsceteeettatetscarytetetott SRR 0ses5to 0's SRP RRR 009COE ORD oo a SE ehRRR : sentteRRR aeaSL 7D RR a Cas 29 a Re SO Risahes. Pecetateraretytan teen te TTR oe SSSR SERRA SEES SRSA ERR SA SOR RRR OO MIR 2.020.541 sl) cain . REST CLR SSSR case CSor tata! RRnaan RRR Scala occ LDA AD ISD ASE eR aR OR RRR a
Bo cece. a a SO IEEED SS pe RRR RRR E RS o SSESIS ce “SERRE RRSRE nC SRMIRC s— As : Sgn RES SIE STRESSES, OTE RS RRR cocci. 2 co aaregieceese enter ra SaaS core esa LORS COLA OC ee OEE co eatets thats 6 giaane? 0, © Oa . Peta gate TOI ats TH RIN lie oR TSI INS oeeatere ooh" Tats: ee NS A i NS MARRIED eo tecccShc8lel eye aslalagtartencnteceneleged L ielele a lle BOER erie terre toneataty an Saath: «
Bo RRR RRR SRE eas oa ES, ARR CESS US UNDESIRED tanseces. cnnisscthmitisgitiers ne ns sais J un saingtiatnesrcnmmenan nonummy BR RR RRS RR ns aM css RR rie ee ar UL CTR RRR SS tase acon elatataleieharegececeretel socerelenalasereteteteclelelecerstetatetetetecs colar tammestctelstsied RRND os SENORININ 1. SURI ROIS oie a RNR CORA: SRN os Canes. 7 Cena Seen ea ON SOE 3h aha I oo aa AID ocereceNC atest uel capetar er rcateharstenatate natant nagatat actor aes naga
Bae oe ae eee satan Reestag a we ee Boe. cone ea el a RRR Re csi ce SET GUT TD ns TTL SRT RR OS GNA I CRS as 22 etaBy EN CTSA TTT RRMA SNS tS Hea Tea et a RETROSES ee TE SSRI RRRCte orate cenen0c0res2°0cP RRR SPS ae otoahe SPECS ARERR eaeUR ee SRST SRR ORR CNIS a arerevese ss ess ae a eS” Be. SORE Lea ORE ccc lr, TR RR TRS cacti RS saa SESRRR ete C's OER SIRES RSS CR SOEe RSS SRI RRS ent Ag Dts", RMR, ORRIN (2.9; | cee OREesate RARteracatetenetr IIC SACRO IY 6,80 200180B 6 20 82884 ceTa rere ett telone aS ee OCU,” RRR ghececacece aaa RRR ate PER 8s 858s cto" RR8.0 RRAMR R ra Are cacatacas 0ye,Hentad CMa a Te ble. wel 1.1 AA50,0002 SRO 8there etaTeco a ener eVetele RRR tals eee ae FRRcece SUNS OO Sa aiaipehe oncteness eeseasans aE RR RSRSR RRS RRR OR 0 I 0, CR RI seo 8S SRonae Lh 1S SOR aE RRR 59564978 «tO 0SRR eosRRS Acece coe a aacSEES e ellen TN acetecocec tere ler et SRR ROR ate tia Oa SANS? cana RE oe ce Pe ee INE. 1 SI | RRR UMN COMMU AM AIT. 1-0'0' 0-0 0'0' 0-81 MRR Se ele to re ererere aa tere et eccaerscererererete ar witirecottate: stele tatetvtatetelstateto! ss! ae a aa eee”
oi ORS Feats aN SSRN SARIN Isc a0 ets - (SREY + Seg a ROMER o's c8"0 0700 eR URN IM ttstetctctanatatetatetemset netted hee Loh AT ITATALALATELATETATE ATPase Oca eLOC Ct OO aS acratsiteteetnreea Se Re tse ise: RRRS REORR RE Sriceaperceitagigtes te | RING Nai? RII» RRR a RRMA He eleoiTe, elecRON aetnaRRS 2 TINTON EN EN RS Acceneealale REE OR MRM MICU RIO RSS oo sco le rocetaleTaSeeteate BIS RNM scuneceieracetenatatittcescarictetatetetrne TRE ARR Be RE ENS REET 0st)eTSERRE IeTSTAea STANT CEI aratatetaratecetetetatatet ta cco tetrtet anal sts's) c a ORIty taSa te Ea SRN cS CL inst SRO OS RE CR RR Fe ro aie act on Beer ie ececriefesstucetetecatetetetoc Peecsisa htc tceyectacatatedatetccetetcte oo INTESSOISADRS ODO eSECRCATELACOLEOTOLOI 00, RRR eeecerecest
TERRI AS-i RR SSNS EESTI ESOS "9° SSEREEDNS hse nv soa SURMRRSosomRattt88 8a cote ARR: a SESS ERT ae RENNER EE SRE RSE N EIR ns 0 sss RN ER
> SRSRRISEI GSES ERE EEE OCU ICNC EEBEI SEL . SNORE Ons MESS ©. 0,00TORE CS ER leone anes RTRR OR one TT Snes age ce che tity OO Bono Tero) i Nand el leSOat ons A EERE ME OEY, RI RED IERIE 828A eaTal oaeases eaeESTER ee ROD IS eas i 5asacareh a a Sepectoris a ee tna ranean LE RS EECCR EGRC
Be REE LRT“SORA Ste FORRES? Oa TESSD nas ORIEN SORES «°°, ?- CMMI CRSACOREER, 1, © CREME #, 6,88 OCPSUGEEST," ee 's = = 20-6 SER ERROR 7-0 OC SERN Kcoc RRNA ERNE RRooe-t RRtetRRC SRT ERIC SEER RE ERE. RRRof NARS SENIOR DS's SRDS CsI UEC SUEIPROCAEIRRREC © 097A," SON, OO SRADREIEREER CMMI = SORIA UREA SDR o "0-0 OSCR ehe > 2EASON RRR Og cate hetee nats aie eran SOROS eR EN Ss NeER SNEED
BT higigc ces acatecencctanupatatenneen es RUNGE. ORME co0 ests 0-0, CORED. a Sagal Ra oon Re RY SRI ORR 2 0eM 1 OO CORI SOO ORAAR Ren NOOR cet ee ft
REE LER RT RTT Eo RRR ORS. SRSA. «RES FEE: PR Soo SPe hats RENN etatat tats Oe tt ts ORR chet AN,” A RSME. * ataratalatatatetatatatrtatibetenaeshatceatat rect acest tet ANON ect rb atlst RR
BT RR eS een tc aT ESS eo tatatnecteet ata hota 1 ER a. RT Ron OREM PTs 0-8 308 o seco o0 SOC conan geA NES a tc toen toy arc tiare eas 1 CRN a a a a RLS Teste feta tatate sitet ctatatitate tyes taletetatetetettct tetstrtstst Pet ee NC SCeCt test tt) SOR: Besse cse es Re o RR NSs RN RRR RSC | RRS ROSH eet ACRES -A 6,9.0°0°809 MERE Y. 0 Lec o- ecaalarictststetatetatcl ates a Sa a ea I a OBESE fata ecte tat 00 08 Noo oc scam nen tatces recisecere Sea POACENe Dee tte Te a
“SSSR «3-0 oS. nectarines a SEEDS TS CSR eR SOS A RRR SEN og Stead ctete tect ct NANA eT antes entero eT er aN ee ee
De 010 tT RAR eT ERI. *, 8.409, 9oare 0.190024 S , FO eee ae SOROS E 2ANS SS MRIS RIES, ¢6.970°8_0.8.6_6 OD 6-4 arp 111.0 00.6.9.) MENA RO ee eR SRS etatatateta’ehiabatatstatstahate! Fe a a ole Te ee Re
Beer $8 soar 33PER Mee'saeahah gt pen OR Gheranet SESE eae ness a eens angelernnegewancnceier casaese oneness Sheen heb eho eonietitane tore nelerst?nnn TSERR chetSie SRI.:Rea ea Roe sv Sen Cae i co tees RRATSNS garIg lataBetas noes RSE. RRRete EE RA MERE STIOR Na cSecpsaca'ySsceece‘afofatscafotssecataressraiecrttateretecereteteteeteteretatetss RRR Bo aeace so we RESre IRESRREE ST "costo" cs i Syne Sec. 100 ERSSREEEIEISS oR SOC Ho gedit nthe nachehieu neve each ne eacenenehcoAe oe ae a NRE = OT a SR eRe.
Ronee erRRC atranectee ee2We eet Spe ERREESS, 9° 0°2-9"e' 0-9EAE -0°s BreISSA ON 1 LUM en oSSLL ORO CEES ARTISANS SN HSN («8.20000 6 4,0 0 a8 a8 OHSscorns OEE Ae et OOeet ER.ee os BT RR ATEN lo SSS SSRN ev We TSOASE IRODOR te NEO 2821 2 AAREIEAR RS RE SSRN © Ig SA,Y sieteretelirecciefetecere BS ROEM ee Cree oe DIE SERRE SERS se ee ES EanORRNEED Sto0 5 MESHES, *,¥-0-0° 01-1 SX MI © RMON RRS RRR MMRIMEEERSIERES #00, 2.ecccenesevecococeriiarets'etohat area ptr ores rerataretetetetanriseetetcrcteteerners t-te RRND: “RRR cr ieee ieee See Oe ee Pre men Re COURS TUR SRR a oresecec cscs cusatanetncsteetstite, os ces OR RS ERB sss! SOREN RR eT ORB cece assse.
BST RST LOM : oo. ee CECER RRS cat SRS 57 SS RRR a SSRN20a aacsce ert ass eaneter MRSR RRS OOS ER MR oe trois aE ttt BS Ae aan Sena COE Sa ROSES ERS RSMo SORES SORDRSERSS occutosenn e's RESRE a a REERRRIEN n'a", OROrescence. setae cece
Boos stares Coorsstiettgtgtgee re colghatern tate or i eae. eC sr tale ta osergts$ opine . SI SIERIER x St PSR SPRRGMIESCESE OC a6 "0"0-0° xSP er vres ever ocate’s"s-="7' SR MIRRIRREMESS CORSET Soares 9 0 PR RRR oon natceeatn test tener tena teceitet tenet gets
Mitccvnitenen EE UUM ST wi naan ORRNS UN Renee MMMRRRRRIRE cee scents a ethno RROD oe scare caceceacereecetetaet Se: eran eee Drees elans heet, La 2otelelaaty = Cool bide; a. .. aReam : Man!Sein ait ratitatatet eetatatetebetety shea PSE Pratt OR RARER NaI SNR ee REE RRR SRNR SRNR aOR ota hutatotahatenstenatatatatatat tetetetetetatatyt teterat 8H aace L8 8 Ott
Beene ree eT hatitie nea Wteiitan teen saceceneen UL acto oa : Je ES RR SRE SSR ena hy tant ss tc RE OER :
pretence ae a eiaion | Ueno DT BO ey : . oe Mee te eA ares Cnin ence RDM seis oratcovarscoreretecetstersetetettelatsis's"s CR MDE SRMSERDI a8) 8,808-0 scenaceceneceloLe.estLecesteascecarecerervcarevererprisas”
percocet onc ESE nn APESithoa : a ne OOO REESE RR RRR RMI cs eecatesene'c"ececs ett ie eLet 2 Ra a NS Ree prcregeeegetercrere SoCNC Ee en I icine Uara at heNL oan a weSeantetetearerenests:0'0n0'50o 2 ER 2 me Rapin seOne scecssecssegrevreseceseceinecerorecenecenestiess
ecaitereelaenie ce ote cWtytedss rcv dtinadece nes ats! BSR eee Cae ele a cline a il deat ees Bok teeny Ens . EES S CIEE N Caan 8 awn ONION RE RIOR RISA ato oc cose! ecsca'e"e“eceterscrtssere’ state o7s/+" 0 Sapp ea ag ane aga ea a aa RNR PICA. D9, 9_0790_6.8,0 70.0.3 1200 0041s 6" e"e°elete! Bsc ce acetate es ice ece etece cote ieeetatbatatenyneesbatetatete on te te eo ageless tala le et saree o Dante, POE OESTRONE C STS RR RRIORR ARS ot TERR ve tiles cee seat arateterstatetatsatstetatyeatsiet acecnredae acaba SO ITAA CH HACHEM ALEEADOCRDEDOP STATO LES EESa, cate ene ata SGRLE STARR ges Ce SUE aaa aaa alee alee ala ale oleae ae ecalele eae ea eT ees (ONSEN) 1 SUNSETS SS OO RNS OO A ARR RR MAREE esc ace aac elefetatatacetatatets (nn RATA ALES CATE
Beater netii scene eat a ee ee gn Hereinennn atmninetieaants amines mranitiewrnninnesenmagh arenarius CREASE Ss “eR Ri BERNE SSN IS ESSN S RIS ESSN SRN SRD (Sash hssasertrtlelerrne enlccerepegareanalerareees rere Ry ela ect ce Le Oa Beene tat CR RRe eh etic eect tebe ekg gap bebescu nee gach et kab eA DE a a SI eT San AaERAS GER OOO TIIR EEL LSATrac ns hiceeg ATE 0'2'tae DASA ARS ee ECR SS S RE «coe ase eich avecrSSC reece pecs crore esateceaeretntes fete ace niet ottoTNO aS ni ON TIC tar Sener anon SOE SCRRR RR SR RSE ERS ONSET U A TAALLLNN
TREO CSU COCE REMY MOUS 8 08+”
RRRS eh RRMA DC MERION eM SCI ea MR SI Sen mae Rat a a CSE CO Oc Cn OOO oP LESLIE Sa laly Inia aaa anette QO OMG OORT RTRT#CG STALE E ATS eEELALELI SS are oalaraTarets aT ere rer arer ati ater eterenetetr stelatety ate te ett nat tol al ot latitatatats latatelata ly aatesitalalalalalstslatstelenaters tela ctalinetatae cots iaDscaroateataeetatanee al ata settee!
FER EOIN icipece aa o a COU URED SIE ESUSSES SESS est nOD IRS nS nS NAC ie coca aa BONA AR Ae 8 AR ee Seem e Da ATBCOCR COMMUTE AIRE Tea eta ey eaeeatEe trate ote cert AESTME EL (tl bele a ate sa Seale aaa oo ee Dts Wieden SPOS TAG Deol eT oe as ea es ae 924] a ge SH ne RR RR tate neretnt ena yc let ater ries ene atet tatedetat 2etateP RS eg ORLA Ege aera Sara a a eae @ aay le a alee ee adele led are alee gel ena eR ERHARD MEREBE SEER RRR St ters s re
ORT RRR ERERRR ERED ESR ere eres csre icsUESE sorrel aaa rinnrlerctr ner reset OO a aR 7 : vee THIEL RRS asscscecscet iscsi ENCEES aes! Slvr secehtes vers DEI SSS SEIDD Eo) AUD et SRR CET Cea EOE UhPSEUDO COC iteraREO pciepsonaesisestssstycsescc oS Popahhbers: OUTED Sh DGCy LOUD TEU TRIS SASS OeeRe CTcrc ee La eo ae EDUUE Sah S'c"0
iene us tienes :os. ..TU oa .ee. ,on SES ANIA NSE piaaigeiiet aa.TD : . les i ae . :etUPC GRU NoaN nou cere Beet ‘ : aRear aCN Sep COTO SIRS CE Cea
preter astes :: .. vars :we ;: Spr eneet SR EES al Bsa ms (UN ESULS See : -teee ::ve .rseS “pt Bet .2 . oo spe se Ci Se ae Bvirctatetens .owe . . : We : . oe moos bo. nat ... “ oe Wn REae ae Recep no, hee : 7 . Co ae ; Cie an cara .: a; .sears aa COA Bites oo, aWevneeal PM, ee ohetUS Sar ese itary 1 os vaee .an . hate .ae an Dantes, . . ue0ete coe nung 7opgneae wee a. my ue .3 .Jine whee . . :Senet eg "Othe €' :asos os ale ‘ UPSEE . . rr . ‘ot role ee De ‘ ope a ee et SeDt Lo aeae Uh OM SS SIU aa Seeso:; = isene ep: ae eneaes veSane :wee : cee .S: 2Bae BOLI SSDS OD TS ON RRO PURER DS RRRERET TR URERERRT RES ES TE earn ee OU tie as eel ele aD stale ea ae * a - - Soins . . nies ara oa TUNED DES Bing
Reeser es Youge, EE SERA Teese yee wh OM oe . RONEN eM SAS See RIMM OC MSE ICT RSC SNCS SEE CIC SCOT SE OE SCAN COA OE I EI Ea : ae SESED:
Bryce eta nd an UO A RE . :neem Saattnrnnierintntites sr Wann ee aCe : ra SOchiteeatieg ” CAE TUS ho Tos UG ectenatasccncacel UU Bich tic noting innneanninvetanenasntansnemeanns cities :. MRSC SEER eT gilli eas a SUEREEIEE SAREE ratye ERE Pissercacacetatacesyececatacet cecarg’ cacetasererecetececctacetatetatetetete statatgtitatrtat gett hie t Pe ACOA ATES eS os wo : ara en Oe LURES OO ci I SREB On Res ere oo “Ret ailvan cl Soci LS Ea
Larnaca etyCORSE ree eee ara MARTA WAAR Hs 0 ae DOEIOP ae tarace Ce SCTE ares GSS ee ats : Poe ee eta a ety ene IC tena R RICE SMS CORRS pESODBE OE RMnhMMO MB RSM ONES CASS ET ros 2s eta 8 ee eM RRROUT CC EERO DEEPER LOCe SSDS NNO ACACIA ORCS SE BaSSannernaaee TLDaDIGI acd uric ane SCI ae peer cb ocoe ENEote RDRTSTNCECSTD Ova SOne SUESECDEDIQESI URDDEEL oy NOC TRRLALAC hagSC CALRLEGA TT etEARN ACO MEOCs gee LEM neg RS bogota ey geese Reise by EER aR eS he eo eerste nicngsnnne ten eng beens cteiiien | enmity ORIEN oe CO nen eect ENS N EWR ICR SE RICE IRN TIT NENT la aay OLS NR AEA PN AARNE RRANA NAL ELON SE RER EARS A AERA RENAL EN RAMAN aE SAD ART. .
EEnanerorereee Srkiekeeees PORE mh a ROR OOS tin Git casa OGL ne Manilla aniuclemns nee yepe aes tncawcneitergtnntt Iai oPeacteaeanoe nS NONRER SM MERRIE Li SRN SON RUMEN SOL KERR ME SRE RRRORE RA CRERE MSN RER STERN CRE EA MMR RNA RNIN SRR RCN NOI Ia SOREN SSCL TREES TERE arienrecarerea ire eretaneretererecectconececererererere'gravarenearatatecata/ nara teCoNanytetetate RAN A Aree Capac agace Se STAT Le a SDA CACHTRCAADP TAA TEA Aa ee EASES TSSEccoasacaceckcececncecacace aca ev CAcELATeceeRCOCAEEcacptacebgcacetacecatucrsdatettebesattatglyletettalttaatghstai tel a sacn es ae aTSUALe 8 CU ACABG Hees Orel aetna eae toaiaeaearanbeer eure esa ietvaatiencanccrecieestienaceaaeaciens Rey RRNA Ton NAT RS ME SRSA ERS RN RR AREER ERE RENNES BS SR AG ES SSCS RSENS eae REE SNE SRN AE AS EERO REEDS Sk tetany Oar Sten en RAM ASNAa Sn ERA RAR EAR EAE GN ERD oe AC AAS EMR MRERERN ESM tatt Rtoiet tester mantel ss KR ARBRE RENE RSE R ERE RENAN OSEEEN, | | settee SER ERcoe ARSE ORCA CERES RRR RE StS SUSE ORPN ERSTE REI ERICH DSSS TIPS SK SOL UES INEM DNS CRR URN RNRKTOS MESA UMS ORRRRES REK BURR NEDRT ERI Crs NOMA PRAM MERLE ERE AMBER ERE RRR RRR Reenter MD AE ARTS CaerSR agtrrarsi cer sett feet Cee . SERIE seers sures ecberaranensiecsenmeeian GEIR Crimi in nein ceMCR ine ner On erSR er ESE ann ce cy RECR CREE CREA ri nter hs PRUE a Rig Gio” ROQpOO SCE LE EE EETREBAR UU EERE RE RetRAMS RE RE Da UES LaneREBUN gD RRND OeICG ee Oe Se RE NARA RAE ERNERRR APRER ERR SESE BENTO AS LOSS ROSSI REELER Re eee tte tet et SRE RXS REAR EERE RO EERE ERY ECAC RN SS oe RR SRE OSCE ESRD UO RRM RR RE RINE RR RST 1 CNR MMMM CORRS» NN MN ENS a LS Wale ataie pune tater atatrtenror SUN AN DARE SRR ERT ERATE NO CRIED CURRAN Seema eielrteaacert AREER EN REVERE RR RRR ERR
SAN RAK Pheriiivnrtomsnberstemenonnn mente eeensanes O rr RRR RRR ER ERE CAREER EREERRO SER RNS AM = REE 1Minn watt MsSree VERE REaes ate TORR Ra ey atte ea SHARPER aA ORES ECR CRU AUER LORE RAR REER ROR ROR DR “Ghkits nooneemipestooonooganneagen pean SRN RTS ASSET EAS Eee Ne RM RICA OERRR DS RSIS SESE SSNS RRR ENROL OREO. « ASR CORRE RRRE, SOS, sone Se Ra LtnENON Reset ee RRS ERE ERE ERR, eer Ra ORE ERA RRRE ORE AS.
Benen ene MOINS PALIN ASR AERA KAD ORAS, ot btn nor norb apatite ip Aipdstwbeach icine eS Ee ER TES OREN SR ORM ESE R SMEs ARIS OCCUR IRS TR ENCoahatatal seen PasanaB ne MoeEtatatc Shite t tt Set tsese eR eR Mec Baks SEBO SASMCE MORASS RNAS RE RSE MAM OGROIACO TES eCRCO NAEP ALY as le la ee tetele rir tetaere ecg katadetet
Reta Bonev cwenrenoav SENT TAR SS A COREE ETOP igen on RR OR Saoanata Metietnioencsrvuce sarSEES imedSRoman eRe SOARS ET ER a RRR ier tee BE teb tenn R000 OCA Cr OE wRSeee SN AAAAAR CERES A DEARPUKE RAE BLOOM AR ney Ae IYOMS Depa aeae pe THR orca gee TORR ee as TE RMN stesnreveriermncepeomrr ROT cite inom Nea SR Sr ettet rent % eS LRERS eR ERR ER RESa RRR RT Bice DOOR AGEGE bite ine tonieesnnineane tne eens OUROO ET: SOE MELE saan eet ne nea Snee eRnOE Painless vans rte aeRO ces PE Se NS Lasteeethe MERE PPE eo re ee BS OCR Re Riaiti ea rthntncn nal ain etn orn cs nian ean alican ert Sin nck cM ae aR IOS See eR caeANA MOED ENO IOODOS NARS RALENE TOT ROT R COM ee ME en OLSSON SOS.ERERRY Sig esnenae BER Co SaCODEN eee SE eee TEERMia ES OOOO RARURER reninSSAA ee gh icone ace teeter nnote eaeeee Shs ANE O AAA IIE IIE Es OKI NAANRABD. A EOPSORIARORLS ee ON RAG ReBR cre PM RESNPY ER cc a coe a ROR BERR SS OEE EN EE ESE aK"sae SERCO LTT Ls Cann aa Sees:ICONIC SORA hpi ee bare FoEg ocean oethre LeAicicecarichacaice a oC a RR» RR RNC ta RAEI a RA COURS NMRA MAK O seeser Ns terns vane caine KARL? aan na natant inate aRED pat WC rt" Rane iobeK OP IRR Ee NeRa eyRe ee aaa endtitRE Beige MNS OSE NNR ata EIRaeNeiene a cia tLe Re Hi een MORAR CERES LESSBS EeeSSeeoa a aa aga IaeAEE SERN oe SRN| ER RR Se SRG ARK sins ieee ressPeRC NAARR Sees BoaRD ostetatee timeSABE ee eee sech AE PON te AAMAS NON ayMRE ON OIC TEESE EE EES Vets Moy ec aceleerecererprareraeracern: eeRR WOM Sepa aDsinOeataianat ur eeteeee OC ee rRA NODRERERDORAD eben LM oe AM REIS I RD a RR NAR SEER AIIEAEERE Ee ee mRNA ne ee eee ELT AREER DORgrDEE ORSR RS rihnenteaueatiennaumegnt oe eee eee ee ECE CEE ER CECTes MRICS RRR READE RRR: MER ER RRR MOUEian irs ae n iM tnninaa teleOO se TA RMR tia PASE OREN ee ee MINA AION beatWO staanTINIE
EErteeR te eRe uO RR RS Nee ERE ESS Renae ALENT (aOR eens ery Ore RTE REAEA eRS220 EUS. CRUISE ae SI CORES REAKAM RAE RR CRNMR OnKW eSKS RSARM oe RA ir etn irmn ror nce terrier cee eeete eSoece UR Se Teter PROS SENS RR MRC st MORE CEST RMON ts Ri UM VERECOMMENT SS RARER RN ORC T Cs KO's CRERMORY RANE REL ENERO 4.2.7GE 1 TORO AD SAREE Hs SKANK AMEN RAIA RIB REA stereocienenennnnes eet pt eae
SERRE SESS RR aR ERROR SRR MR ee AR aes atom et SESE RRO na SN oases Ee URE a aa rececie nLite nr tnenen pi cement initteeeenehh sateen eee eee eee RRR SERS See aoe oh tor Sra rare TSR ER SEATS tS ST RN SSIS OR, PERE Cay nas RR CS isectiece SR esAcasarardrarensteresptarete’ Cecacecoretenstatotaeatatat tahitnty ERE NRE RENE MRR IND to SIC ro, 12-880) ee eee) ORRIN REN) AECRMRRAS MINERS REE AER RNS fee NRE NENERR ERR SERRA REE AIOE HERES SESE ASA RO etaearns CRame SOBER SRR CRS erIDBME eh RE cena geRRA cramps NR aSORRENTO neha orepenn es Ss eeSSS St ORE SRR SONAR RESIS ERESAR ERTS i SUat OPER aR eiEAR RI ee COC yeoeeie ys) RNa anny Ca rele tnaiiotete RIMMER ERAS ENOL R ECR DOOR ts 20 SCS SERS RRR: RNY: ‘OORT. I OU hss seat ah RTS Scere SAAR TORRENS SRE aRE anataRRR arceatySr Se amar
Reese eatetgtatatet re SERRA SRR Re AERA REAR NEM REN sea » te Ai OEE RNS CEMA EN |RR RR ER SS ERY EN PRN ORY PRT RRN ROR RN ax aan 9 EET. pDeaseiatare sacra aera eae OrA NN eee ARES Mei Bea eee ey areca eta alas ecesaensest tt CRRA ERE ERR RC RT
Batre teac Aaa teeree eres OR ossaaere RRSesSER ENR RIO: Cage Ao SHER RRR SROeee STateSR RAT RA Denne) ‘ Siete mane ceeEAE secaRANA See atta Semoccaats Rat SEDER Oe ea cece ee SeenSo SiaSaurenorsctenwan ce RSM tirerre rte lense eae errrORR meenaRR SBI trecaeresecare: te) een eearereernaaee ote Cee dt Se anteSERBS ee FEAKANAKASEEEEPAR RAL EEener REE eens RED ASE heen eee ee Re CPRNate CR
PISSED stwnteneneerin caer EERE net caeser teed EEE rea SOROS RCL TR MER AE LEEPER CRE Samana igre SSRR ERNEST SREas LreCUR ect Sree Peeearac Reg tater EEA eR Cone Sa RAta ERE ORR ERY RE MRO ORR BRE GE cena Se SRR ER RET Bae RSS aCeCroan MRCS LR MaaSERRE hee ieeecreas inet ety OREgE eee ieSaeeae SORE ay eee tearenee oe BURRS APE EEE RRR EE BR RED CTE OM eatCSE ty eee SE GaA eeea aates RETONC ERS aEEcere SEER Od
EEC OR teres trates Reve ena oe pone RIS RSS EER A Sy aeBeNe en cssSSeS Soares Biers Re RSE RE CRE athe peattcnummni arma Saget eceees eeatay " AttSa ah Bee! 4 Seas SHARK RR AESASS AS SNE MAAIUS RAISES ATOSS TORRYTR «|. SSS «neara aCaNRRA Rae maSRR an I SEna"s"Rt CNR EEE Ly tatSe MeSUS totn tataort Sekeaaa datasUR pry eTaretyatetatitatersteretecet atatet SONS Se RRR SR REE RM 5RE eee : Eeiecets EMSRS RRREEERERERRR ET EN EEE E EEE a SSR eros scteneroenes seater ints! SERIE EER LEASRRL 2 UR RRS aoe oSssaE seats SOP E AW AEST TR cane RA TROUT RE a ERE trot cgraretg teat taratt ents aPy eR EREscatatabatebatetatetyt RRR ERED REEtatty RR RR EXE SENSE RRAARAN EERE RANE REN ELSRRR ERE RAE RAK ENSSLE EAE RMS PREESE RRMAREPL RESex RR ER ERR LR RE RRRRRARRERRMAM COMED OUR care alt ROO: REARS RROCNC N OSeae EL SE CERN LOSS ROcre HT anus RS Sacaca"sravarerssataceretetotetetetara’aratern’ Reena t-aracatin tari taeL MMM AS MRO RSE NA NE RRSEE ME RE ARH RAR ERE RRR RRN RRR RS Ra SHER ERROR eS NERC A OS RReTarite 8 ice Key. SBS RRSP91RENN RCE Nst st aM ee EERE TENOR MERE AR BREN MRM RARER Enron nettle tniirrawisstnnnas eee
Babee ee annem resrarras cee Rein nitanieain amram anana BOR. gee See so ret ste ers pee a ic SCO SORa Satins at es ASU ne EASA ROSTER ae ERO OO ON OEOO
Bats cearocaae EA REE aR EN SLi as SRR EDR a a Oe IR ES ROR Re Seon Scio ea Per enesasein nee cence eae
poe SE re etree StU Sit nance etry SRR cs UO RRR eo SRicto ae inte era sre ee Scene seek SESE n CL et a HR CC) we seers terarerwrarecar area aouinratecetetolecatacatoteritecrtatatatieitetreetetatatatetegtetitatatetaestitatitatrtrt retina eRe HMR RLER eB SRE BAUBLES ers oy;ORR ae teste A ORE ON eR ERNE STD oe Steet saat nase RES VERE EERE NES SRSAAe TSeT raeapatatanetetatatetececdeerteecnctetie: reeecaracnsacnateecast essiyed ‘ teatinspurstuteratatenseataarererrieittocrsateancocarestee Sr esietereae ees Seat erent SESS IRN SRS RRC a - RED eS amen SORrere SON Sa tate! eo, CRS CRYCOREY ote SERUM ALOIS ROO, REN TRIsee NON SRA EN agELA AEE AtAEAOE AVERT MAKE ERAN RE RRRRRR ER ARR R RRMA
Seitetene Rtn “Aetuaiee x ebb sa Eeatattatetatatal REelatecntatt OR ee SRD, erbe OBESE HP CNRRS ICRVOEY renEEC aS REN SSMaR MONEE APRA ACRE RENE SER ESE CORE OMAR ER RREEE REE RR REE RE DS cette edema ca arteELE en NSN ee "os AMSAAR Te eae -b 8 aeRES ae ORR PanesCRRA tetera reanrean hatet“aRENT ttORE COEUR REnae REE RES SRN REtetAMEE aSSCAN Sn |Ea ate aSUT eetatattatetetotetrectet te SBR ceCERT EE EIS UE SMe CRECS Tetete orate scene erect tc eotes eeererereecat SSSAetettee en RRO Cee EE laatetettetetreutesndecenieerertansacamaseretaretetienensatat MANURE POR SRN R ACRE NE NER ORR cat enna PaO1cP Sot enatER tessa tae ICRNSE a aSCRS Fo TROLL OReS RRR RAS RESTSAS DEE RRRCNTR EERE MERE TRE TARSENS SERN RRR Sh SeReaRT A MEMeMner hemes:
eee tegeaeeataes Seen 8.0 RRRAAStora RALROS MIDS oPBRS EWORES ae atacarere SEERA SAMA ARRAN AURIS SO Sy geen StaARR pA SII SALE ESCA IS TSS ROR A" {eee RMN ENCU EMER ORNL SERRE ENMeee RENRy Gir otterRee eReERR steiner UALS O N09 e a a eet RSH MRT 7 Ress Seimei res SENSED MSU MMAR oferta SSO RRSP SARE RRS LST ESR ERR cM GEN ORGAPO.) B ERED REE REREARER KEENE totes eae L Lior ar itn br nee EE FARE tee mam arranreasenranilecte
Rue Ror a eae PaAR Antanas siete ass ERs eee ns RR eC ROT SN BR eran BORN areas cer eaten Ritch ape Sean a SERRE nO ae nee ena rina uthntnnn deere eter herman sreieeee . ae a ee, Se ea a Nn RES RE DR RR EDEN AER CEO URAL A catia statistic tartan at AAU E SM EN NEAT PR TERR ERO RR ete ESI ERE ECE Dir ein sea ria par SORES IaakentyasepeauserasscacasenesaseseneceenconenanecaenceserenoreeptecatatetecréetoteCwetatat tate esas aes op ee EN ORE Pee te nC Re TCI rr Se ete scacataretatetete a etanatatsiaictatehstatstatatneaeat tat eter ithe alet tak Ay REARS BEE REE RABID Spiers state
icececatetateretata PRON eee MOREE IS Pree Pak ur eh naemmaen nnn rner eReMilne RE ae Gn Sy ah 1 ERD NERD a SEINE SERENE ICE RS atalatelararasitocsnveseieernerneusgernrnerse ceMRT neateceeen ERE ge RRReter RENN BAS ARSE DORNER D NT ooG88. tT CSRESEES ERtatsRRS Wasa V UNOS Ret es uSee ‘ Crane ts SR RE prureir Se Seren AIS tas thtLC ston ASchao AS SIA a SSMS SRST ME caer HESSa=pirees ERE KKK RE, an Oana ateGregan a eeSAR NTMB Te AE aeeeane hee BREN Reena ah Reuante Nausea nenhee SEO eaonan SOO DER OR RRS RS baines SC RR Sh oa Ree cate ere reSNteed aurea nariustusearnisn Dn enerSENHA rReen Se a ERATE COPE OOS RRR ORME RRR RCSB E RE cece See ante - Cees EERE RN SMU RMBRMN ER ERE R SSRN ARR SERRE SSS SRST RR OS oe, SARIS SRR US he RR RRR Sa ECR Sa RN: Bata fatatatetatetotatotctatataetatrtatrtca dec tctytetotete tt eats ce batt SAR ORR ERE
SESE ERR SEES SEN Peete rec banc2 ree rerun :ene EEC TATCOSC tea EREORO ERRESIC ROE CR SERADAIR EMER SSENS EREDPROT PERUSE KU RR UR EN AT CMR pochcoeceeenreereneenr rt ctr ett EA ea Cane aa eR NS mR oe oR RRC EELS SES AStina RASTA, SEnreete TE ‘. rier etatocs! SOR ORO TT RER AASDER SRIROPS eKROR EM BUX ENNEDU RESREL LS EER OER We nates ” 3 PEEL REE RAE Ree ET NEE!
SRS DS ato eC eee Seances futhendseerncsassieens crate Baie earn cise eer cet tiaue nent ni ereh aia ces eves ores Nee NCEE DATE ODED “ Set TUete CR PORE a Seamer iSneN oe oeRaa EO ee ann ney LE AERRRARE RRR R SEA RM ETM SS ARN SEASON SLyearescnriergrett EA UCAS TSN SSOSCACECOSITETTTOCOCOCNCNCR DRS eur EerTnrchacanerrrace ste etotacstatavatatitetetetntaatatatrtatstinbrtitate meee mn Tee eR RK RS TREEROMER ata Tet ne eRCORE eee Ee ESATER Eee RAS EE EU nd
Bo Ses se 1 SOE Con ORR a aes eee eRe RR con ie Be a oa SER EEE ESSER ER ERR RR ERE BP orgnanat Ro Rteicicrecrsciccrriseiattart crete sea ne ogra Rte ERR iene ere ee
STD Rape ARAM GR SOR SRE CSO TT aE SSR SORE RS SACS SOO ESE A Ge ieee SO aE pom Sab ae a hehe San eae So ea TS CET Soca Ne cenceaicechys Rene euaieenes MRR h drorr betel atatedstnenertsteneanepreneerttconecines tree Sie oe Tee apt eae g 0 REESE LORRI Seb rapa $s Sa OOO A SRR EIS CEE tae oat Se Reis Sroabec rr a> ee a EASED, MIEN OC CR ERRORS MEI SOR CORRS RO” CSOT 1 Rae EOD REE ORR nee SRO RMARR Rui i CRM RANG RN CMa CS Oe 4 Sei Sere REE Scs RRSih RMR s.3MEE De Rn wate ORNS aR RES OS EREae RES MERCER UBMs Te 'e'ein RR aD SOREN RNS SUR OEE REM SEYcet REY RRESERRER AEROSE E AESORR AREER ERE REA AK ai” DM ONES noe AA RRR ODN RCS LAN eae eee8.1.8 ee eT Se28 eU Eee nerd KS 5 Rae 26s. SMS NORIena Cae os eeSESE weBOE CS TEI antease. Earn eee nateDOERR ieeeNES Cree ete e aCORNEA? eee eRe SAE a Cee Ms Eds aR, ee Ae Cetabe tke ea Se nO 8,8SP . RR BE eReRe eid ak cates eaten peee 2Scarte So aeNene REetSRE EER ECHTE NEE 0s.OIOR, “Se CRtera RRHeSR Sate nieRRR Baie aorSarane Sik a eeRAS, Sa 2,t, a Cs ti8908 RR RS8EOS SSSER I
Hersras oy Sek GREER SES aS RR RRR EOE MC qeiceg capers poset arg tee aa Ree POCLEEEERCERECUCEES: SR a se ae PS ipercaearn COS A ORCC I hack tener Spee ES, Bic dk ese er tae a es he IEE SRDS SR ER Boe . OP WEEE SSS EOS Oat ae cytege cos states cee te gtrtee htc ect tr RIEL eae Boone ee ato ERS SEER EE ER” oR ee a age ee Bec ASU CURE R ETE” ERRS Be RE: RoE ag see ee Wea a aaa CS Se ae Sa OO SR RR “2 Saas ERR Sot ee aM CRESS RRP RICE ana stats st Eseres SR ar SR emt Sea OA aN ae BRS ae RES Sey ORS SIS WROTE RRS SENT CS OOS OMIM ier SESE TS BSS, 0a RCcee A IKPecans ek. é eet RNR ee a lt ee eae Be PA BEES .8eae 8, a. Oe “3 We cast Peas. Sti coe “iil Shan Keaus Seec-s AA a? SASRR CR TRS Tg Sota Fone S50 - See SERA SSE WORE BR a a OS eneOBE aeRA poaaoncce: Maaaean ORES css casRSoe Siar teSOS, SRR a pee SREeeeRES Sac0.0,aie Bg AESERCO aes ee teSOT SoeSEESER a Re oa tet Fg: ETE ROR PRe OSIM nr cgcites gate cteteistest AUREL On St ee gel hpi ES ECM AREccscecetennaesteets RETR CAE cai el erg CORRE R WN SOR SRT SHEN RGDstatatas DARA ERa SERIO SRR STEER | SONOS i NRE Rs aiYoe: RiceRa aR ee % SeeBsSia yr aE CeeSREL Eocene Sppeenecorcenn comes * ERB TERREaaRRS SQthg ce RP ree Re ee SEMENS Ge rhage Feces + Sooke acetate ORE ee ORSE® FEE: res. RR Se akeREE ascean&:Seat ¥ Oe “IS aE a sR SON eeaearecectcest erasprecerscbenrerertsractre en 5 ARE eC DERE SE POOEN SEES EERIE RPLOOHED.S, CRIDER. #1 6,600 008-0 8,008 0°8°6-8-0°0"0 1 0 Co Te COUR ROMER PRE Uns RR eee tnt aR SE On SOO RRP EES ORR OR: Sie ae SRD Ree Po Mig EE ROE ORS SE Eg ae
BegenRae SeetseeeOhctatats eae eg a eetithe eaea aa TR akes SRO aiaeSSE RecA ReOS,Be‘&Re peShES ORC REOnee ato teacureaner ce aon ao otesee UR aER cae ees ORRe RE Ou RRS Ree CRD ASCE R Se ee FO aee SaiRS BRSSS SSS! SRSARS OS SRSd ER
8e . 5 . ° *9 > e
BST MUA ih ARERR RRR OS ISOS NA ERSESREO ERS E NERS REE in oR EG GE SE OB BIE fk” 08 SOIR AED 8, CITT TR a ae SOR CM ar ge oT) RC es saa sr eerserenere os stale Whe Stale AR ate ete Salata oy a b> Peo Eee Sah Ses SO SG AeRTE SORES IPCI a
Beir —e SOE a SRE RB Rha deccbiob a ROTOR. at BRS EG SE SRR Seca i Ne FRG. SY TR ge cok nemo ehhekgengec
Rr re ee OO PTO RERUN ORR BADER 1 kr ie is ot ¥ ee ER RRR ect SE GID Oe car BOSS, SIRT EMERY SIRES SAG. cS ENN SRE EERT S RES RON MESS SENG CREM SMOCRM RRNA SMR Aer: Cams SRR - Sa Cie sea ee 5 a Rae ee ae
eae Ie Oe Aeg OW eee:. Lo, SE ESS SE CS BOERS NIRS” )-1-0/0.0-as0.erecac ern ern.) MARRCOTE CEPR SERRE SEED GUS EEE ScCcnSSSE EMSRS CN GRERTS +O. .Ae: bone bee paces SERAeeS OE eRRRS CLR RNC300 IIEES TICES, CNCSS STRTE AEE Raa CCIOREEE #:OSE FEE a Ie eeAGERE. a a a RR ee ANSS EEE ES OO ERE oo wieSED, ogg-
{CRIB . .atve SAPP SELENE SRC RE RIERA RESTOR 2188.1 RES! CRS RES ROE CORRES aE REL #.-0.9°8.0.0-0 15 OE RSA SiHR SE, Br tsescrctrees renacr.oa : . .ot De. a‘ ;awo, ; : aeraInN Eo CS aOR EU SINCSaSOT CHSSSABA RISE ESCSOIEGISC SSS SRE ORONO ARERSSESRODGL OER MRLSEU OER ORE CHETPOD ORES SED, ORES RMS RSE "8 00009"904 0) rR RN EN
Pa aa ees ese ee . . - - ate . . oe eres aa ares . plate eee ae eater ere cetera ete? Tete) e%el.) a MO EE SS Me OR OO
ae : ‘
Moatearenatsta cece ve cere en eet els ye le Tela elleleleelsele teats let al ley Ween a : CJ sh Ue SS Sn, 0h ag Gn ae Se WOOL ed ODED SL eee aS nn rit iit eer eunelew new ayingiegs OSU Ct a an nea
Op: Figure l mass moveme : I Flemish ovement et werk on, Spreekkoor en massatooneel (1937).
+ a5 « s . man nisto 1 tadiu Berl F pic mat rlin,2 1937. From thein Theatre Collection of C]Uj1 Bottom: Figure 66. ating Spectacle celebrati “ in JO a fGer. gu . Pp acié€ Cele erlin in seven hundred ye rs o1ogne UNiversl ly.
|
>
‘ a. . .
ANHANG Chivesi yesiscberIianz
Se EO a. Se 26. se es Tarz 2 ;ees8‘FEE. : am \@ 2b Ch. nes a &. Moderato
f .j1.CA H a
{4 tka eoCE EEE YY SER W).4, 0 eee en ——_¥ : Se, ‘SeETAY 2,bEOY a Oe Ss ' >ASOR nO fo Sg612 naneee OD
Zaigefiager hoch sus sehnft La er . i‘REE ARS Ce tceereteeanaeeeen Ree ee: eee EERE, “Clary OE* CE = “Es SIREN ER, . EE CRE hEI«= Oe:
gestre
Satine” LP Moderato 7° ‘O09 aes ee fh} CEE; GE EY SP ee Y ee ¢ : Klavier fi * ~ ne by eeGon oe oe eoPy Ee’ 1GRRF SATE GEE TREE CRN, {OF CNT CE SD STSnh CA SD. OS WL a “SE it ydGRC: i ‘06 SER o,AER Cl «. Ch Me weGR.ee.
Auszvg) F PP
Ff ‘ ' ’ schrift eS . Aa7 -= A=~ 7 . > . ° —_ .vr.— _ eS Oo = aan 4 = 4 a Wee WHS SD ¢ ee SE" 2“ 0 Te 8a “oe 2,CFU, Eeyl 22) EEE 8 Pr osEee eee eee ee eee
rt}4.5 ‘2. aN TAs YY¢sd4 f enn } 2oN KATY? Yt ‘a 6 6 8 0 Gets 6 0 2 on eh 0 6 Cee eeeA'S af 8 oo 8 Ce 6 9 6OO Oh We Os |tt}GEE SEE CEE. DHE E.R Th Oe A A, CE © 2 ee . : A L) 3 EY 4 CS ont & CEN * GORREETEDT 0 CEE. ¢ CUETO J
© GReRRESRER EN o“er ET et Ghee QeSY. “Gees ee Sa 9 SSRRTRTRY SOME. 2° 72 RR GPRS REETSE 8 ANRONESN > 5° OY ees sae 8© AUS CY: SORES ee 2eeee * Ts LS: SN“) 962AOE “TE CE © GeSe6 PE Ee OB 7 Re Gee 8AGe © Cee Gee
. fs ° Py wr . ws ‘
or} STR5.8 TESS PE 8a LS aani YNMeee CONS1.SRwe te A A) wee Ne RRND Cee bed ei se SAS CEE wc GE NE CTT AE NE ENT CED SMRSAR RSNERIDSOTS RN oe c05 050000Se o Sees tehs sg RR SamanaERE Sa 2 eS eS ee . : ERE IO SERRA a RR SONGS SOURS eRe ‘San oe aS Oh hts a eS ERR RE ESR ORGSr eS a aRR a eR Rae CESRS eg. oOo n am u r ] ] [RRS SE SB aes en Soh Si RRR RS RSS BREESE MEER =r rnc aMRRg acct Sa SC ORR BR le a RE RR SRE
SRR Sister na A SR RES RRS RTESENSCRRRRSRSDO = 1809-00820 20001 0 RR cecyecece CARRE EC RRS RE a Re eae ENTE EERO
Bee pitaRR p thant RRR SRP a R82 EAC Sse acre es oo ee nC ht naan 9 5 SERchntag on eetiara ORtaster RRStenes 0-080 RROaaaCO cSoS SSRRR SS REINS "HERESIES Ue Sta Sa ROR ERRORS ost NNR tte iy ine RRR RS RRO OC ER Re ERRORS o« SORE RARER RE ORR RES as RRR SSR RERRE St -acrtrttrnns aN ste Re tc ntrgcteeeatiteet stat te ARR 0 cS ee RR REE rom am u r uséeu In ul Bees eca a ele e ys Als tara AIMCO NCo rere n 8 RBS A 7 7A 807 won e a Lele oSTACH NP ta 681 SS eo RR 67S SS SS RSE REINO SE RRR SIR Sonera PNT SIC CREO PERU E CES Eee
Bee ategeceaesanaelegh tantra ee ERO ORE SS See EE RE, SEMIS oc rete cutee cnretreteeteapbneter ttireasnacseec cooterenreeaeee tinea
SR oe eee eee Se A Ras pare EO ah oe sraucagacnrarecetesseseperececenaaen Sige SEARS SSRN Se S tae A Sag fetctatlatea ERASE OEE aT Seater aecatateas vee laeens Satay y otatyty! a
Be seiecsrnececnriennscartontemnaiemate etnies sects caer COR NAR ates tees RUMEN ANN RR NSPE MEISE «>: SRRMIRRBEMS. coc cS Scctcascecr ac cc setaeeternCatecascacelenecenr ere ase baleen cee
NERC taba anaphase oh Bi SN RAI RST ERR SSeS Cr OG OUE: CEE CCS OC OCC NCSC CURSED: < Spare an tntetne RRMEMMERER NARS ERNE tS NC eR ES ST ies "= REE ES SSS LIN SR Ha Os ate LOG SSSSEAIEIRD A Soot Tei rcr ees leo alele eae aes teta tote ASO aS ROHS NSE > -, SMSO. ecS05 5 ice srspaseregbcecsye acoso elecese care enevate erty Weirver alee ream Tee ENR Se sce eR RRR CRC sant St Rg ee erreur tet tteceerctetage: ci) mamma 01,11 SE RR OR ARERR RS
“Se RR SES EAStata SS ROR SERED fa (etch ent 0 ree tM orcas Mrteennfcteec eee eech oo SBMS 202070 IRR RS a SSECEREE Bas ee ee eatery te debabon terSER. Meee ot OS... RR neces Ra RIeens NR se SSpa -°-° SASSER tetterete occceeeeeetsscetesaieeas eos Teaia eeatatelteletac ce:gaaececn cet
CoOL ee ORCA EN Ra SCR NOREEN oso cececa eects eeace' ool a Rae es seececessacetacscacaterecalelecenecaceresstacecarecetacecesstecotecenete ecu SRRRERB he cee eee 1:1 SR a. te eS eR) Beata scehacesncarecasacecaversiaratatersroretahe’ateteta tatateSU escRR t p's-s'v16" ee ERM SSO: MEDS °5+)- (1 co RS SSN ESE CSCS +c)”. eS Se CANN ENED OK ee ERR AS SKS MERRIER s Pith esc ecneeran a OE Rag nce ee apace ame ett SNR SROSE LS Oats EERO
TORS SSBB ORS EADS RRR CePiers pa ecco Lee RCni oo eS Secemetery RS SE sacatatates rie Seer enceRR a terRRR ada co SSSR nat aniaIE es 0000008 sen Ras SAR ict SSS cinta cecenige
ati Mate: RRND SA RRR RR RRR NRE ORR KOA RITN SENSE SURES =~ -)- (SA -8,8.6500250.0.4.0.0, 2 cd SC EES ON RRR RRR MRM NINE OL ERR iets cebat conocer orate, a a RR TST SORES IIS TCI Ras e Satin erconemeagenta, acosetarier oc aaaeatetieten
Seas Oe CREAR AERA ERAN MERE RMR IRSER A 1 080 T's os ate - 5": CER cc he crc on ERO UE SIA 6" o WAG ono 5440" s NP a OE ORE OT a he a RENN EAERA RE SRR KICK RSPREM esa tete dete tat ete Se Se T AER SPER Ste rece conte nr atnentoa neat Pe PEC CE SL - “ CRP SINRIMIESRCRISED, £-8.0.°8.0,1.0 0.7.0. 1-s CRE RNR RE RARE RR MIICS 5 RECN E RRRERS IA SN ® ICT ID SONOS > “oy OTRO RFT IS OTR RNC RROD RRS s-0 000.1. 11 71 8°20 I ROR R etr eri siacs rcs ia'er vaca eetytetyecy oar steric sis aceteteseietaietatrtatattis al
aESERENA eR SAEME (ont CRU RRO RRSARI RT 8000006080010 RRS RRERSE SSSR otro” eh:soos" RNR aa 202-0000 CRC SAROR RRY RMB ES AOE SE ORR 04007 otc cc en SORENESS e"o.o'e"0"1 ARO RE ESSSSS SSS SNES
Seer rne “0 -eea haatAa DEAS td bs SIMO PSGR TOEERE ala nen eae raeESSER at SORIMIMIES, -.-2,2,3,¢.8;¢,°,',+,! SERRE ARENAS Sa RMR KOH BarAOR ARN MRR SRR CONCERN SEER 82-51-11 OE CHOIRS RS RSE|IRE YS SN MARE ACS ERE OE EE 0 ARRR RR a SDS8000 TAS! oon ei RR lle RE ines Seats aR Oa1SRR RRR
BOR eT eg Eeeee CCE Ht a Ra LEED EEE! Gti oe Tees SISRER. «.°, REEER SADA: ROMER) B's ocolecaceiscelatatetetetetete ry eee erecta eye SRE str) ete te Eeet 2 ae reIS TREY ele oh MODERNE St LF EERE CARRE Nee NCATE gASORI OA TTCEreatetesrie BR TEL EAT CCED I LaRoteR eC OSC RE eeeRS Areca eiiec cane
ne 8 ARS SECC LN PASE GE Eat aay ETA NATE .
Reo EE CECE ete a ates OE cccsrantniie ciel -onsterenemiecice cao whee SUES EME Slates ovat dat AOS eral aa ae i RET SAREE RRA RR ASL ES RASS TERRE ERO: B on seprscrratanreiteararccoritattcmeeteiotsbonretr rtaitetitrttasttiniiatecan icin cece nen UT SSRIS DiS LES SRO e acccccitecs c iceacncecne cca cothyg@@tre coscasetertaeeentnmecatessseyrarsttatettanntatetrcisicrs cnetien ser
RES Bee a 13.0RS .969-4 NSU MBER STE SAMAR Tal NSA arr netee TagIRS eienetrens cere ahaa cacy eae ee!SESE nt hr aan aa OAR IE Macng Mecnn CN MOC RES SRUCR A SS SRR RNAS 55ee aOTcS RRR a :ce ciictaneeneeitn ene EE SRAREA AAA AARON KOK SAMIR N.TSLC TOR TR a8 1 ROT EYCUENERES SONIA... 6096.101 os 7o7s 5 5 0 Sa 08 ROSNeo 6 a a retee ee ete RENE AE SER SMSC ERE BAAR ENA N I ERAN ‘Siienoarar Ll Pen reticesec Rec UCR OETERES So ae eae scr ascccreacvarnreerers searAANA cesvenneaaetnnnensrnaitienttieien crcrrcinmrn Re eS relent omens eine aD0eer LETTRRR aenacernt ee rehRc ss RR OOM, osEELS cere cnyelenenegagenge rene SX RAM AMA RE RRAR MERE RN AEN ECMO ER WS
Bi settler to UTE RRR REN SRRR gayTRCRO ie a goa geceonrrgstieare ee 7, Reemir Rntaeetenbbbreiee a innpigmecetsacnscoisntt SERS SELLE DLESNR ER Se CR SN ooo ot RSE OE CU essay omanSSS CeecstSa Bate ratstece'aiatetn Neel eS ie RIOR 1 eRccaR SORES = "=" "TE RET OR RES RR SRE RN SSPE BSS A RSS RAORCY 9°8:8,6,0.0 1 1.),-,1 28SEC ORERLASES 08 82 ca OO RSE ORS e169ON 0"8 as NRO on CRE E RRRK a ORR REE ones aoe EAS. SRNR SS aKSar ROR SERENE ERT nse as PIO eee es! 0's SCS NORAD, 20506060116) RE SRE Re ANS.©.* CASE eR RR ROME. $5" a EAS CW Mass 5At 5 0a et COED ake e's 60 S300 aeET :9, CUSUMCSCM RSH. 671 "0717270 10 8 J0RR' S'SSOLD, 0") OLAOR USREL vateCOR PEE CRM M MMS Ye ORAS AN) '*eeCee ieTIT RP CES Cee etsa5 apse cach haha heres nets a Enna : : oes Tt RIT SEDONEETRSEERSISEO SIS 00" NSRP rect ne on ,8G SOD RAR M MN ENN TOMY S90 5 RS RPO VENER PERERA LMR "s RRR RE RRR OSES CDOT -c-o-o-.--c-1-,-010, OS So ERS 5 ORES aie CS 0's ee OE,
SESE SERRE ASSES A IIR Soh oh 8 LOE OA SEL URES RRS OS, 0.0-0,0, 0 EO eC RSIS 0.10 0-18 0 RD OND eR aan ACRE SPIGA SLSR? ¥010100.1,0.--. SO RASC
BANGIN SF a7.Ca"0st RP RRS Ss. eC 2 UES DSaoeORE OSES BAERS STEAL ITE0 CUE7=aaa eraOCUR aoe ES, een x Cofta eeaetARR F888 .0 00 Pat va! Ae ow, ieietecs LARS weetek “yack See ane oe - toIO a bas aPC DEES © MOSCA ICON 29086286 ees aoc RNS
ifeteetatatanate eleones SoaANCES ens oeMRI On R, ERE, SS oc SRS anaes PS | ANS aENCS RISER SR s2etc OEate at . PN ae OURS Oat 2o8s tet fistaca RRaace. RD eee ©. Teele hs EEE CO aes S RORUNRURR EMER tS eR ec poe eee eS RRRtone searsCC "enev Beearrnetes Ree ehers aye Ream cect segs SR CEASE Sh a cee RRR R Ee ce ie Ce OUT. TURE ITI SASS RS SREB sc 2-t7 op 19
BE Roaate SRE REE DREoomasneet EDEL See conocer SRE Crees oTnoche: 1 one 88st SB . Rtatanere enoryt tir RRP RR RRS Sos ERR one RRR SE Spree Cilia aa ESTO TL Rees:RERTEMSEREC : DOORS BERS ETOCS a re. eth Pc RCL RE a 2S Ro CER ee 0200 "0°01 eaSs ee NR RES EST eabes os Re :
BOE ES Se aR Se eS HE! 8.9.0.0. t Re RRM ORME ARES RAMAN RE SOMME APSR SOMRR. 7 C0008 UTE EC aie on state NERIPRRRMSSOTORSIES Too b:0cPeRo ee eee os en CCE C60 ccc cc 828,
Cees AIR IBD tet REM atatetsteAM tet lelaRNRR ean tata Spa OSE SO SOR OTD aa a a am | SOD hoses eter eee an Ri RGD Ah SS a hc SNCS co Os: ES ARR RR ERAS ON RRR TRS naeie lo RE A.a2.SR
ee aaa eS SISPANIORL ELT.” 4°.' 7.7, ".1. 5 A SER OA Ne PUNE Ng 80a Ls A : eee PE CRCRRUEIESCIESESONOT. © = 55-811 4.600247671 76 1 0 OOO EL OSS 9 9 Te ee ROTI
PSM Xe aE MMS ICRRAINS. NSS 510740004. 5 9 A MOMS MM NEENTE DN Hews CCVMe ADORE cane GAARA TEST 8 eS cs a rte6a oe5070 SEO oscrPSR sMieetetaty. SSBSR RRR 5. 2.7.208, 0.118"RRR «aRERMN, 2).Coe eaneSeee IMSS2aRSS fc CHSTeary en UT es”ene Sete i a
Fons aR ERENT total RR SR REDE. Cleese Re tHe acne ce see CET a Reser NIE CL LCN COL a SN? Ste es .
555 ae0 APSR '5". 1 ee SPE IS ERR © MOL DMORS CRNAER OL COR CSE OURO ESLER 802-109-9000 0 2121012 2, 0 DS 7s crc a ocr oe Se RD SREB CCCSA aeSEINE Re eeeTa 0 ss! ee eeeSRNR ee Ot ORE ANESNC COTY LS eeeRRgCE SRPMNNNMIMIN tocscicrtice canton sctinrs + tS SS PS SRS SRE RENEE Cte LE5,AEA NICUose ICRC SC eeRee eerie COLGATE SScr8 COR aaa 2 ke SEER ORME ANIMA. 40.2.9 MR RRM MR RN MMM KEK AB 0 86 se tai sreSse tle RRR Cred elleReAAR es coir ened vce ee cs ToD oT a a RRO TR spreeSRO Geyee Sean ptatatitatetan tote’ RRS 2, 0°80, teeta 0-72" Vintetetereca 37 ucpcatatdeteratetetetetet aieMMMM Sittcanmetnates at RRR RAT. PRBS SATE RIRIRRRSEEERS
PERE RR MERRIE DEER RRR ROR ESCs: RE REP CRRA REMIEDIS ea ONCE Catt teri Rr ettet tt Ce ac aBe co TEE Eu RRR SSR—°-°~ 00 100,000007 99 0 IR ERRRRROEMOS ooo Reece, : : :
SERRE SERRE PoE EE -R r aanRReRRRE " SROOER RRR en :
; SoS SREES: MMPS| RAcoete CRETEreREGIS Sta ct BERR IOP AR ASscfeStstte-c nM crete ettetteae teaieaaietSaBER cis cpebieaeatientcl sc itch EA OPS RRR ats RRR RRR sc s-S hs.ORE cS cc cc i: SMe uC ey: scl SO RSE. SERS EET ST RRM sia tree a oo . ‘ ee: See RSS ee he Ce RI + « BOERS RaaA458 SORES RCE RRR SERRE CERRRETON RE NAAN Bt, SCAR SS «0208-00000 SEND RE sais RRR SR. Sn SERRA SSS ree eta So CEs LO NELTSGN prpusicssieguceieless ELT "RRS ae So pratense . PRE SSS enasiclaceoca) eae SR 00ST crRe Sen coeehclebiperreseg Cee RR rcteAIRC CENSUS SRO A: SRR ROSSI 200SRRR0 cane CTS, , cc cS SENSE “SOMES . e ;
Seelecaly. leleleleceleareece raceeare} ROLLY, 9.0, 4"8/8, serene erties Rae Res wR nahn. #
C
B
REU ENO
SNARE
T
A D DUG n N U G OUD OR SSA SSSUNL S R T n OES OER OURSSTRE CST CSC v v SO Dyv R dMa aop a e eoponnmn n ne n yon n AA nn ny ea en ENTSCRU STANTS SAND e co ecec e a ag hh S oun egyee nenocev a geben Da eeeTS SeWOES y e a e oe LO a e
RR EE EET O T
N
G
C
B
A O
G NO
N
D RR N
OLE RW RN AOR
D B w
R
CON ECE ONE AE TE M LA E
C WO
RM N M NN RCN N
W
R
EEMED B U D OCC ET U T EE UE O OE NER E CETU DOR TE OEE EEE OE CRATE CEREAL ERR ON OPREP BR RRR RRRRR RON RR CEER CURL TEE UG OCR EECEDE R LTR L ERT B ETER CRETE FUG C OT COE CRHROR B NRR OE CA ER AN MEE G N OU m CH D O E L DE EE wOD G UAT AD L OD nn D DUb O STS E E SC E NE T ERE EN N MC NR ES R MN M C RN A EER N RE N RE b hER M DW ES o CDbhb DORE RCEES ERMA 1 MM ERRRROREN EARNER MARA AE S OCUT o wTSdww CTR R CO ORD CbhARCOA CORR Whhh D WD U C R UD ONA SLE A GO RT D U AD C8 A 0262 A ANCA RO R R ERR R R C S U L b CO
C BO U UU
D w DO
RE
DN G O U
EOE EE T
m
DUN
ROKR ARN RADA NR MRA R O R DN ARA NO DB C R RCO OU RORRR R RRMA C A
D
CO
R
REEMR K
AVCRU AGE O
R
AA
C
w
R DMBNRCER DY
DD AOR
OC ROR RR
TL O C UD N VEL
D
T
m
UR D N DD UU
M
T
N
CO Nn O nA hD Ln PEEP EES OEE on nA P n on SEER ESS COS R UMN OU n DSE EULA A SUNS U AG U hA OC OLASO A A N KH D N H NK O RRS SS RR RSDRRR D RRR D hAA b D A G GRELE LOSES m w PTT S M M M M M od ACE N Sno vOST n To CET n ynOT E MRC E PEE oN pTT TE n SUNTAN on SoS SY BRR SRE DRM WNMARR SRS pM p n m TT S g oD U o OUST n n von oU n WEE TELE DR AOOU CNAOoO R RRM RSSS RR P w OSES SEED NG ER GN aa eS ee a RRR RS RS ae BAS ceESE e s e OREN s c sc conve euee g yyg e soaene see n WE N nn u enVLe SESS nD a seme MM M W SRS SSN MSS eC oC SLO SE SE COSC EE SE ECR 8 oSn WR ODOC nR ORR OC p nSa a ca en m ns Sa ee SS Se ARERR EE ORR MERE RE ER RERRERERRERE m eeToe RE H M NTS NREED C O CREE nORCA EN RC NAC MMMM S on nh see wo Dy ng EC ee bo BUTE ES M
M
BRUTE U A U URE UESU TE EEN E OEE U EDk USE D T AE E DOC GRAT WAR DE nn S B CONE ORCS
CEE AN L S C w S W n d ng n y p p n
Th
W URED TE
NO R
DE N
n CUR U
d
ggy
T w w Dn A T ATS Do oT
h h h
N DTT y G n NG n
n
CU ED M A
n C n
RE SESS
C
M
M
M MM M
W
SS RE OR ROR CL RS SAREE SER RN RREMMME REE M M ESSMS MSSLM UN PORES o S oy oo on
COMER CA ED D ET ELEE CEO OR RR R RR ORAL D
ERROR ET y
S SS o S SE g bo ER OREN ToA T L v A
S
M
MH ERNE A
TRE LENE ONE L ES n TRA TS W N RRERMEMER
So
o =
o
n
RD R RRR OO A RC CR C M C AO OC RR KK A RA R AK R RA RY R OR D MMMBR MMRRR D W OE ERS PEL LEER W CESSESOA ESTEE SRS SERENEC ETUDE ES OeaNne ECE OS aa RESALES SS SOO SAS NRRRRRERS 2 ee ee y ee woe eee ee eo mo eDaan a e M
M
M
M
M
W
O
N
SET SENS S
RA UR O
L
M W
ON G
UUB
OD
D
PEALRCE TUR E RUD O AL VR CAETR M D
W
N
w
N N DA D N D A D H CC D RNA M
SST
MA
M
M LDT
PREM Q D N C
N
ADL R EL
A
O C A RA MDGD OOO
TES OS
R CN A NO
SCEU ERE D L
GMO
OR
M
SEMEN SS N NU N
S
M M
M
M MMMM M
M
M
MM
RRA RRR RRR RAD ERR TET RMR
CRN MA AVNNAM AN
ARR
M M M
M
MA DUNE SAAS TS
RRR RROR
RR
R ROR R A
N CN CCRC
N
A NRNK RN AGA N AA MN
NN NNN RR CR M
N CRM MMMM
M DR NM OB NRN RMM
M
H KY AO N DN
N
C URO
w m OD O
C O
G G
N
B
M
A G ON
ON
CW R D O OR
A
N M
U
AC
RM
U
O
PEON C U N
N
RR
M
RN RR AAR A D W RGN R R N M
M NAG C HLANA
D OO
W
N
M
R M R RRR RR
C
A
M
M
U
A O
R
DA A
M
CERRO OREE E CU EN T O
m
T
R
RRR A
O O RO E CE A OEMC NORT
OC OR
R
D G R
M W
N A
GRD NUD
M
R MD M
K M AN CA
R N NAR M
DO
DD
D
L po eRhohS WOCnD o ney O cee aO U
A RRRRRRR M G
MMMMM M N A AAU
R
NU C M
M MM
M
N A
S
N H M
M
M
R
N R
M
MW
AY N NN MMA N AO
EN LA
M
A
M
M
RR
L RE M R
M MMM MMMM M
M MM
K DKVX W MMMM
C
GN
A M OC
D DON
M
MM
MM
O RO
M
R W
CR RRM CM RRO RRC
RR
AR
D
O
D
MN
R RA
M
O OO O
O
CC CLE LAM
R M M M M
G
D
G
D G
M
N W
A
SLE
D
NT OR R A
M
T C
D
L
M
G w
w
TS
D m
G Q RC O R
mDD mD
R
M M
G
D NA D
W W
N
w
MAMAN
M M RMN SN DER RRRMRRR RNS
M
M
R RR R AR RR RRR R M
M MM
CCC RRM
U
NOOM AL
RR RD RNM DM M MB R N AR
A
AR RR RR
OOR M R
MM M MMMM M M
M
MONAN A KO M
RMA RES AN ERRHRRS
R M MR
RR N C M
M NA RR D R M AM RRR D
RR
R CCRC MN R N
M
M
O N A A AA AO N EEC TEE URNS B T SABENA REN RRS R R O AO A AN SRNR
C
RR RRR N RRR R
M
O
O
C
NAAN N
M WE
MW M M R CR R RR RAO MRR A NAR R MM R R RR R RRMACD CK MRM RRM NU RUMR R M N M COO ON R OR GR N URN CMR N URR B R MO R UU R OU C M R R RN R RRA RRR RRCURC UCN O MRM MR AR C RR RAUR RRR RGRMNMB
W
YAD
M
N D
SUwT UN A w PLENE
RR RE RMR RO ER E COET OOT EEC ERR E TO R W N RN E ENN TNE MTOT AN EU M O m WOO RON RO WR T M W N D TET ORE ER RRRNR RRL2ECR RTO ERR a RERON RMaT aNCOO K EY N OOOO RNen C eA pA e Aee ccnena T US SENaNN E C SRO Rw LOTR TES w A RRR REEAER ERE RORR NOTRE g TS DDD SL SEE
SELRCOO O RRR W
D GU G
U T
W
w
EE DEDEDE
M
MC
M
M
SET ET EES U RRR RRSHP RS RR ABAD MERE A SANTA SAREE RAM RAMEN EMR RBBOMERRR RD W RRRS M Dae e SUSS C TES T EEEQ UL T TS SAU aOCR Roa ROA SONS S SPAST ABE WS SSNS SOS REESE aeR *MNQ So n G OU CRN R UCRESS KN w RD CNRMR NRRRM RN C CO MSU MRO RMON NM OM AK RAR MMM RRM MRM O NO UG O mm U W NN NN NK M N O O MU w D D CR LALTeS PURREEEE SD SyDTEES
B
D O M M M M
CER REELS REORSL ED REST RMR RL OTE L E SES DNRC RET E EAEC C DEER RE K TOTS R KN TR AMER R RRS RROCMRRER W
A O R AO NCAR R KR
R
M
MM
M
D
ON RSC M
R D U
N
E
we
| ‘~ |
cut Te WMS .
Gri wood .el rimm’ IZSZENE. Brere x he ppoceacoacas l .2:°1enb 3ro.mLuise asa Pacescenceaes: eran pibrersoamenreas : u itl1 epee ag ee, ve FEEgage peseorestaySATS Dor ae sate Peele aie Merntefedatet tT a : ren es moe ote . MERE O NR Spoaeeaaenan ear seer nn PS
,
ume intetats fo sarees Ios gata’ Saee vy “aatsts onan Can Se tee “ARR egpeegrey rane CRORES ot vehi CEE ATeTe rasa oT
aR SES Cty éTS Eenneniarsearee nen ae : STE as foe Sou ae oe Pearce aseonSoiree ener PRR. ia ,ZIM eae tare So ae Ce gee aa SA ONT U1Se G : er se aa ege vite ate ee thane tts RRS cy SRE xSap re Semmes ae BS pease ooatatete aids P Reena ve oaths via ateEe esate ren Bete cyoC on RRnares Patelstetntece’ mee iss %ee jaeSant nea Bessette catia igre nee SER oe ]’(Sea ) as) =eEE ees es Cae “See DN oe SURO She Honan ARES race es RRS weBees Ste wt “eae Cis ce ae aesRs Ree «sien “pees: aos eae secrrccce asieits tee Racer a orasBe aye are 3seats 2Webco Briers ties ene ee eo EES SRS oe SR i aeree Bee EES rete nats puoeenensan abate Bens fg cris Re aaa Met oe OER vee Bc concen Sognaee we RGSS arn Sai ey sige Aleore ere BSS , Sauvhagpepiaene! Pee. Seca et Ces Oe a we Ese oe 3 SeeRN Lh Ben Bee ie ars Bea eae Sr a i. sites: Pees areas oe sroteerraten CEES care, oR ee ye PRE ne gatos eeseeeneas SEEN SoRess See cgebiabnasieacrn eeecacarete Re ae Riarese eT ore pears a area te atatetet te sepeee "a 970. Seacnononmcnieeees Ll Tao SAE oe Sen's OS. , easeteieteceretes ett RRR SREREDC NS -™ Rees el here Roe eet aan . ERR eee SAO R SA RAE,
eo es BES aaa ee ae as crs ae ae Se ee ee fe: een cores:
ee Con RR:he SEE ES aaaRee ee:cnes SRS os RRR. eer eerie _.hULhU aioe: Soin votganansed HeRov SESS Sa aacovaaie: oR RRDaas as enema “asSame ae BaasOO: a eae Boose. Doeean: meeelellale on Ba ioeRRM RO a :Siete ESAS PEEREA lat a SS: ERS My RE rncaecese7e 28 pviensreareeinereeee Snes Seeeeete Nes 3 SEEN soe ee a een BERS
Senne sere eR Saas.oe SEER SEER: SRey Sete Ra a escORS OR OO | See ese NONSee BeetsBes eSanosnentt Bee SS elt eee oeNSpeneannnn tenn geee RES eae CELE SRR ans Seeareecieen. ReBasia Soremnpente sos Powers: Ber OyoA eee: SE TR SS ROSge Be eS retee ee BS Sie - aah er ee aET SSL IVE a Be aS eSosBe ORR Ree ape ae RRR oSssi: RS pean Seescre
EE htt aoe Ea a ee SEB nee Ra SoS aes. een < SO tee alts os ee Sout eee ieaR aER coe oO 8 ae Ses, me eee See I es. ace SEARS: eee scans ee iS See SRS a eis sae FOR ts arenae eases — ee a . SS
pecatrens aces cers paresapreces fee ae, ea te HSE PORN 8,880 atatetatatatetetets SEER oa Bostnatisetc SANE, | Wi eo! “Bee ae Saas SENS Rewany.-'c!. (ASME 8H BONE ateletrtatetiontet i ernsonrteettey ete te ttt Ot ah tg CXR MAME MN MMM K ON MDS eS OO Seas SO Ooi ite ue oS aa SEDATE T0 L009 3609820, RE ee Ce
SRRXXRNMA RAN RR EA Re! 78a acarelacar acer 4 e-0-8.8 Srervennenenunnenececenne CaS AUEN ARR MRA MRR SRE R ERE MARR RMR ERE REM MEME R RAS RA RAS See NR Re Se oe gS POTS Res ORIEL Us Lee ee De ele tetatele ts ies iret . CERN BAAR CNT EEN CCS CRRA ER ORRR RARER mantic nace tniatetttate rtatriee paapeitinen at. aaDO re rte ITE Nees 02 0 0600 DSRS AREER Ot MICSRRB MRSseaibnrecatatacieaeatataegeptrtmatatotntstrte SE RICH S, 1 1-8. aac aeaarararertosve T=f fo)as SSSR RSDeasarat SPT OS RTanantcg CW PACD SS SOLON SCINinety MSO SCR OCDE ROSS EOS 8-2EEA 8-94-8780
sfabatatatatate:etatetatate et a AORee,RE E00 02s) RRMANERA LODE NA IS NLL aE RTP SSARAM SSSIEARAS SSN SE SDR nt Me TESSTeene caeltes! ee RRR HSN SORE RRR Ee eee neseital stelerecat yenen.ste er aatetanscan aca cefatrtetateaatittaaat scecncal oe er SRL AK PERERA ERR EK UE MENA B AMER ERRES OMAR MRSS RRBaS NthSRS e haseARERR 0770 DOI BRERA te tates
i
RMR RRMROSCOE RM MRR MAR Net enaRRR 0-8 pectavesetatatae esarenerectepnice SENTnti RR CNPC CTR ERERRR EMER UREAtne TORREcutcnt NASER ERASE CREE Eenen RIES SSSto hi SaMOTE aD Eitan reer sceALAR Ito Dot an at . SSE TE eSLORRR CORE HH SNS Heeevemter i GH aR Eiees MESUUR Sanne Gibney eENolathe tient en a NECN MRI SERA, RRR ERROR ERR SERED ECAH ES mn PEASE NA CRRA RN MERE EPMO RRM RR MRM ERAS RMON AN OCIS A OR a ROM eR RK Mere rs Neel feta te ale ete pleats cate
RXMRRNKR RAK RAE RU RATER CRM UR ERK RR RRR eee tan Ee eee he CREE RET FL Oe eves Aaa fe eee CRIA eile state sett reat eseat yt riety aerate steers oy e+ Se eee Nieyrtr isis tesla Tet Dn stent trated
RUAN RRMRRP MEMES seancnerecennnttie SN a RAEN SECEEEEOCEUECET ORERR CTERR ET RRS ECES LES LE RMR Chr iriociagir eneNiereunion oneEEmatinee ceca al nge comer Dela antegde SS NERAM RN EN uneitaeeneter ata cacere cae Ree,ssSALE ae SACO APNE NOR REL EM REMAR SERN ARMA RE oN NTN raya ROE No Se OO RSS eT eee Se eRe cle olay! elelele els laleisiaTe ie lela een
, RUBEN NRE MM NNT RAN esecnelccepace-nenncenenerenaarcernuo SOR eA AR Be arcgraataeatirateratyso aclalgter aren Nn yan Oee PRR a eta react atecaten nhac etary atelpeetetatatet ene eeateca comers eerie toe i” Rap iaieerccretceersre ee’ DO I au ses
: . ee lem eR HOUR S881 ae ioeERNE AURIS RRND RE SORES pen HRSS SIRES R SS REE 009." ele 1s acter Ce tea RRSRM MR RMMR RR tte nese oonsath < PeeORR een cce EURe COC RRR RR SER MRSStoh IR eR RESONESTAT DR ICIS RE SOO SRR HSS eB NS SI aSRCS a ORSROUSE ROM cea SRSRIES es Len atetel Dlecete
SEMEL EL ELI RARER eIE Scere Sch ih Cy Re 1RNAS So RRS HSSRSE ES SS RE Sees : tetgteeaitetenetatece ott ASTRON hates SRC LRSieSE atSL PES RRS UO SRS SRS! SR ROSEMONT Sas -a'otnetonata'eteie tectRon057 PEPERere RANecearsecen A ea eee? Sa DSS HS ONT RSC an SBE aOR SRRRREES TCDS SICKEST COT CCS SSSR +)” 1°0-11. GO * REM BEKR EMRE AN Sata rsa Sate fot earn se. ee ahaa a Ante tee UNS e KR RR ERR e oe Se EG) CED eae abetet ee ete teeta a ete alias sia late ctrlalel ace aleale ly leta ater aay sleet MAEM Rs feel yest eee eeat tenet rtas seta race! cle STROM DISD econ RUM MURSMRMMRMRRM SM cosscasecacveeitscovtetsttttcs nes. eects SRENO th an RICO OCSRORTEORT ISIS SSD ORI DRS SOAS STS SPL A 9 SST SEER RRRERORSRIGRSESDS + 1s 000-0 6 SD
enetereteertetatetatttrerecctecslotshe eee SME RC RN OT ARON ie aa aca craipycae Cea UCM OEE Paasche aaROCN IRD CoS NSIS RES RROD SOROS PSE SRRIROSURRESOSE ROR 0005052012600 00 wane lee le a EL
. SEEM NER R RiMP ORES eR ESO ERSTE PERMMMROCM le6000000 aIte eaeDDS eRe REPRE RPifaercnas RM RTE pKa (eee ALORS RAM Sate Ni at hy att itr aa EER ARERR A ANSE RESET «6-0-0 0.> he CORD R REE REARS SORRRR 28 0008 CCele VET ate : SERRE RMR MEDAN S sae nee maa sale oath Teor rcres BILE DNRoh LcSERENE Tene Sti teney eastern RE cassette etARERR. reo RRR Wad aeoleae oesated eraceitaistacesteneeatsty tannte ate see mag ROR ane sos CSRSRRS a RE COR GSES ass." ER RRR ay 8 leCe ed ENR ARRAY ER RRERR RSIS A CERO Ace OSs acFFE choseateentanoe era ekia naraale Ree wT IPE PSTD SCE NE ICSSENSST RCS 8's 6WLR 0-22-11."os RIN MRR RISER? 200 00 1 0 86 ele Falter) ne leeipa Dales EEE EECCA PPAREN ILE COLE U RIEe PLETE SSE OehaeLAE TE 200 (TESTER eS CE NS CATES SORE RROR Dit ‘ _ .Bpeepemmmnemnaa mee mr Shs OLD OC OCG 7 6sEE Sa ay.: +RET «RICE blaesDtaDUons aDatstena cate RR ERAS BEERS ec RAMS SRR SS aM Ses Esai ty AeA est tre chen eieninCOUELASD cans ocr EONAR A ANOS. 8 SRS eS cea aCTE ELE Rope coe a0! 110 OS RRERERRRM Sone net felons
EERE IE UENCHS ae aL CERCE ERLE SER MO eoreerenrec CER CREEDnnn Ses Seana ceneaecenees SEE SUERTE OEEeo SSE 29 aaRE: . ae SSRI SRR DMSO cateneREN he ReSa nekegeriaes f ca eToO REDE EECRERRR ROR RG2ate SEN RR NARS N ER ER RRK MRE ME RE SRA Ese SSihaee nen Oeste aes a RO ne Dae ae a Ee EER RESON SRE OH hn 0-0-0. 0 + OREO De? 0081060800001. 08 20 a PUN ates SONA AMES SEEN LR SRE ott Ch nee a Ra Seu ae a Re RAMEE MARRS DON o's RRR ETTEe eater te tstetet oteleRRR Te teeTE rete Le eae ELE ENOL ETrere EERE CEL OO RTT ERROR REMORSE RTRICE EMMS rte‘afeieit scpene cncReaeaueRKE vues Le OO RR STDy SS
ee
ESOC U OOOO E ODE CG SOIREE SUR NeeSORE, Sees EE EOEERASER ne a te ERR SSSR. ge OEMS RSL ROR EER ER RRNA 80 s-0-0 0 GRRE ECEU4 CORER EEE fae Pe wee atyate earl es . SAR RRC aN A SE SAPS ENAAEM am nTav naar lala ooos tNEROA Stns RSLS RESIS UOORS SONS SIRREI =ee0 ee nnee SUMNER 00 siatos 8OS aed aEAN Oe th RR REM RENT AAaen MMAR HMR NS AHO cere ne STROOD FURR O SCRA LER IOLEC °C la eae REeehesain RAR CMS ROC MSR 2-019 8 CTR. 6.) ARR RR RR A : Beene nee ee eeeSands e eect ORR ILISTCE BOR EEEOSES RSOR OEE Es FATES Teer tORR Ma Be eeS's en ee eee Ae MEL itt SCL MODIS oR RCA RISR ee Cte REPOeee ReRO RUM RER EM EN RRR BRET TERRI NUROOT OTE RD.Soars RS ee SER ROSE SOROS *,¢-51's '-'.°-!-2.".*. 1 :tay EO REMAN RMR ER REN MMO MRRR ERR A ERR AERA REECR PERE Sn vsi RR OER RRS SR een CE ERE SOE BEAD MOSER OEM ot tt Egan ttt 1- URNA MAR RRS Spiga LSD OaP= ‘ ns Pe eee ! See ee te RRMeter RRR NER Cen rtn Pee cnet) ae FisCEC SOROSTasCA, 5.) ea NO SRO RES REDE SCL O RR ORRARA MEER MD ceBEER estcvcscrcecttce-culieicyiec rcgletgee araRR She en poy 8ans On ine FOE eleSESE Sele Cen earn ele neeMN ree we oP RET rhc ETC RRR ERE ER HEE READ EE ERNE RRR REED Beat italeteteSe carer eee assert etat eosEL aneee oe late SorenSls RN NNtlatetetatstacateeert SH RMN RAM os HSN NMBias NYYtera SS 6anim OCOD Oe DEREERRREEER eR DREOCOERRIEEES, SateAR 8tyEAL * TC EEDCEE EESen REESE ne SOE ee ARR Ta aratetebgtetats latetatel wean a OS ee ne eee en ee ee nn RRASE SRM .: RR RAU RNAP A RRR SR RRR ARE SAREtaRARER EREfeta SR Ne SIRER CnNe Oe MOR CC. CP MET ILO UROMAR preg) Oe YT Ol ON CREESaaS: SA LOR Oe EEAFee EERee CECE CREP UR HARRRENRRERRNPEREMER ERNESE eit re csne hee:Des EEN ENE MRESRS REM RUSE NMR R SMD SON A 5 skce OSaERE har eC OTT YS «oe IE AS SER ERE RNASE REAR SSR OA RARER SS.aSyvee ER ERE ; PeeRERREMR ae a eR RRA OSURRR ARNE RRR ROSS eaeshake COICO CCRC ACO ER EeSOREN TO evealte cele ee ee a: cos ee oe RENAN RR RMR RASA CRE ROO CAS sh RE Tal EAL ac LATE Leas Dae nae ea RRC Reema ee ELE EER TOR eee e KERR ES MARNE RR ER ARR ERNE 7-0. TERRE AE RRR ERE? tater eas shoe tone :
RRA ENTREE RAE M MMM RN Ee eR NN eee aE rene ae 7 EEE ERRORS Sata an nee EER ELON MC EEE EMER RN REUSE MEME REE RE ? ed DOM NN ARREARS OC ee BB Se soft’ fatetr! RRR A CieEaS SIOCae emREE ORSRRR Ce nS LARK BCs Sones ReROKY ni:=Sh rs) RO eaten
BESS SiN See SIRENS AUS ONTO Se Se ie ae SERRE DE ERAN RE RRR EE SRS MARS ARENA CERES SS RSME RSS Aerie ernie aah ne rn eaRC tes Be. eeree ORY RRC eestectce hs aoe ne SRR RER REEMA E EMRE OEM RMMEN ELEN ou CK KY NMS SKM COMMER REAR MERA RMS ORK SK SRR RN MR MS RICCI en’ sna ohare 'sfotere eens sts ata cacacatees Oe no recuanecaeatit nie’ Catia’ s' =e annette as "1 CRN SOMO a a ane TEAS RRS iin eae Be See eS a etatettersiitetatetscaatriotosstatatetsta tatatatetatsteteeatatrtt tattotene ROR08) ORBR ORaa TaaCecn CREME ERS BREE tee RE OC vee” POR et oeinSCRE OS reer) ROR aay SARE Reeotetctetatat ES See eS RN MN CK SOtetatetetetatat erento 5S NR NMteMIC erste reI avin RRR ORES MNS sie: rT TORR 8 Ra 882-8
ea a ee Cs SRAREEER Chicieinaaieuay per neeye eeanaenenceieaererhech Pee ee DORR RCO RR ERR Rs * SORE praas A RRR RR Bai Se RESON SRS ROR Se a aces pe ticnschcauiuentatia teen uhateia teen ee on RRScaURS nh IRR RR SRR EE ae TEREEE SSOS RRIaSe cnasntesontneiiese nea eeRS SO RE RS ghee Set NeeFEES Se SRSSSS REE SPS WTS ee LESSENS PASE SES SSS SSS reba SS NEneers SS SSReee RNR ARERR SS OUR: 0 CR RIONRRSE NC 8t SRos RREI, IO en secacacasericarererere Goer 8k eS TE TEDS SUERTE TERREN WRX RS eo RR SSCS RN RRND ARE RARE RRR ST Rear aire state MNT Rt ot hes RRR RRR CRE CORR YOY Mee aR SRS st AN a Aare ate. ro. ene SE De Oe eraeacatat RENE? ‘avatecarers eneTolaletecaleTelelacaTacaraTelecaceca le ely ala 7e eta’ eve aia a 6070 787A ey g"a'e7e a’p tte 8 0-8-8 seh ety & rendiatelasateaty‘atetets sak Rene. res AM OE Ce: a RRIF Anta stats’ tite
SCO NM EL NSE SER OB OM NI Dt Wl Ce caracecececatpcesececerecy tae Nr Re I es 't"0"s “CM RN le 8 a RRR ICN. Ne ae Rees
SEAN SNEV NAAT UN LESS Vc rete STAC CITA ata ate abate et mama eteemehatatatatate mb acacotetacasisaticoccsstatatessaticaterstseetansesatanatatnecstatararacrcamtatentststveameacoeatensecthnety RRMA N RRS A SDSS 30s SE oS SOREN. Sk EINER DARREN ERTS
Sa PI PP I OO a Eee Pee Spats Ses atte 50025 055.5. SRS eee DRDO ae a aan a ROSA Oana AS aaa note arena ana nn aan bY othe bn 4 318 OE NE RET RENEE LP Od DP a ee se es COPRCE ROSE RR ee ee) 6 ane a ese a ne ECE MERE EERE EC ee ee one oe ES A EE ES LESSEE SESE ENTERS EET ERRORS SEER CRED raced
SSEEEER EEE SEES cea oS REO Bh SRR RRR REE ARE MRE RR ERERE SRAMERA RRA E REESE REMERON Cerin nearer ice CCAR RES PRICES RRR ca at clase ae eR SSSA RENE? SS! t-S5 0. 58'2 8) SK: SRN RS RSS SRNR NMR MAR ERE REE MEMES REREREREEER ARERR EKER RE NMAC E fei e i ssess rey teeta st 2 re OPT TAMAR atatat ot ott RSLS RMP RE te EER Mg
Ieelalelacalerel ele ale aaa ee Cate a eee Rp eae enacts SINS oI STNUT MRR TIT nD Ne CARER REEE RUS MERE NSRRRASCE DREN RN 0 A SRO ERR ISIS Cot ES Wa PDO REGRET Gao
eR NT RE RIN Ite SL PRRSERSIS 2, 98 5, 90,60, 0! 2, RS RRR RR AN SE MEMS S EEN ARMM EEN MARNE RNS SIONS RSS Oe Se AERA RAE AM HIS ARMA RBR ERE ENN CRESS RAREREBAER EE RR SERS REAM R MERE ETRY Ss
PP ie MOO Ye" SE Oe I 8 Ke Pilipinas annie coenenieeiensceene er eer ere eee CAREER RRR IS Malelslere’elaceleletatets ec atalatatetatete ete a lt Telarc ete apy eieaa sae s 26s eae a Ra SRRDE Naa ae cAce Cae ar yO WAT a ELAA ORIEL STET NDE erg ALACUCHTASGSUENTOERLOTATATOSOCEET SUPE at ahaa atatetat sti ataratabacatatatececacacalstatatatatatelesatatehs hy tat tat atatatetatatacateiststetetate® AE, aM RT STATAT Se AEA aa A RRR J Ve RX WOR OOOO Wn)
PCL art tei Sn Nae oh See a eae eee eee RR eS REM RS NCNM MER SKS CS ORNS MR YN OD Nee kw" e r< A RSET TEL Ta aa aaa ae a Oe a aCe) . Rc OaTCC aCeSAL ReaDA.REN Soa aOR iO steaieSea ae hata St SMa DEMEIODE » | WORD = SrETx ee 07503 ws. ea RRaaa RSE ° 9-3TSO 0 tener So cleceseere ET 1RTS UISTLSaES Tee Og a oeCRUST aplelte SISO It uebtntat fs SE aT Se RESET SOS POTTER EOOL DESO CF BE PRTED 7a OO OE ODOC SRE Gd PL* OEE 0 A OOS NahNSIS eae a RAST eaten arena t ataSSRN hts cnSENTENCE ita tat RSM EARS IE RIREN | SDA tee SDT8aAeon aaa aateen aENN nae OER CaanOT TanSDONCN SEE aE Sea'sSaeE tanaeer a Ran Ona ESTEteROD ISIS G ORES wT EIN et DDN SIE cs Used os betes peleds co ACUCAT ORAL UDOT ee ona cc eae cecabe re Secorecanletavetesetetecetececaretet caretenefenelet eas ca tenes ccarenereletetetgcteter cr tetetit tatatetitelee fat talateestetreefetetatatetet Staaf 0 aaa REE 25002-0500 ON RO Ra RRM teres sronccoletsestee rehire OL DUE NU GT ALLEGE EUS MEET GL NLU ROE ODDREEL DUES EEC DEDL Gn ny cee signe anne at ws rm ta veDEPT peels SCIENCE aoe Ros ie GD or ane Vee ere wa NT ayy Se bslsgte “"IEICE ieee ea VRCA *" eepeetate at atatatyhatatstatetetateletatstebatatetgteteteteletetetette ataliaptebete atte EOD gt pty tatet reat tt cee GENTE ATEn=ASPR LATIRAMEN RATES aye ea ee, > Tae 3aecole’ oa %9 Selatan oo» RR aa syahoea lo ealSOS e le EE ela OO ls «i+ RA a ca ce AI SE i a OO CRS OD OO Sean DESEO OLDE GD. DUNES IEMEODRRDEOODIDCHINL”, a Sf SSO wD Da SSSR 6S Tn aot’RSMMC 60.2GRU OSE A AlesTe "17s Sath ce lale re oels aa ea SA"e's ESCO ee eenSCO ee nee en ee een ee ee cence een eee eet nl eRSEES ns ene OSD ee netsINCS eee et anel arate tata ret erat nee erateDDC aera Reet act kre aed e ted Ree ERE RTE d Bd HAE ECE Re "5-5 Beene2koe SEPT R apte (ee bia tata aIS aRSD o>" 67 41h REO 3 CORPn DIER 8 aeeBG TD aaa a aTeTR eae” 6056) 4-9,0 616. 6.9.6.0 RINTMRR 68 EA IA ee ale wala ata leg lelalere els alaTrae) oleae k ale470 ale [ele alaleleleleletele olalalalalelalelaleslelelelp ale ele ODED atelelelelelete a CE ele lelelalplalalale elalelelete ng eee ene eet SCID III aDER 0” =o”. OI Oa Oanee POPC OSPR ISIR aDee OOnee LALOR rT alerSaat SERPS CaP STi aan MOGs be Si anna aS at eat SPAT Oe hte SPORE GOalt EID MME A ss '8 94's RS Tele OO SE I OMDla Ra 2a" Taefy eatslate y tyreladelelelalcalals ge tatetestetet | tataatatarete Tr ae ee ala al a eet Seen eee ee rE ee aid ee aeeDCIS eneraeieee neDO te ee eee RURDCIDIRIGIN ee ee eee ee ee eee ee eeEDcece eine eeeaInee eeeIOenn ecIGeen eee ean PalSSE ee ale rae ener t esSPE 0 MIRE 6.32575" ske aT ocelot saleaarorarar eld rteMRR er erd cT«CRM hark ast helTIC WMATA 6G"e+ TAT alele’ clelel a lelal ala: by aleete oletiteretanats lelelel Lalande] leTehalelalel lee eae Datel Papas SC SPLID ESA OED nOOL EE OEE STE ERLE SOS DIT ESDLALICD ALES DEESOSERSEDSIMUSGINT> "."" --.".__".” SA USS SR CDL ES LSE SRS ES SNR RR DSSS SESS SCS SOS ESCAPES SR SE DOSES HOSS NOSES SC SESS SESE RE MS SESRSOMEN MRM OMEN RSERICHE + + css. 1 1 sO RR RO Re RC REN TEINS ORR Ra ere Cra r Sat he er NCS weer iat at oe ea rear Sree LE
Peete a eer nEE Ore aS SCRE aE rE ee a GE TEER ROS N.S SO Oe OU RE BBO Oe COO REE Be Be BORE DOOC RECOS OC S O O s s9 es t OA tse Se Tee ate ee Tele ate tee Eee eh teeta te area tate eee tel SC Se SOO SCE PIRURESEEREURENSERRMEREEE (. "09.8" 570-0 ERC ROG OE DOS SRE OO DE SE SOD DB BRC o >) 306” 9 3 a eles eae lat Delete tel aD SEEGER > > | >< sO 2 OO OO OE OO OO aE I SnD aO aE OLDEN 10 Osea NRGRIG GEL PRP LORTGD MIG SRIRDRIROGD. © SPROUL MEO i Dt. *..”.".".°.7 1.70". "2" «eee ae een at a a aC aoe ht ne eae ene ae oe ai ee aS Cae She Rene SORT SCS SE SC RCC RERERERO RDO a... ”.”."."."s) v 2 Cn ce a oe eee ne ee cre wales sSiSte Senn TOSS ee an ISSSt SSR SSEERRERSERISERERSE™™” "-” -_. »: SOD DMIEICUESOOEUENETES. 1OSEIC ESE ORGS ESCO ROESE NEST ST OL OE MOH SEES SE SSESEEE ICRSE SSCS Oo RESCH SUE SBS SOOLOE DEO SCSI MICOS EC SE OER ODS LC COCR DOES I RM AERIS SOIR NCR MOG DON > ---*_+"< Su the ROSS SROES EIR; *~"7,SOW ".”,*,"”", antRPETY An he the nin heh ht oo crc heat aeESCO i tt SeaSPIO aD OO Reae SORES alee ECSRK ee See SEE See Oe Ne Nee eae ae ee. ss de RNR RRR MRR 3's OR
DD Te ee : . ra ISP OESCESC SEIS." SOIREE SINE ESTIGE ST SEIS PRES NRSTSESESEEE SESE TE ISDST SES SESE SESDSER, SEETRSEO SESS ESOS DOSE SOE SE SOBEM SE ROSE ORSERC SER OU EMEECN MOH SURESEIN. , CRN ROR MME #70515 +1 1+6750))_ 0,110 RR aR Ce Mee CaN eae i ek ce oe ARR aa SEK Ne aaa RRR Ree hE ee RE Me aR ORI, 3-2
Tete eee ee ee ea ane Te tat nan ta RE ORES Rea MNS «Cen ERR ERE EN RSS MERE SERRE RENEE ER RNS SEEN ECM ERAS EES SEEM REM NEE MAE RAR ARR SRK MREBN MOUS w — CC RC CO O O O Nm MN
A
R R M
MMM S M O S MDPM MG RG OO
M
W
S
M
MM M M M ERENT REDD MM MN R mm M MM S
M
M M M MM MM M MM M CCS C OCG SEDER DEO COC OO SS DUNFO C DEOL C S BR RCC CB n D ME O G G OCD D GBERT CONDTLD C SEO O BOO B SG ACON CG PSC HCOnBC DC 2C DD O PO nOOCEC ROG POTTER NENT NETSC»STN M R ENTODN oo o
W
OL N
L
E
ER ERA RAKES AE ARS RE
L A OP h S n TCARERECT EYEECOL ORh US TUTTE CU D CD ON C
O
A
MM
M
ORA
M
R
yS m
hm
m
MM M
TT ETT
7P C
M
o
o
C
oee
MM
M SM
M
N
W
M
S
2o
M N DO
8 Dok
DC
C
R
O
oT
RORO N R
OR O N R
h
OG
M
A
AA N C
N
CORE ET C NC CREE
OT EE RG RE m
M
m
MT
RTG mM H
w
O
M
M M MM U AL
94
SL 2 O OC E S O A AR nT b v oD T 7 o
m
D OA N A
O REE A R RCUE EEE
m
A R
w
C C CN O
OO OO
O
B ATA T D
@
a G a eRRwa aA R
OO
M
D
ee
B OC O B OM W CM BD T 98 8 O O
O C RC O N
b OO EOE T e n e EGToae O WDE We EO
w
E CE
oT
C
SS R C A CC O R C C O CEE ON O Oe OSCON 08OLR oe WOMEN eeOC SeOD ee SR ee ee
RA
W
CO
S Gd
M M
M S P D M n MPC S * MSS S a PEe RRNA h O SnD P SE Cy wo ne os PO OC MRR a aO 8N aM dh h nnEa OG “ ea” ae aa a a oa aeERT a a CN e onea
BG A O O
== R
y
COC C O OO O OO
M
n g n 6d n n R OC O R n 4 D
O
R oCNBNC B h
W
5 6 CE
A B N OR
M
ROR ELST PRE S SDO BL LAR EPS OS 1S h OG BD OB O n O R O N D O O OC O DORON OR C RO OC wo PURSE n SOOT So S o O n h PRE h
T
n CO HOON O vDB K D d nn P n Sn
W SR
m
D CN
MO COR R BO B B
M
M M
M M M MM M yM *DaMReM CR SNE ee CM ee COM MB ey MG eR A 8a Oa yO 9 eOMMs Mma BW eae a Oa OG pMMOW ea OCW eae GaRM e a ee ome a eca ee a sD Te s ee aS a A MRO M D M M R DRO O m O O M MMM A R w w
M M R
D
M
O
R L LL OEE T S m N A A RN RE OE N EE C O S R SMSC ODE ETE HEM TEE MLWTeCDeOW OP EOEecMaCa EOC NS STRS BACON RETE SR aO eaE Te aSa N TEA eS aSATS c eee eeeDESERT aR TART a aWHE Ta OE 708NE 5 Anh ae Seana ee eee 6 ee”
Sco
o
M
NCon O
G
O
W
O R
MM M M
h Tp nNE AUD n+ +Onk + 6 RR W M
M
w
M
SRR M
M
o h n O PT OL S SE
ORO U
M
S
MM EM TE MM
REN
N O
OO
OTR E AT EM A
CD B
M
RN B G M R O B AA O ORD D R RGN O C mC O DO A DA C OOC OC D O O CO O OC O NOR R R OD ROC O D O M RR DM G OG OCC CO C HO D R GR OD CR
M
O
w
N
M D B UDED DD O AD U
M
R N O O
Cw
w R
M WM
TD
m AUR
wHL C
R
O ADRD DU B voM
M M ECU CME N MN ERR N w A E G TBWCCS O NMRRR DN RMR UR
S
R CA CG HMD VD O D
CR C
A
C
M B R DB C NR ACE
C CC D LO AC EET CO N CHRONO M O DOR E N CL O BTL O N NR R MM C BLEDRBTR U RG W R CR RN N XO BU RERREE C RD NREREN C C DD OR A A R N RENRR T RCAC COREA w C OR O A ELE CU N LE GLACEDL LO LURL UM N CUD ETZ BCH D M D MMMMM NC eR OR Se eC PUCC a nan eT epO aLe en eee ee w w ONG Ne PGES T aan ken a kee Sa een a e e e E B C EBA S BEE OCnga A SEa ae EE oo E Reenen SS W eeennee ER T ROO DR OTN M MMMM M MM
— we S ePAo ekO we vee e ae C ae Mee P e a LOLw D C a T na De Do e O T SO OOOOCC CCE a ec a ce aaa a aS ESD 2OSOR A O NOD O DO O D N N O OA
mD O
K NM Mw R OO N M R MM R M NCH R N MM N W AK RRR RRB C O RN M ORC OR D R MN MA ARN M R M ND ROR CR M R M M M C N NOR MO OU CA D RON O O R MR D
W W R R R AB MM mREM ER MRAM w COCR R D NMMR N D RD GT R N R MRE RM RRR MA MMAR RM MMA T
T O
DCOR U C R ROR RMRMMMUDR R ARRN RRR R N RR MR ARR R R AG R N RRA CNND M M RA HC
Bee 1 OW5 Oa PARP SRR RN AMB ARNO MRT n e on NAMB oon D SE DEED EE oD AA O MNO H HH O U M
W MMR w =D NR AAA MAT
COM C O
C RR R RD RC RR C CR WHOC
C
T
TO w AE S
RM OD VURRN AA
T MBP w ES WT RRR OE O RO E
NNN OMM ©A D R MMMMR RRN OO
ER
A RD
W MW MN AA M MOS NK OARROA R AMM R CA RR MA R"_< CESS SCO OE Dn nN DES Rance era8, eet ee907000 rR RRR RE#Sop cescarecrstarteaenecheeermentrenne TRIOS ALOR OS OO RR RS
REDEELAT ILS S Tv 1 AUS eS a ee Nate eo St Star VRB Aree osa a a8 RE ERS SR No RY ROHR eR RABI MURR RR MMR Ce cesaneanie scot sc cnc elscechi eceieretete drecenecatecaes . SED EE ne ne beeag SEER Spemcahh aes sate nrar RSLS ROEM ARIotetatvtarensseteer IBN I ACI RO aC tseteh PRS SES a Raa UerictsRae Ure Cutts Deeanita NR NRE Net OnE Ns as SRR AesRCO e0) 1A epea RN aoeaS scars Wratacoreracetatenerdeatacetate’s cers etetcton ete Lae ae nee ed Nd
WE SUL A ES Ser ee Bie cccisamnptennineren ate agi co nc a aR eRe TIL ati CORRE RRR IS CARRE A Te. Re RSE ae ete Ea eR te UMN Se S RE sees ee rect enrisctcic enlace ry ee er RR A Ree essa ietencneuse SRR ttc oR eee ACCRA RRR KH NER PRICE ERR RISC NTs AS. SRR RR RRS RI
protean i Lie “Ce tehtesecess RADIAT ernest RRRRR creer PEehonet EEEvO Nett ERASNe2 CONT RARER OTS, «10 SR aR RRS Re SEES IN DORA EERE SERSSANA tases stRain. SORES San corset scanscaren it: RR moe RINSE rca" ERROR sereERE MORAREER Nes seinsREE sercascttntetiese nt eceestieeacnelaecent
SUS oh ot ER eae SORE EARE ROLE er ot Sa nh a RRR san aiinanutaceatetes
TERI TD Se Dele lal salina sateen rag eens tact roareres afe Lola te BRON ata sas eratecrs caretSPORE naTNTe Sree one cs CRM NN ACOH 8 SRASYS RE SEEN CORR RR RE IN ON OCR IATAence e” ov orecec ere elecelececaralecelecelececvie eletetetaretere SULTS 0 DSTLD SSR Spmmmmerran SIN RPMS Oa8,-0.9, s ENN RCN SOARES eeCNN hace eects acencearereeee
: REDE UD EDTLIT I SSSR EEE age RNP SSR SCR eeey geen ee ese RUMEN es 8c8ses ahs eae a REE MR ERR Once SRR RMR RRECNCN Maen ee esi cece sce irececareretenecsteese Annis:
MII UOT : CULDILT EIPARKIN ie eee Gh SNR N apace nerd EER RS Cot Se eaten ERRarcane RARE CAN RATA RARER RRB ER RAAB RRR Reese heer cceieenchieceenieestrnnerietanetes . RANE ea ENED ERS AR ASee MNSERS Ors Eee rsethrPee GR taORR RD RRNM Ween? 2251-12 RR matical RMU tstaSeterniecreecn steacase /ccersretnea he iace aR RS EERE NER feteR fslelelelte teeta saetetoos senate eee, ST Stee SE TTS ONE RAWS OePARR RRS RRR Setetatat RRA OORT NIN soos snenecenecerefecelecetatetet etcheesete caetet erie tat Nee
REESE EUR ESE SES Serio Su Seer Sn een oeer ea AOR oR ERIE SOR 00 007071 ORD RRO Te ae ceco cor acadaca ea fatetevafaraietnt concn en RA Re i RR Ri
DIOS SS Basher Satara rae RRR RRR tbe cetera enter tntitin tite thelr.ASHLEE hla RRR82S AOA ee ee ed SAL SL a nsTET ae eager etatettcetatetate see FAO aOR Re eaneee teneretacarecacrsorarn ete ate Rta APACE ORSa Se
DDEOT SEL ONDE Bosarnsnonmentann oss aac aecet canta ran SCR RR RRR RS eeentae sco neean tener reed Taesac areca STARE ASE SHEE OSL CERIN ES a6 8 Sa BSED Sa BB Ste a
. AT Debt Rpensee enMMee ERS occ. RRR RRBs ss CCR RES RS RSS BOSSot S ISU IE nateBADE oe eg tasehen eR Me AR LER MMMSIEN rrerrert 1.97 c2ane oC RR RMR 8a. 9,001 he RE ERete ERAReames OA AS LOR TRBEM RR RAR DIL oene a DUST SUL REESE Ca SEE OR eSrescore at scent RRR nant tel eee sroeiese eects ig oateeccl geben et DALLAS AOU Gnae eee estes ots ce ORS SE NCE os Rear eseratectcasncesestces tae ERROR RN Lotsa ecanes tra" S 8 C Oe eR MMERRDER Rare ot avereare,evacecotetetete CONC ePetscetsce eltrtetetstcttatettstyttecatatytetatctytats state
TITIES To OS IANhist AARP RSet TUG SUA etait SSR Sa sss scee RRORMERRONS es scecteeesacecrappmEN ete tcoricsesmortenssctstentsacteeerane ete te tu ennnen eae aa TET TET IDG) Sirtriptactatecete eteacest restate aaa asserts SINC ORS ee cessssecenecec CLE eR AEE NR RRR Roos sk SRR RMR REE RR ERR EES eTere RRR EAE Counce RT DEERE UEP, RRL ORE Co elcec noe Meer cseecanaen ace e OOO SORT SSR ARR RP BREN ER RRR RRR ERE RS SReseGesrarcnctseatctstonseanstetansbet ate te CICATACHLACHUALALUeeCAALSOE see a " ietearaenaeneenan eel icrcrspans mane NISSAN DE See Macnco sereOa nla Nea SMASenin, RROs SER RENREN SRE RENN BREMEN PAREN eS OE RRR ARE BOER ERE RRR RARERR RRR ERO Mee REEDS OA SSR EN ORAS RADNOR CS!ects 1809 tot tgt RI aence testes: tt OREO RAIN CRO ERR MRO RARER RE RMR ERMR ERNIE
ESSE AEST hy RRR cts ce RS arch neemetns essai tnn essen a SRR SARS REDE RRA ERE RE RE REE RNR
Bet icTERCERA aREREMMRRSR SSS SSCS SC eo 9c tes RRR a Son RRR BURA ME SO ORSON Rae eect esc EN Ne MURR octets fetal tereeentecteeant tater tetas eneibaeaisvaniteeanteranienneaomaneneneenen Seat SERRE SSE Se URE MRD T EN Soto. Yolo EOE ft 1. 2 RE AMT ter TENA Rate te! coe a anetacatentaaeettet rhatataratetatetanstastaretanatetatatatansta’ ORR S AR AROR EE RK RSE RN RSE RRS
Se See EMSS ASMA ARORA SEIS N NG! Se Sct-totcto ts! s/statscrnate a RRND Sta MRR eras cas cctses iihuhanhenaanengenennny oR SERRA PERRET RRR RRR RRR ER : . oR ea EERE SIS U TSS NMI Nec n ns tes. 0) ose MMR SKMtntc RREMP EKER BERENS RA ORE RS SERRE ARREARS STD LTRRR ae Tea eae ascetic ae eelseaee ae I eee Re Cae ease etc eae ne RE MESONS ass eeRES CORR NN NC NS eS SRREWER RRS RIRSC MRS SS RRR NC : TAR TET a icitatatatatatatetatetatetetetetotetatet tate et a Oe Oa SaaS Ont ta!S)sataratsearchatstet stmt NBSP Senta tel nat ntat tAAsaN Atari tate t sts totes tafe SabsRetahy ot MNES laine cee tel otarne screens ereceserectaeteceanaraeaettet inane ineroneoee eens eRe EMORY RERER REMMI STs RNS SMM ARN ee fare 5 ena eeeSartore eR A Nee cere cts DNR ar arenas iecstetytbi accra srteearnpth NANO ERI en trteetcnregentele ie ete9 belsntenaehtenteretenetetie ae SSAA RANA SRI EAAII rsa We Pe 9-1 Sra HIRI heestate N RSC RENT SRS HO A eR SL SS aes SS SL et peti ep CRI RESnSinen Stile SOR EONS tsa cotet tsetse teretangcteny ces Reena Siberian sn setescetatstutacstecetscececreerraue POR RR RRR RENTON RM Ne OST ot SADIE UWE MIME Cas aca eta tabettatebetetatatetataberetatetatetpen abet taty tatscee ttatatetatet teen a ety eet BBE ate ESR sakahects toto t toel tate AS en Se eS Se ES NE STS RRM RURRE aacaca eT CAST ANRRR RSE RI oo oce terns aren pre ORR RD ear Nees RRR ERENCE ARR SNntentatesctorelater a RE SR SESE SE RE lene RRR AA KANNAN SD IORBN NAN CON SIR fet con ne ep eae SHOR eeeeeroyssssein CRIES 2 EPR E ERENT RRR ERY SOREL ORO AT SS SORE E EERE SR ARERR OR REESE RR MUSE SESE SR . TEES SDC TAL TS Lae a aaa acacel atacand ne oe ot seBein Raa Rat cota tatetatet ee UAE SBP NEN ccaisness siceeasiseaneanasetTeORMNNMRCRES recess ecesectccsecesesesese erent meen aces eIageah Oc RERLOSMSe Se LeDeteceseene ESIIIICIIS SSS) SSE See ee acesecace aceroraresiatates A ND aepeortcncermematcacaceten sshesieaneeh tessa tiaae AMMO Ner ein oreietereenicatite tenetsasieaAce ttetteetitetetstage set datigteteatstoeegeeee
De EROS HEME AD DARIO REAR At? 12900 oc tat oh fob MBAS SSS RM MER SAE D OE SL ORES EERE SRR ASRS ER REE RRC
DRoli bitsBy Pesan SOLAR NR ss meostaocerecace sce =eceice nenceo nceghie aceiere meveter etalercesstatatetetecgitaeetatene . TARE DCC eee iho Se A anteccna *. 0.SN 8.1Sercceeeneetns OK Re AR EMRE BIBates REN Baeann tenet tetSnes ee teSRORR tlct ts oot tL NEN SND So NsReese he Saint SOEice Neertby eS tStle STS CS aE StS OR EE SENN SR Brat NT rd
REDRESS Noh ts SNOT ot Se eR NNR a a RRA SBR SORAU Ce Ce
SEL LONLD to Soest Sauer sietienen ROT SER ERR crete aes SCORER Soahenghemniatnge ince iaeeenhahinmnaseinaniacienrenmneneenenrerens
TSIEN CIS DEEL CI SSSR CE acetate secareeteserertehen erat te sit SR ESN ste nsetelo mane crce ete ceetelotabeteg tena etesetey mettiegimten satan tenet ieetstalel gnenebeanenebeneenees SEQIDE IO eS cae ROR RRR Oto satate ton 3 eecsetigisecectetsas Case RE RNR coer e Sibeernee reTo sa) cee WORN e nooo Lara e EES eee TG Sn OTN Lo ed STPLRL elo ene le OLA Dera ecesp rele Delerereratetetetptaleteletenerarerety Ie Tee SE NUESTROS ARRRSST SSS RSSsstotccracpeasecaciee out Raescaterece as a - 5 hetets cata a PRET TT ora sheRRM ORE ERR Te EDEL RNR ERNE NESE0e RRRES EERE SEE NEN Ed Se ae REC BD)PANIES) mae einsSree teatetatetstatae OMT aCa te eR carne Socecece CMR MACE. eee RE ReSTI eS MSOC I SESE ER SaMSE pa eRe CRCER IC 0-3. areca scecatncetete cease Oe NERS EMRE =, 5970ne4 RRR DEIRSAS Io 12.0 0s ok a neOet te SESS SDSS REISE BES OOO atSES SS SttattNenSstd5 , PRCA RSH SMORBESRSTR TSraniva acne ER teste 'nie IOLA RMS TM RID Crh ines shata Ss ee Reta nsec AOR acessCara scecacicerececerececacese cece ence eceSPTAC eT FLCoUca Se MSMTOSOTACALUTOTAULCACMrcAhecatecococeretatOCetetecets DEE TES eso eoROSA cara»BD capecececeraceseeeoncecncert cocere a 4%a"ene are Nec leetacecse RARE CORIO cere rennet teeter ALC ane ee EEE TLRS SEEPS TENE EL Ee erage ee ea eee ae Pea SpeITa EEN ESERIES OSS SOL NARI tSKS SRST. PORNECM ER eaten aSNe nah ee a NR as te SO RRRURES creo areca eco Ac Ure SRR LSLAL SUA LS STRLD DOTaTACASUcaTa ererarelarteatatetetatytrtatecetereatataty AE BRERREAEREREMMERENESESSRS cep7-1SRN SS7Aceca N'saanee 0c CPR ARERR RRR teers 9LEICo's RNR RRR RRR ATR oon Ss -. 1 s Hare e e ara a ee eeER OS ORRE ETC er aN tae Se TAU DUDS 0 Telel Sibert ted fetetatetelatlatatatetnes ee spiatareionmesenecateeeeenisrarceets OER SONS satis rarate eisrarocr esti ANNs SER EERE ORR ERE RRR REE RSL ERS REE RS TI
nO sepei Sesee rcasaat as RON RRR praca SC aRa Taaa SMR BeetBERR SERNERR R ERAN MME NEE RARER sg [cra ne La.seg NSeve SN eR SENS Sea Sa OTR SESE EER a NR 6S RRR S NTs CR eeREAR ceRRS RaRREN Re RRS RRORERREREN Bae IT RRRST aR RR EONSNR in RR IEEE OS DU Os SR Res tNRRC LR SE SNE SRSA RAST MEMS NSO aad
. TAIN tee ok Sc RR eae Sirens erences eee seer ennarenn RRR Re nn een eee ec cccee ccna c cen crncc eee ere a Denaneltts saseieariceeenteaeat
SEU EN SR ECES ESSE ieeceeee BO SERRE a Peseta raneatiesier nar ase Rane Sane .
Pa ane TERCERA rs RR
EEEDOL fc bo DEST LIS UT) GUS SoS RRR NS oss oot RAR Nan aecsreyss tans tpns terete en tlct Wah MOMS RMON PCO DORACELOLeLeLeCALECALATACeTOSOTaT lay eCaTe (UTSUICECHCACALSIICACNCALLCOTACELROALESeCDTeSPeeRGeaReReRnetepeceaeree gee
Ag hoTHERTGAIIO DU DET ODE Sees Se ipbsscerecereren RRR RNtees SNM MHA S £01018 FP NNER REET vecoreens SASSERCESS A BieCERT TEARRN EARNS RM aARMS ROEM SSR NE Deo oe UTIL Se SRENV PERM Cite itotes Foon ate tatr5 eR ROO ER RIEnefeo Ee a ean SE LOS Re SP at GE I EE REL etn SO ed . SESED CUD CES STL CES CY Fev UTC ERR eS ctcc zee Sate Soe bat anche naan Aca: t ORR RIS SIREN Dace eee ODI Lere ere Le STALE DTA ace ATMLO TAT OSNEOTMLerarel eLccaTeTatecacetecececetateretytatatetatetetetetetatesetetatee . EME ur OU DELS Ee CECE ree San MNN crane cess recscacn'a CRO RRR SS CCGA SCH ISCOSRECESDTOCOTe CU ecHe A SRR REI MOAIOOCES ieee ce SSTNCS LEDS TT Uare SETH eSatetet state! el etace tate states otal As ty Bethea! tLe Cee eG ECAT ACERS
DNS le eee at Rome rene DERM APs conese telat naneinatsreatresteen es SEN SRO cts oe RRR RR RRR SRR EARNED RR RI II TY . DRESSES DSTO Rae Sree taetoeoERN ere cht Susan ect RAND aS. tenemos nse tle tN TOU AIWrM Ug actofag acacectat digas vastad toasted taueteteaterstneesseaegeeetege
SIND AAD SUL Pott ititatatatate! Rae Kase eaitase wide EE NaS at eA ae EEOC 8s 195210058500, CS RS SS ss aR aOR Sea eae EERE RERRRE DERE RES Soe OCA Utena ek SE erect RRR RAE toisiiek dE Oa aE RRS SOR SOREN NSE RO RRR RN
; PRC NERLRRCR EMERathe SS OR CCR as re reece Sareeate RRataERRORS OSS OLR EREARS RRR ‘ Eel DU GOLLY CORSchcarireatate a oteca eas oh ee OR OO RR RRRRRR enn ee eaeRRS Ee aSRe aaa ee Sees REERR RENROR Ea EMBER RRM hore t ec e K RAS Win ere es s-c'sve"g-3/ We Biter casececs rote fege net tetas SEE SRS Ce s\ 7 SERRE RRR eR RMR OMEER ERR ERS Re RRM EMO RN RA NECN KH Kl net : CISILEE SEAS scape kas ace's Fe RSS CORN RMRRR NMR ONCE Icer Prec tcec Tec EAT ScOL RARE DIONORMORIOD Sern: o19 eA Are Ine CEE aT aS TUoe cca ater terete tslaeate et acatetata ate og t ota tetatedatety AcE SSAC PCEAC AS RNCAS PSE AOPL EGR
TOE DEED SE PUSS, IE Sse Need RRR aR Sata” Ce SPREE NN aesercthkcocacessCECECe“OTETecR CR STUOCRMCNGMESYTAS¢(71c4" 0001 0CAICATA‘AIGC TU LETTALALASHIOTN WACSCACACArArareLeceTACACNTACaratesecer ae ptetatnt teats Patch tatateteeenatatgtcte
POU DULLER SOS) Seo eeeaoneae eee RRR RR ROO Soe ence ater eT DN eater eats eteSaCDlaticese since sees atcte phctac ates ir ater esicatacecptat st tntates statatecat ciety tt AA HERA MASA ACOA AACE Ace BLB ACOA ESTAR SLOSS SES SLIESA. PN ORE Sees Caan tan atone ROMAS118 ICM- hoot gopcasesscasnialsrecesct astsbenes ct ene SeReRe ERE MRO RRRRER REAL ESRaENE RIKER EK ERM ERK MORSE R EREMMS EMER RNR ARCON T ETSNN STITT Depites oDEI APL lisse SORE RDS B7-0-1 OAS: ! ROE AUREL 2hai oS 2onSe SDE BIDSDR SS ae a SL SaMER Sas SSIS NN ENRRR Nw a : DUH SSNCIEEN RN SSSISN S(OUN NUERR ERIN 2 soSEALE sor8 tea Pan tyes sot Het RE REID LIEcaBs CSE RRR RR at eCa SON SSI NM ES ian a CR ROT
ee eee eee eee ee eee ee ee RR Se tcsstsastatsact-a SPARED Deo aR ana nea MDD ODN er seocstatetenstesacarsisbanareretONNMGALTSpepteteageneghatgtecceacscinscanctacgecacecatacetaneteceensarreasaacstocstotatecstatetets oeoteHatStOATRGAGECHORM AINA ILOLIIO LMCI ee
Rie ea aD PEMA MAR RE DERE ANS Ok ARNO NAR RHE et 7311709, t0nes Teena ee seoh ten teta SEL TMUR RRR NICRR RAMEN MRK ARS RRO R RIS BRR ERR ON OR NE eS RN ON eae a en a ag
BERG SEL LS TELLS CCE te hicrcehnsannnncunacnnnjeisaaywananee tne nesenne eee nee ean iieaeaaaRN
Soiree aed SORE BED 6" Or ASR ARUN AREAL Cs pes0rectrre See PSR aracasececpeaceseenecegusect eCEOeTMIaESPCATACESCANOTDETOS ACOs -C04 Or cLec05 070. ACOA RIALATMrAra ec ATeL CaSWTaTeRSere eATUSOCHTTEIECADNeetptatetacetecatettetatatatatetatgtatatat ate
a ee Ee EELS E*, NSC RSENS K NEMSRE ERRRRR RAY.RIN 7 2.f Sst’ 2 ttt Se SSE DRE SRNR MRNAS RNott RRA ANE scenes Nee ORRstot ESN REEDS RES ES ENR RRR SERREER SER MAMARee SSCA RSETRI MS Nett SERENA RONAN Rigas eR MERE ThenaCRRR RRR Neo etaCeS ttenSRR curate one Sener ROCCO ARERR ee ata eR eR SEES ni OU ODDS Ei aetna acavalatptarscars’e"et1e3t ORR RRR SICA RMR RMU esac elete car aetna eentatotctetctanets stat hfasstatgtyey tent t tc t a NH HEPA Et Ee ARLE ALLEGE ACEO N ILLES 00e PEGS Sa EU EE TORE
TON RTT aR onan adtalat cnaennkeneeenneenrgnerntny cre, meagre ceeceencunrreperete cnr setguages hEA HPlo HD tea tahatety ITN S eeetan LehRGR Lat nly OCS aTalele [atos scale ale NSN) Ta Sepa Seatac at te aad tat ete cove et coat AICO BAIAteeta RL aL Se Te errscan arececreavetane Lee ENR RNS ESE RNS RNS RCS ROR OP HN SNtt Ue OMEN CRC EE Ey BESS Ege esa cose aeegs ; cecdtcnssiachsoasase! tate aa, coatievigsetecasqeacasiconntstetaegeaebepoatatrtatpegl tseCS RRR CnFer SOMBRE Roe ececaseces oe htereniergttiet@eriers freeMSS titieM iinetRepttitenteng Maley erage ate ee PEO rin tito aren Ctr pon SMART Ress iro y sea eh etatst Pe “1" ss SRC RR MOSES ECR E EEE EREDAR RAEN ROR ARORA ERMA RE RARER MORN Man R A =
ee enccc renee een ace nc ncn nn renee ee eee tet tren Sve het SSE RB SO aM SCAMMERS neater sCECHTTELS ac ararersCALeOCOCMLaMASOeNSeCOTStECECOCHTMTOSOeLACeSececteacers CW TV ecsrarati alecete careers, ahely aietetara seetetetytotvantetettatetytatstetabeayR RH ACRBCP aly
Syn Teed Cae eae eee SERRE RRR AR RNS Sect fa! cto! SAS ARN ete tel eet ae retateteertensranntactctstennist hat eetetsegatstetsmsteeteereriettee, NOSE SUSIE WOES NII N MN Ms Ot NM NC OCR ARNEL eRe RR ER GENRES IAEA E SH 20.1.1 SAA ER NAMM Dota! tc - ceneteeinenectcetrieeseon CaS RE ROSAS OMe SS aE PRENERNEREMER RENE RRR RR EEN RMR ENR MN NH ak iN oo
TEee teeaN ONCRE ETE MMEC SREY ELE Sa RO MMU Co ecacert“h-pecscereyacareritestaacaaseateacapereatittetatcte canter mtecneenennstinestemanspersstiestaomeatatytateta RRRPIRI RES ccts seSTM RTIce NOT Ratatat fo "aos statctat sts ts stot OR RRR ISR eed SINC ectateST SO RUE at SELASSIE Snasnotcnayesentceeceeesthy GO Nd BCeeSo DDE nS, TUDE Ene ete tp ata SE snareoeie -ecncRK erateees eles oC Ca CR IIRC oearecienssterpracecetacetateMEReTstaceentatetstetstarstetetgten cress toretotrtetats otetetet AA AAAGD Aaa E 4a aa aa eel elecNT sae PERCE EP ERE EE SUS Dn on In DD Te RRS 2 Aeroe teas core tarat sts WS SSNS PNR MR MOASEREENR CRS ara fare cue tvoa0c0° 47814 8c 879, SoM NISBCATSCeSeraLecesenececerelarelace corer! TALIA SCALA TO eC NTU ETM Le RLS ACATE ATA ACMTICOL CaLeceacacececeatetotetatatet ghareteteteratetae
SAAS cee oe So Ten ES Ta ata rR cArEcecaPat eto SORROW sebelah tata atataestoee a RRR RRS AC. 8ct Ay sotns AS ACECE ASA AMORCEELOLOCUO Ae Otectetez erty seid trttugrengateteny thenelereterrapeiet eenneneceeteenancannthientntirt nig DRIER GLEE Go 0 TCC BI Ce a Be I es iateareegeaeer SSSR RMIT ee ncaceSecreciatatatatatarateWMngscantatatstetatetatiteneeatatptatatecstetecaitatetstatecyt Sane FRE A MN ATATaL AOL ALe a7 ela Tacare ere ece cas ealela elec eCecaleCecelecereiacacae ARNE ERR Ree PR MEMRNSR ERROR R009, 1 Cn A SSR UBS EIT tet ai rer rcats teased arehh eR REE RRR Pa SK XK RMMNM SNS OREM RRR EMRE NNER EER MEM MERE SNR ER REAR SRR Rew nk A ni LID RIED DU aD De SSIES Dee aaaorn eaten oT RRA cael ANCL SARE RR ERR RMERERBRRS Select ti cceisiien rete Sie ht EIEN OSES NCS Wt RS SPST We eat SK SCION saleGS wee oat .TLD TESTIS ESSE eR CRRA IRR RAE o et RRR aelvsecatetececaceom Raat taracasetenatatetatabatatetnce etn sitetetiaccichietiin: rcrtecter eerecgtctshits tetNOSE otat BAe IAASiar HALE 0 ee ACOA ATRLEL ALAR Lt SSeS cece gett tS ICICI
deacon en ence enn ence enn RRMRRRRA seater gaat OAS MMR DNS 5 te-see sscacenactceseace Men eicasesecacnceceecseesacesenesicreetecs:riatenecesecenescesmurscrsaracasaras sarecataceeatetrsnstreeceseieesstanereeptacensnseaecepnets
PEE ONE lee Se cree alae atetarel ete Teale a Seater Siberarefatecsterateteenterate renege eh atrnsathsts ORR st OSE RIOR OO Re RR SO ae ke ee ND IN.
Se RSIS St CECE n= RK OTT Me ccasecentanta echSe orate SACI E AAaa ERearn ROEeR Saree RRR RESeeRRR NE RN RE SE INTCN ICRCCR miterKiKi aratedSs Mec OCC ee vinOS oatSIS enlaleleleleleletele ale ae santas eneeet eoae decane ORCTR On sty astERE Se RO MMS ee RSS RMS
Pen in er 8 os To ec ttre eee SS OS A eR ARN RW SEEM RAR 13000 CRS RRMA RRR NERS RE OER RE ERS RRR RENE R ASA RE RRA ERR R RUMEN
RR RemeeRerera Ren SOR EOS ROMA ier netic eminence menue antnuannnnrnietentenrmernerenses Sialetele tele otelet es 2 ATE Taree ceo eR NOR ACS SiR I SP Racal ote! Poss Sar Ns ati RS ERBL EMS at eee er eee rea Eee mace eadG Teenage a eee rene ahar aren icatatatetetreabeantettetatesstebatataty TORCRO REDE ce Fa LANCIA TECS eS sie resutata rear oteteneaipeneneTots eat ee RP RRR REeDaRi et tat stehs Sate oR I sctetenetcenectenctateteteteocscteketstetetetetenetectetatetctotototcbetetebobebebebeactensheocnsassemsorneteacteerennseeastentananncs
CAT ee To Dee SI ee ela cele eS setneeneeee NERA ot tatst RRA Serhan SOE Cet 212 ORDO COR DOSE OOOO aC EE ER OR ORR Te IC TT
CUEROL ET Che oo CIC STATATINITE RSIS SESE AUS e RRR ace aaah ea Seeopnaeeen ORR RN ER RAE MRR RRR RR REMARK REO RR ied
ek pe ee RMU R EDR S Aas." ACRE ANS SA toa SER ROOMS Sata = Soceiacreken LURK R ERROR ER STORE SEER S SUSE RENRES RENEE ES ERR ER RER RAR RARER RMR SREY
SANS aoe a EONS 3's 9-0. WS SSMS Ce 0 2 SSRN RENNES Oceeni are Te etcacae seecnecate aaa ears eras 11's Oe CR RAT LN Oe ER ERIC REDE STE Noid EEEREEIIEON OS TLDS CEEEEEEC RR Roh nineties acre ceacntcctann inane een aa ERE AORN ANH 0.9. ¢ 6 MCRD MMERBNCMIRM S6.96_0 0 0 SMW MMMMDER D0 oe r 0 ee a aS slate tele etaes rire (te ot sloth ee ee a ae coc inate.
Br SSSI ESSN CECE SRR SEE SUSE, ORI OC OS RE aR BECO SRT ee «RMSE eon. e ooo ORR a en eee eee Sates atts rar tc ccc ace a ea EAR arr REC ee tae ne En EEaS Rane ose eee REREER DRONE!” .-.” . PREMERA ea." ae ee COR Set Ce Se BRE OC SUE OO aie lalate lela ele lel ete eee ete ete eta BSI LT EIT DER ie eS Se ES SRO RE EONS 5 5 «oo co esos sel ceercceere red [SSIES Sen at Dcrana aL vnCIE IES EICHEC IESE RSE SCROCRESE USES RENMEIOND.. SURMISED OC. «it a eS ee. 28.0000 00. oe Tee AC a aia ters Socata
x eee CE eta EEE ata RAGS ele ee DLO een pace le gly ie sieCTSTOTSTOTSE ae) lela a 'sle aes -'07 ee ic ee wietetete eles ctgtetetatetetntetetets aoe epee teatRRRRESD aterat Sie elalece TAT eRe OTE TATECD STA gra ea! BEL TID I Lele TDRepee ES DEES SCDITSNST CUZrah LSTALAL els) 9A 9227s Lo a aa ei oS DO Boere NCEE ENCE 82D ASEAN A TELA 98898 RTS
SERRA RAeaES ORAS ee ve-0-1-0.0-0-".| ASE acannon caer? a 2 a a a, a ah ee ET 10 eS eae
aeRO RST0807008 ASE Wa 0-385 08 PSE 0 RSE 1.79 RRR RIA ERI00wa "1-9-5wae 2ELSEE CReC |4 REE RRRRRNA ASF 8.8.0.7 06 TF 8 5 i0-6” SE CSTD. +e RE RSD ESR aL MOLIRE? © OX 5 S000 SOaR SCSCSI NC EDSON De eT veh each ae g SRRODBTD A Eocenecsceccc nec cee nce nhao ta RI Se RNIN SONICS enone siscrane e ECA RRR Oe RI EERE 822.9. 20 PPE eR Oa ea * SEDER netsh ots0.7.8. 88.7 Se PaLIoaReR SR SPRES NRE ESS SSIES 5 5 oe eae UEC Lee Eee ne Atateca tetas ely ree rta ata ee «8 Rene nn wlalaleys Clee ele ase ae! ss Re aR Dee RRR recent LIL a, IN ee acc aEE ca EEE Rae RRR ESAS SOs SSore=ttCciresisiastcicscicrsiccascrckeiceericelet foreTL eaeTO a a ees |BRS REREERRRRB EGIL LASS. SiaORR EnCana SS MDE REEIMERIEEC Mates ocrare tence 058.1202 SAO 8oten focSION oreo Sees TN TE CUT IEE CUE SSS DRESSES cv asescetanaseccsoniss SRO ccceccticces LLNEDO) 01017 IOCeeDS eeCUTER eee REESE DCEES pretest te otto EPEM Le Na ee ' CES SSS ae a TASaelec LOSES SSS SES one eee nN CATE Se MCELAIRT ee aerHebe vcarerretcetselelstntetats Rita a a aL RRRRRIES 8 NORRIE 8° CORRS oes copra rir alee a ST COTE et SET66 St Oe 0 OS ccsrecetsrarereceteretasere
UBBRRRRE tii aeSRG: SRG: Ratatat ty to Soto eee eeoC eee oc a RRR scone recececal SCL cE «SRSA RRee oce ane aceneca
see 3 aati ha a "RES Satara : nna c a ata SORES . + a OO RCSvot 2 ns .'ae - . aera rat INEM EN YA esER vos . Senn anna -.
a octane SERRE. * x MBSEMIEN. © * MM MMMR RW ise 920011808 25. Telete tatoo ete a totter a a ae eee reretarare atecaatere
SHBB AMA ar tl ! oeTe ERR SE TEROESEION, < C EREREUEION «.EMMIS OBRARESREESRESCR 582 2 Te 2 aon oa ea a kee aT ee EOCENE ae a hoe nS EDIMIEMRY "ireteneoteee toes > “TORMMR eraselca cAI IRIAN RRROOSSESSDSERED.“ 23-0 c occa Too rc cSovac RRR. 0 So 8050255
oo ets EE Re RRM Ie A RT TR — ee ci Up a.e, CASAL SSP P LAE ALS, CR RR, -
SONOS NSLS Nt Si OOOO RII IEICE OCONEE OCI SOS R CECE NEE fatale eNetatctaltet inn fatelatete i ween: UNOS SACRA ORSON SSL NRE RN SERRA RRR RN RAE Or atece eerste ern YREROC RRO CR DOO SEAN ROR eaten eae RR enue fth : DSRS NSN RSs 5a aaR EERMN ERRSSA RS MEMERT RR TS SC Ae wn Sneha CR rhRRR ne sapere SIS RRR eaeEdie on fe ete an Cobdh : Bee a yo nn, ear Sete RRNA TWN 5 nis SOSA ROEM ale ote aA Mw a0 NaH a)ra Ceca aca, scocate Sco ERNE EO RRR. RNP NTS SRM IE aot PCE piaant :RIPMEER Ml AEA RON BGR a Telstar SSAC NES S978 Wao Aes OVA ER REEL ELAR RR ORE Tele ele lele ata lets siatete tate eee a LEany PES ONDes ls ie eancataleretatebeliatatennty : Sane PCO Ss LEE S07 aaORME ea” REESE IONS AESREDD STAD aREA lelelatelelayeleesaateta"a yee seek eee URE, pee ) reACen Tacreninetanateen eset oe tentatct SaaS Setanta anne Sateen -ly.napa “- :-ve 0we lecistesetetatel: vies : TRS actaa5 ate too gear teats eak Ceata NES m Sree RRR eR SSaReeseeasas eeeLecale sienna aan anne ienoe .ne . . ES To ‘alg ee :ey ate tgtatntetatn etesyategaee EE OHO | te dF PN te esate >+ssasetatetaraleca wae ia at Nene RETR AR rant ee re OSER SAREE RE RES eT SE :ET :eacan vtat. fits woes fevoy Oa ROMER aren 2 CAIN IN RRR CORES ES Iiba RARER RARE EMR RRM REID | RR eceeteecole alee alee MEMS ER enn ERY AKon SSma SS Xie SEAMS MURDERER DS Hire ase SCRA rence e neo een SEAS2k SEL OS: Pereira aerace ytetate eget ao L ae aarea .Nas soe. :- OSA H EATERS Ol eee RIECK e WCNe AKSCRAPE ASC SERMON RnR ESIR Re ane Ree sehen me naerrtrmiitrtsntiestisnead
BeReo peneoN EELe anere veeLate : pels. ee WANES ae COOTER SEES es Scans atetanatat rete eee CaiREECE Ae NER : eySie . 1HATHA ONe. cmemmewtiatagthenge coor cats SSSR oe “ COARSE es SU etreprone tat ERAS nam
SECON ce ea vere tNea an Treo COSRRNOERIRTRSE LSTA oe SR nag, itaatnte Re ann aren Are! AAESSRE SERRE, A. ERCP Oe nae2. .LISI . est ' ee . .ecu . CLE . : esac se lete lara a Aes. Proneeanntnt Se tebts , cores eesaebtis SMeS a eC Ae s, ca: a7,actctcnrecermnceret -.PEDO A) 9.8.08, 9 0.09.9, 90,9 8eee 08,8, i ‘i!SUE Deentree NO SSa BR n eesalvo eeoe .- :. :: Ne vote Sea Rae elates otiels phy 7USED igbisteaaie Seen SFP E AREER ETRE EMRE SID ' teNate ::.nos .en . REE :Mek :oy Light REESE Pee ER EMERMREMERS Riayat Ca SNe PURER SRN IECR LS Re FN SEIS SIREN An alee AA RS SieIE : oeC1DL ce ODDO TEE ee ESR SSeeees ROR Reansaeaes
SC ns BO por von ae SIA AURA! 6 ERAN OC CCE TT tO aS RR i ie 2 8 SEE ET SEARS RSE
Dee iocscacecatscereraceca starsat crater ear aterecet ete : ne, PEED I ce SN SES SRR RAE R RRR 1 UNNEREER! : SUTURES SS ite RS I RSE RRR IRE 6 ARERR a8 IIR SERN OSES i SPIE ISIE RCE Ae oe OE ee SCREEN a a SOR AOR SOS RS ar BR : WV EEEBERE le ee nrenrert BSicecececececniccaelecarstare terete ate ern stece a atrtihet hts ot tt cc ac aR S258 8.2 tec EE
Dea aA SURAT OCU SRO ITO SHOT TATAEALETIT SVSOS - ‘ :aeSSSR 8 EASTER RAMEE RRR SEARS! shige TINS 2 RS RE R800 SRR a ene Te a:rae ate ai SePE eeAR ‘“ers utaaa hole hs RASC PRISE: asepa ASN EMSRS, : ARTIS roeee yee RSE Sa a 2Tee RRR So SDT via00 sois CELE >eaeCee SEER RAEI yee - 1S SRR RES NSal SR MO a2 22 RSae050 C0} * PRA Ree O DRS Seer citiee eae : a en veve aanREEMA eehetattel te SARS BD a ‘ ep tk hate PEEoD MPIEMRE “oa'cna"a'e'a7a"w'a7e’averevereceTeTeTeTeTehi serenaG's tytatet 902 test ec ERS, 2. a70"0"e"8°0.s*arece ee RNS
Beene eer+aco cca! SEES RESINS RMERER ERR REM EIT:SEN TESEREREEE OG) UU SUEU CODES SERRE tan tae SA Ra SHPIDSRERS aos'oescalacisace-e'e sc0ERROR RS asa 1 RRR : “ nyUenebernsncrnenberrre . CUT ARSISHEIDS Se OR PCO TR s RESETS SEES 20-00 SORE EMRE 0's toate roca nece icy ener eect teeta rott1Sea tat tet tentSER 082, a Rc RRR 2-0-0 FA 0A0 Ct ACS . Ret O ERE LEE AEE ENS CEE CEH ' ae . MEP P-2-00-0.0.0 0 .rEI ra viarr ert RaaSe enue et tt TCU ce pesoreca, LIT pao Ret ae ECR ceo ocacor a ecco RIeee sae ei2nae eRe NCCE eeeoleretrrpcetaerstacatetetatate Seaeither :atERNE : ee aot “DEAE RRR RESTRICT: . ene oe Tee anne nnn ee eee eee nee eee eeO02 oC aER DMB ee Me scorecereceretecete arbSERRE yee ERR, SE eeee enCas aleette ree OR a5RRS ae 7SERRA Vr co ee ReecaetacaceceTeacacate ier 2622220 Css a ott Sa eS BS CONS C ee EES ae cecatetet carpets a ate eee : ER : : aeCT une ORRRAPR ROMERO ARERR RARE EERIE 8:eeRR * RRR ERS: mtSs EELS sca RRR Cee ‘ERE RRM CORES KRISS SRN ET rete Tear asTE aeTeh LOADS ESSERE OeOARS CORI ee ec9F ahoccecscececececicec: oc R22 ECL oR RRS ES RS a ne2 saad Bra cetnre ata ncecaTAeiaceteracaterace’eteratererrcate'stehatetatatytabatetatghste ‘ BE Tells 210099958 RCRA ROE carne ft nnn tC COOOL C96 antec sot eA Oarates ‘oTalaTs AACR OLYDALY Ss ena pTaele leer wrens ste gle aera a yrera lst gtrer o 7 .ot . . :Bex) CaO WOR COUN es Pee neAY ene=|Cam omy eosBREEN REISE nn nnn nn enone” ARRecocacececseiet 3-1"ocgcetetacecaecafoty
CERRO OC eae ROR DNTP oT Bt SRE Oe Be SP SE ESE TEN Be ENE NOT fee ee tt ee es me OT ES RII SIN ETT ER” : RR He tee” 6 § I CEE Mn | See ee) Raabe weed
ee eee CME EE UO REE CHEE COUN One . . 7: as ERRAEMMCA on 905ttMMMM “hs 0ee"eLee ua.ms 0 0.90.0 1 GRAAF” ORC 866 974s 00 8a OR RReee eee ae eet a eee h Fatt SAUL IBSOOO 88EEE M868 0,89Wit 88,8 020DR OOS 87 UES| Oe eeevos ere > ~sieserreeeetaeeeie TO ae Wis) (MEMO eR ss foo016.00 eae SOR oleae ca : > Do,9: OS mh SUCHE SUES SL 1 OTLICE ISSR cece SU ecSCATECCAS ST Geta ci ScSRC PORE RREE RIESE TSTahe ESR REOe Be oreE ececereceentcaca acacacelycernee rr enna tececnenneeaeeneer popearmeariegerscnecsrtete” Oboe to Bt! : WEE So DDE) Geno(000 to OEE SE ETO aRees oe
Saatsleca_eceieleleia’e eae I NE aag alates a -taleA,S,9,8.9°9.
‘ae °F Core fly yy .ees see HOIST hrs - : ar th uit : Ae t A sel sad|a4Re wa Thee tess ec eeuepes Ticelery gD :aire aE? RR OEE ets ws . .yet . :Ce +aaDeane siisies tieIPDS SA olsfe ete Slee elypeels Beeline ovea tee Deel ra. ;eae .ue aan ete otsalae we aalee ten bo leerefWe tesas fees i egald
Be baer Cola :ries . hoes tse oune War : 1S «Se SA Tales aa Sonn ale ietetatetetaic 2alyla EEleet EEaleMacnee. PP. OaaeCete . are .ale pee “ et . . 7 eleeal ate els oe an) ' Wate ee +. ve .ee CTaylatel etalala Salata slaty Setaetre a eats:betta gles se (eta els ay eeCOREE ee Pee ase Voce a ees te ete 5de ; .TeEt . ate PINE a esnCnnnenS--! . Ua UIlelASD alae SOOT oe
Bo ESE ny Saree ene es means eS ee legis [EEO es acne eka tnciein « : oa Pete DRAIN Or NDOT rhe rt 1 nr ne ee Gren ee AONE C OS RESETS ERASER RRR RK RTECS: Benne nen eee ee Cn CEP A ene Lae LE CoRCE ra an obtneh ni cben oiled eninge Gila MP Ug rs Toa) TOSI ons Peerage tang cogent Dis eho tc ORME DOM IP Eo oT NEM TPE ae SCOR RWS Si Snr eC Ce TREES * RD AE a noes nea a nn rare, SISTSRSE SE ot SeOR Scho naDeSSCEIESSSOESEEESILS HOES STL OI SCSGOS ICIS DCX 3 GOSS SOR ORL SSIS ADESSO SEN EISONN DS ISOS DNS SS ES ER Be cc re ne uae eet ng ol CE EE VU ue CON Rr CEU EN nS Alcea peerennaceme comseeion cate ais a RAINE CE URR EC SIE CLES U ne Linens nen capretenos ievatpsratamigantnnnennont PaaS aR OLOCOC OCLC:
eaters rete eter eran a nial seer aah nal ohel a grater ametye eee aa ree nTal grantee Ferran a a wg and Ae aaa aa T ea STATS EEN ATATE lg QUA RTA INSPIRE OURS R ARTEL a ST PLALETNLA ata ge ee aaa MANTUA ea an ea NA TOA CAN ATACA ACP UAOSCEUMENT AAA PRAEGER ACSA eel etna sen TGt tet SSA ER ela le ate ae ATE EE Aetna ne E NTE
een AA SPSS 9 AT SEL ETECT ENCUENTRA Soe aad eae Date tees SoD Deo U aC Tate SALADS ae nace Dal ea ete ds [alae laa ate aloe te Leo ATOM OCR MLB N tee tt CGA PLE Et FAS PAG SBS PSTN ine Le ATA DATA ee TR ee arte haat tat atte retel seat ns Mala ptt tet Sp ah ata letaerlatelefatatesefatetate gists eheelelesh lilatarehes cyleale le wien ecmae a Seale coer ately tao atet ee areca el on ere ale lara, 9] e Tele Tabatha eleven edelea els ahaa) Ca soe ale ee a aaa alata 9a aA ae ae 0006 CAEP ASS AsA ys yrit toe ae aes eases a ase alee ial al ales alge ieee Tella ytiaat tel latent oo eleletetety
a CALERA a a aEL RESON LE CE UTEaTEES TRAE ADDED 20D at cS Rawnt826282850282 628 eee ele ee age ae Be elect Se alee alela alates cece Lata elaCP eeeLTO Tee TS ea aEIS elena a aDe at alaCaDelay eaeSTE ae CDT a Ts, DOMES, ale DDEDAD TOUS(Soe ani ces ahaTe OTaDIT IanO ho a RMR esas, eta calele eles aD rina alan ae lalate ateselse tel lal atasala eea ED eae aR a tea ATTN NETRA Oe gta aaa TTT NG Matyas ately yaa te eT Te ESRCnC SE RTaC ni CORESIESE EIT LEW SACOC SC CR REECE MICO CSU SE EE St DALES RRNC SLOSS O00 SEER SUSU EE EILEEN OC SOE SOUR SENSE DECOR MIC DESO OCMC MAL ACA MWR. OL ves eT 8170 a ee ae aaa ae et 4 Te POt at cr ci a cre ce cc DUDES SE
Boe UTADA OST SU a TE RS ns Cee ae esate eT eal SR NDAD EG DUST SST EMD De aaa ela Tele eee Taos 2 ea a0 oe a eee ea RM BMRB Cc 2.#09.428°0°3 8 Teles eel le ls eee ela ye al esi ae Uo lalallala aay eins
erateea atateted EMEA gt teTe tetatet Ttateara Teteals a aD ae pg eeTeale gel etatats ete leat a a eee aa alae eT a yaaa as ee alee ss oe: eBe 8 ee De ee lee Dd Cl 8 eis6SOUND leaeideleelel fale ad ate eta Sb atanye eaee aeSTEER lel lalateele a yeAe pele el Teste Catalase eleled e ee oye alee ale ee ta Ta Teaay Leta a eae as rant aeeaa MMMM ge a ataRB a aaoa a i alcrTeel et ieee RMR ove eeeiennees ee eS SES
a argc ytetatet ete ele Late yg eee 7 I gates Nove ree ataty an Talete ele ete eee re ea at etet yee ee wae ee TL ne CUTS ei are pra 0830 6 ea RR a Se ae a PR ROEMEN a "a"s "272 oc ee eee ely wee Lo) a ma PhS ae ital
Hien ie COR AUD REE LOSS 0s ten (ia LENS UE LESS En Ds S UES DSO) BIT SDTS Wags bb ales Unset ta Chk ORS REE EEN a aaa ee a aR RER IS. ccerecee ce Saunt tren hs bo shel bbiet ov ys HO IO URENDS ST DR, DEDUDI EENats GEOe OMDB E Ln SULT EPUB UEcies EDU DISSE ODD END el SI)else categy AIlal NeTeIOOn anenaSTIS [1 bode iil 00eo a i6ce oe eee cecal ot eaeLeace ele lee eins STALL Tens ae eleleaels gaa hein eeSeng nies clslelel el Tate 2 Thon AAAS SE RRR co"RRS o ee ane aCeete celeCe DUIS eaate a I ede teatslaldeOita nice WIRE RE ts CRE ES Sate Tet te a LUN nee San E Sea IS EE CALLER NOSE aS aT SESE EEE SC SE Ves wa elelelyisfel “eLalaTelalelalstnlol 227006 0)s a se eo ee a ei CM MMMM 4656020) 20 9 lela ele Tes ee Teale . pete UELSGISY DSEE0 oa
PETE CE ESO ES BEETLE INR, NEE SSN oh Spe ET ate SD ERT re On tas . Soni et fl TLL DSSS GAN Se ec ea CER nT TSO OO a RSET ee ho nt wD DED eld occas nary eee cc gare relate te Dele L LATED ADEM CS NETS cS gg STALL SST ISTE DLT S De SEAT STU ESE DADE DAT CATA Te TRG aT Sa ST TS UDA ee Tag fella alla: oleae lee nn, ac ce eee Re eae MMIC E9706 2c yt Tn oa getn it gti lee sleet SADT aTeterelereTe Le rere
Serotec SIRE race SeSIEE SSIS RSS COIOE TESA ELSE SEER DICER STS UESE SETS oS ICSIRE IESE SIE SCERESECE: DOC OREOTSL SELLS SOLS ORSSEE SEES aearaa CITEREADER TESTS NY 8.002 8-0-0's"0 Soe ee act ect cca enece enna titre ntl eDe ae eace @eperegtr ect eieitracntatens nal t c c cecr OU USS Se Ta a a
Ar EER ETRann et DARN iO ratCOMBED SEAS EE otESE PS DE IETS AME aD -SCTE viele - SC NERMMMMIR fcr'sre ep OC ciel genre cerelea CiaCULES eee ETRE TS he els ae aleeDenese als #018ress 1 glalee ea heyn a ce ce hse! oc ecLSE] ca a ce ees Siac araMEE ara ee ar aEnSESE ERED GE DeaTT SESC RE AES SSOMR SEnee CRE TCE8rSO ACS eee 13200 eeale oa Tecerele ca ae NSflarececa Se RS SEMPRE el Tne ee aTp
ee slatels I LS tea alate oo STL AN TEacetals te go atele taew Lears aT~Tel oeet. Sie laeta ta ostate le afe. 7reat a6ae Lewoe SOare a oe accaaee«6a aeaees ehetse ria ae eee eegree ile Tee Talal elelal a ae Te ee ee. wines! aa ae a aeMisi ee ee tcrssiere ee a eae cecleacnneine ee eee eelegen tL! 8 Do Sa -qin wee‘ .WD . Rs es
CPIM nee STD ODDEST TESTS GS 2 STDS I SLEbay EUAt SSI eh hes GG OUetUELI O ce CUTL Iaaa ce cc oe Se ce aaaMERMMSR oe RR EM BERR SSRN A ssAc500 coyalee DALI geen sor AO CEelle ETRE DEEEIU TEOoUU OA hc a a aEO ALO S,!.8 les lee sine ease eelale a ele ol leeEU OS ne len tel ives Ue SEIS a le itesDEEDES Ube, Denittgs SESESha TT ENN On ne oe SUNG LUTEUS oYeo a aea caeARMM a aa aoe oe ae a RMEARMRMM RSD00.80 A? 2000 0tco 28 8c saliDE es bles ‘ iia or piapelelalelate he sale Deeleeedele ae :elca aeona DoD eleeelet la Dele Delle sele Ts Denn 4 5 SO a Cn DCT EEODL BTREGERPEER OPEONIICION c's cece eeeenoe fell ie 7 7 gle ee ey eae elle Ter aeUalelelelelalele ee aah varerer Se Sane ee a +elidel a wlatele Me tee 0416val a a led ae nae ead aaa Saar ane TteR naeEa annea aeole LP aS aD it le ie at as Ona RG nae SE atEOD tan ae ne ane OE ORME ICSECOO ERTEE ANITA,anny 26 517287 rere 7roe) . . - ee
TRE toyenTa ae ena a relaPIS taalSh ertET et CBEST et BetsEe TTS 1 Dee a 224 a osRE a i ae eeDEM PCE REMEMBER NHR 8 6 +8 2006 ee follle Pra coereees EO SE tsaotaca A LSE ET Tyas Wiatattestie areET ceINET ST See I ee2 WO TSE S a Od c ieee eece ara.SeccRSE NNoeEE MMM MMMM MERE RMS Secrest asDoe, hoot were 2 DEEN SSNS ate TSEC SEO SOIL SCOT HE ES SOS SERIE DCSE AEST AE NOSES IESE OREO SERCO CIC IE SEEDER OE IDEAL SCOOT SEO OE SESE TOSS URE OOD UC SEGUE SOSEUST CIE SOU SUHE SUSUR IE DENCE ODODE YS 8.90508 8.800820 To Meer piety rie stele wiaelele otale SaTe Eel clens tac elatetetatestetelehy ep sat Ty ana os elaeatelalte SELES a e eer Vb ig shh bb ind: ete Tale oda stele bey tater Det be NEE Susie bla ball ee coke DIDS aang TST ee 0 0 i oc ae coe ce ac oe ce aoa RMR MMMM Res 4 score el a TT Coe fl ELS ED ey on arer ar ar or tae - See ar Of a Se Ee OO ae or a ar ae ork ae ney cate ee ela ee rae ela 1 Ra 6 a ap a a er a ae te ee aa ae ne ea ee eer ner are SoD EDD ST Les 0) 00 9 or irre i. . Pee eer te teeta ected DI On Dee ed ee ne wed leie Dste! ae SEAR EET oo COLO a eS ce ee cc eee te nee een MRR AE RARER MRRERRERR ESR OC 82-0 a : eohélc Dyin AIR ORE DOESNT ADT Ee TNS CREE ete Ohta tn DRE CE CECE cc eS a a a a eS ES RR OEM MER MES REREAD RIS ocho ee ene ee SST onary SSOSRS SESE SE OSS SEDER SISA CAE SCSC SERCO LESE SESS SSO NESE AR SISIDCSALESCSESE SSCS BODES SCR OCRESO SE SEITRT aa Nea SOUS SRUODNEGEDRESORSESN SN N= h-—— aces sescvcrcciseesVotete Lele atrasteleleLelecalatetst Deco lel Dela ode ae ole Lele alate eed TD, AE TAD TASTE 000 Bede we
aTelelaleletelelefelelelelelelae etaatolder eels eletel seelel eat Telelaleelas eaea atal ese ele ale eta oy gaeate alee ee slalele oa sled lle oT eogaa eaeRat eee 0 MS 2S a i SeeBPnea aOse aera eeBR SEM athe St tTSUSE Nn Sea CEOSOE WERE OEICEOD WWD aos DREGE 'v ee ce ROS Pen ene Uae Tste. .ayVales ete RO ah ee ener eee OS ata te a tate ataOSD ee plate teeeal Tat enfetetlat etesloyee . ealease Volpe aT elspa aia: SEC EEO SOE RERD Benagree Te ee ar peasoer behe Serarer ESEtt OE a Ottee ROataBO ORS laterals lela Ist lat. a Teetale als Teale et Ua7e ce ne 97 on TL 0" aanent agagaaaaaa a dc aia ata ea aheceoeoeaeaae a ara an cotOE cc eh aiOO etaSO ateOCT Sane aT aE SetOL SP OPRECDLERAURRACGREE MISA.WK S" 7070707 7 an : . aD * - aes, Tate. at
De eee eare eetOMNae eeOT eels eae Tele lelaDla SER SOTA oSSascS SO eeaeEMM MEMS REMMI OOLE Cacs sess"scTe wenNDTe aera Eeepalate eR RTT SE NORE EERSDD ON OEDD Et eTesDS Seas LI aka ee aa eae cet SeaEe eae nate SP CCR ee Se RRL as ee OEM CMM MSC SOMMER Xie cnr socecr’e selswet ST aT: Wee Te ea a itd
Teta eeeNPI yar ES eeteMEE eee te tare DaeIGE at tee ee ale an nt NESE Sie LenSUE SETS acSOC oe eaMOM ae eeeMMR NOON CRN MIR RSM M RMMMMMER RANA 6 66 re el000 touseee esha SIs ieh PTE TS POE OL URE PROS ernegiene oatDOLCE Tides COUN enSTS CaerATS ah aeFOTO a a ceaaRI a aooi ae MICRMMMMMMMNMMMME ASR AE# 276.0806 . CIS ERE EE OE INE GTS SMES PEC ULB EEL EN ENE DEEN SUEDE I SUCS UG att oN rt US DED AD) STUD ee U STEEL TLE TLS ae a aa aD Baa Oa SISOS OES EC SaaS RSS SO ER RSME ess 9 8.008.000 80000 fete ts iter vetar ies SS NSSRSERCSSS SIE gS SOOSSES SES TEDOS SEASONS SEES SOO SOUNS aC NUSSCO SERUM AL EOS IOLOOEC SEES SEDISSED ESP OONOSSESNCESDESSONEDE DOSNT ICS «5a. 6oSoet-seo-e soon stscsseersecesciescseatetacete ce cepteesc ete ee aca ne eee SC eee Be ete e ) Donne negenhits RERERNRMMMAM MEME eS csr tte ice ee De en en vale
MEE aSIR DIES AIS De SIDE LOTS ELS ETS A a er ra eee eS ee eee eS Ree eae RR RESERMEREEARERE RNS rerscccsceeci ng a ene PRs SORE TASER SOOT STII SESRSUICSESTSC ESSEC RASESESE SCORE Ste MSOC ECS SO SCLC ROE OE RE CREE CEE MARU MERE RERARE SDC °C! 0.2 Teese eee eet Feta I LTTE TE OLE OTOL gS to rc rc cc rc cr cr rr cons Une ScaCtESeSSiC sec SSRIESE SSD ELSE SERLGESESuSISIRSE SENDS SOOT Arsen SesSSISS SESE SRDS SS SEIOSES EE ERISS SEES OEE SILES SRG SORE COLE SES BRE TREO 88 8-8 8-6 erate ere te elect ene a nae eee lalla TEL DEG SIE LISI TUL SOS rrr Bott Sas de ehLNS
TTS oe ete ona ee tps ee ae Late De a Te eToTATe aD oTaletece Latah Tetalateteetelety ets atels aa tea etal sa a ale TUN CADE Nes SERCO Se a SSE ee Sc ae a SO SE SEE DEERE OP MSMR MRE ARR EM MN vee ee ee ny Sry SSeS aIi See a OSLaI SPS ane SLOOST URGES ENaBESCTERE RSC REIS SOSESnC STEERER Se SESS ai ESES ELSES SSIS SRRCIES ESR URI SODESEIEDE SOO EAESEIE CLE POSER ERE SRR RRMEESR OSSD No 9 ‘ al.ee ee pies ee vrs. .:GN Neeleee 17]oe RO a aaaa ENS RP ar DhSRS Sateen aeReere arOO eee eS thaMM ah s'e'o"t srrele eso rin te. . oa . . .oo wendy AEG RE CEE EES A Ee BE UE WTAE OORT Tey ai aR Re RRR OR RY ravececatetecatarecerecatensses EER KE RR RERMER ARERR RE RM MMMM CEE RENN MMMM MMH REM CMOS ares 4. nce e+ . . ra
Penh ee ic coneeis ONAL Ee EET ED DOPE OPER RNR A RAE A SERRE REA ALA) RRse ERR NTA” SARAPre Nae Ree R RESO RASSAAT sr see EEN tel : fesoa OSele lies. os DDI wey tayDIS voyDINNER eet te StL Debt net SRPMDEDRS SES NS 'NCA 0'C0Ra eleeRe oleTe-ecece™sieceis tcrleceleie ceeARR ietace brace telaRR eteORS ere bree OF AeNRE He RMN 888 BRO eReEMEMERRERRR 0 a6 ee BEER ECLA
SEOs SRN aad isoyWei SAIEGS Tas20) 9 oo a isCUCL tle a SRR RRR REee RRR RRR ERED Ns SERENE MERRY RENE H tse SS GUISE | DEES NIGge Girolliens Og ha ENTE CE SRO aSRRR RUT eae RCRA RSA ARREARS BN.” KRAMER REIRRS N*MREREAD RRMA E RR aS eaeMSMEREBRMERE Ree ORAM SRR R SE REG RCS vets tccce . oo- ae rd SoS TE te e ethers oe 4 SISTED Soshstete ete atetescete a Sealetccatety ia ete asotecataleteleletataveleiateleieieleleteceiaiseter canara ecnsereiacett alleles ienacsleecerscerale 9920 010 CE AOS 2 ERO RNP? SOR Ne RN NCA RARE TO LH ws .- . J EIEN ECR SDD UTTAR IY GEREN asian Ge ainsi Ghent SRN RARER ERG RS SSE ER RSM NER RENE Ans SM RRER ERS: RRR ROR SRSA REE HR RRS SEEMS MBER ERASE 800080507 a : : ne Noa
er NT aT TCA RR iJOE RRRALIS RR AANA RAE RRRCee SERea RAK R ORME RENN SC RRR T REMAN MRS MMR N REM SRReee Ce wy els ' :. ne : ” .CEE, . elle fine innEN tyeS oteETO whos ie SOY OS ID NTC RENE SS elRsaec'saISOR eR ERE R ERR 8 «SSB aLE*, | Ae Se RESMM SS ati tao MRI SE SS SN rita
aaa Ce DaleAL flaRg el Ae BUGS oe OaARSE eee RC RRR Hat eSCRRRER sc ON RR RRR RRAMS MMRME MRM MDMEMMMEM SN I Ao SOIC 68.606 . . an ERT OEReine CEE MDS nD 0 el SURES RRR RRRKR RSEERS RR RNAS. ERGs. SRE RM RAMEME RP ENBR MREMURABMERERORREDRMNEAEREER IKslon: SF . ane sear etl estate foto atetg hey arin icare TO ete a else ig ete ates plete elotete tate RE NAER RARE N RAK ARE RARE ARR MER RAS AP ee RI eR Sana a RR BRN. 9 RIE, t+ SRR eS Meee on EMM FCS e so 7 Co . _ estes
PORE Wen inUUM nce Na ee SD EBL intESUL aaREADER RR a RORAACS RRR RK SRRROTI ROE :RRND SSR RRR RES SS os. sRS SSRIS Ct.ESTRREREREDRES S RS RS SC RS MASSES 588202020 7 woe ney We Naess ELE TOTS UTS TS 8tCUE a ee RRsaci RRA RRO CREE CERES ROR RORREROE DEEP SESH cress US-aeons peta GE late : ee ete ahetetate weet Me lee SSMU MU RRMECRM OEMS S.§-6.5-0.0-0.6.7'0-008°o uvaTereceresecaloLN 8-H 8.8 0/6274. 00009,0,0,808,9.8,079=6,000:0.0,6,400,0,8,0,4, 8. 60978,010- 008" 19-8888 20 08RD OP tA A BORE tots A HLA Ea A at tate et atatet rahi atr oc rbat ato atat ant eae ee aan we . . . . me. MCU Gs EER CPA E ED GE MAGNE Seats § Moet PTs cD LD oy SS RRR Me RE RME RRR CRM ARR NRE RM RK SEARO CE Te s,)) KRM RAS S61 SPER RR EER RN A MRS MAN R MME MBM SMM MKB NG F.2,6 80608 oo 2 oa yD
eee De Ssee eNO scia et aaa Sa SC SOE SL OM SEM SORES EMEC 0-000 0.8,0.9.9.1.8_61910 0.819.010 0.".0.9.8_9.0,2_074 19, 0,0,9.9,9.0_4_6,876, 0007 0.0.8_0.8.0.#,6.9,029,9,8.9. 1,8 4,8 008 828 8 9 M8300. 8 6 5 RAO 8s 1A ene ato ata gee Tene AEDT EEE ETI CET OTITE EEO 0/0689 60 ER vlee ‘ae . Be NTT SSASige Seialeeee ane Noe ae TATA SI 8 SISTER SS OR SO eR De RRR PRR ENE NARS ES SR SIREN RSME 0.°. SERENA 1.) ORR RR RR RES R ERAN CRN RSME SSREMEE RUA sccrejtesice r= fe . ern
MES ISSUE DN TE So IOS ti lal irl ASI I oa SOS ER RR SS SES aN eA TNR oe 00s tH ORS. 1 RR ESSERE REESE MERRION sn, : ene
TL OTT MT TE LOE EE CTL UE acenaneegererestcrceranere gsreriravandrtestererayaveneeirdfercassstctnerecaeraiaresotcd tres tat fc entueet e aaseyt to USEMMIR a 00°80 MOER H80 0,008 8 0 eas a aceon tea ON FA IN 000 OO . : . a De
SSeaR Seat SDSS OE SC SCN ORE OSE SSCA OS EU POE EOE TO MC ROURLEESE >. 6-9,.0-6-0.1.0,0.9.8,0.0.0°8.0°800.010,0,0_9.9.8,0, 07050, 116.8090 6.0°8.0°0/8,006,8.6,006.9,009,8,0,0,0, 8,082 AAG H 3 Et 2.00100, te OR OR RRMRDRMROIES SS MROSDIED oo Sevaahane“aeoTeTa'sia of rele ceTocicateleeleree aCe eres ete aS ee aR noe : Bhk
lea lesiiy erent fittitys vo ESeeIaSEaS I RESEDESE EIEN Se SERIES EMR MESESE S's" 0°s"uecoce“¥S010°¢-9-0-0rere“y"eerace“e0.#re"e.0.€-9.0-0/8 0°00. 0.80F- 0,008 8-8 -4-078,ar8 b_ Pla L8.€, 810-079, aL0 0_¥ 0-0, 6,9, 8 RSIS, SS SCKICSELS O28 078 9 8084 6b aca c acd a 70044 A704 aoa, A gd Os cr . _ CO SOS TCE ES UE ee ETN thESIROUSSRUMEMEMMMODESSR se"y osesesacscacececviocsveetestersscesicrensercneecseseececnetetrsefctsecec tc 4-ava 0c¥:erecacbvasessterhea.¢cty4-0-07a)0"5° 1-9-0. 000 MR RR SSR80 992070000002 ac gna oATenaeaeTeTN ere ece ICE T8160 CALAe NC 0C8: .0A SEEOE Merete eesPrt sa ae veeEe ls vate ee POP USE SHRE SCRE SU RESS IDIOT OREAv ORG ESRIC'6 3" e"'0"6,0,0-0°672°0.a"c ae 0 2-1-0 0-3,074,01078.6°0.4-n1010-0,0/8,0.0.8, 874-4" aa ha 4°8_8° #0, 4,076. 070,070) 6 0 0S aR a 609 IER DRSESDOGIDE.S, ©8878 oe are eae ta ycten oo 88 So . oe
ts ete . rsvfs . . .atetats . . . - +PRRBNREBRRER A SRE LE a aad SP ot sceee Pe Setate OECesena WP WE Bemete St OP AOEbibl NON lS pe i laOT a REST RAISBSN te ‘. .. .Spree cee * aVale te weee: oeetat TDaad voce rene Uemet nt OG tnet tea ett=tlDO LettOt ti. Ee hc